Mar 4, 2015 - PCR of ATrich DNAанаMolecular Biology data:text/html;charset=utf8 ... PCR of ATrich DNAанаMolecular Biology data:text/html;charset=utf8 ...
3/4/2015
PCR of ATrich DNA Molecular Biology
PCR of ATrich DNA
(Nov/15/2007 )
Dear community members, I want my students to amplify (and later on clone) several genes from lactic acid bacteria. These organisms have a low GC content. Especially the regions downstream of the genes I want to clone are very AT rich. Of course, this poses problems in the design of the PCR primers. It is difficult to find regions containing sufficient G's and C's to be able to design primers with a GC content that is within the range that many sources recommend for good PCR primers, i.e. say 35 tot 55% GC. My solution to this problem is to design longer primers (to get a satisfactory Tm) that at least contain one G or C at the 3' end. This resulted in primers like this: ttctactaactcttttttatttttag (Tm approx. 60 degrees, GC%=20) or e.g. tcgtatgaaatgattatttattttc (Tm approx. 60 degrees, GC%=20) Does any one have experience in amplyfing ATrich DNA? If so, what do you think of my solution? Am I doing it right or would you suggest to look harder for a region with a higher GC content to prevent aspecific reactions? Maybe I could find a region with a higher GC% farther downstream, but I prefer the region I have chosen now, because I know there are no sequence differences between strains in that region and I want to PCR the genes from several strains. I'm afraid that there will be sequence differences between strains in the region farther downstream, which could result in no primer annealing. The obvious solution is to just try it and order new primers if it doesn't work. However, this is a student project and the amount of time they have is limited. Therefore, I want to use the strategy with the highest chance of success. Thanks very much, Peter Arzeecue