A cell penetrating heme oxygenase protein protects heart ... - Nature

Gene Therapy (2009) 16, 320–328 & 2009 Macmillan Publishers Limited All rights reserved 0969-7128/09 $32.00 www.nature.com/gt

ORIGINAL ARTICLE

A cell penetrating heme oxygenase protein protects heart graft against ischemia/reperfusion injury J Ma1, CK Lau2, A Obed1, A Dada1, A Doenecke1, ST Fan2, HJ Schlitt1 and TY Tsui1 1

Department of Surgery, Regensburg University Medical Center, Regensburg, Germany and 2Department of Surgery, The University of Hong Kong, Hong Kong SAR, China

Ischemia/reperfusion (I/R) injury is an unavoidable barrier that significantly affects outcome of solid organ transplantation. Here, we establish a protein transduction system to extend graft preservation time and to prevent I/R injury in heart transplantation. We generated a recombinant heme oxygenase-1 (HO-1) protein containing a modified protein transduction domain (PTD). PTD could cross cover cell membrane and carry target molecule to parenchymal cells of cold-preserved heart grafts. The newly generated PTD-HO-1 protein localized mainly in subcellular membrane organelle and nucleus after delivery that significantly prolonged cold preservation of heart grafts. This effect was associated with significantly less endothelial cell activation, less neutrophil and macrophage infiltration in PTD-HO-1-transduced

heart grafts after reperfusion as compared with controls. In addition, transduction of PTD-HO-1 protein to heart graft significantly suppressed the I/R injury-associated myocardiocyte apoptosis. The infarct areas of heart graft after I/R injury were significantly reduced after PTD-HO-1 protein treatment. We show here for the first time that PTD can maintain its biological activities during cold preservation. Transduction of cell penetrating HO-1 protein significantly prolongs the cold preservation time and protects the graft from the I/R injury. This approach represents a novel method for the improvement of the overall outcome of organ transplantation. Gene Therapy (2009) 16, 320–328; doi:10.1038/gt.2008.162; published online 6 November 2008

Keywords: heart transplantation; ischemia/reperfusion injury; heme oxygenase-1; protein delivery

Introduction Ischemia/reperfusion (I/R) injury is an unavoidable barrier in solid organ transplantation. This antigenindependent organ injury initiates from endothelial cell activation and apoptosis, caused by depletion of oxygen and energy. After recirculation, activated endothelial cells quickly express endothelial adhesion molecules such as P-selectin and intercellular adhesion molecule-1 (ICAM-1) onto the cell surface.1,2 Adherent leukocytes, especially neutrophils are recruited and accumulated in the reperfused tissue through their interaction with endothelial adhesion molecules. Neutrophils release oxygen free radicals and inflammatory mediators and cause microvascular damage by infiltrating the injured endothelial cells and obstructing small vessels.3,4 Infiltration and activation of macrophages release cytokines and increase oxidative pressure to transplanted organs.5 The overall effects of these insults will lead to parenchymal cell death and graft dysfunction.6,7 Heme oxygenase-1 (HO-1) is an inducible enzyme that degrades heme into carbon monoxide, biliverdin/ Correspondence: Dr TY Tsui, Department of Surgery, Regensburg University Medical Center, Franz-Josef-Strauss-Allee 11, Regensburg 93053, Germany. E-mail: [email protected] Received 25 March 2008; revised 16 September 2008; accepted 18 September 2008; published online 6 November 2008

bilirubin and free iron.8 Functional analysis of human HO-1 protein shows that the twenty-fifth and one hundred and thirty second histidines are key amino acids for the HO-1 to exert its enzymatic activities.9,10 There are various forms of stress or tissue injury that can induce the expression of HO-1. Copious studies show that HO-1 and its products can maintain cellular homeostasis based on its anti-inflammatory,11 antioxidative12,13 and/or antiapoptotic14,15 properties. In different models of transplantation, induction of HO-1 can protect grafts from I/R injury,16–18 acute14,19 and chronic rejection.20 Protein transduction domains (PTDs) are short peptides which can freely pass through cell membrane independent of classical receptors or endocytosis.21 Although the detailed mechanism of this type of transduction is still unclear, PTDs can be used as a carrier to deliver macromolecules, such as functional proteins into cells, even at whole body scale.22,23 Among PTDs, the PTD containing 11 amino acids (peptide sequence: YGRKKRRQRRR) from HIV trans-activator (TAT/PTD) protein is the most extensively studied24,25 peptide. In this study, we applied a modified TAT/PTD, arbitrarily named PTD (peptide sequence: YARAAARQARA), which has a transduction efficiency 33 times as higher as that of the original TAT/PTD.26 We show here that transduction of a newly generated recombinant HO-1 protein containing modified PTD can prolong extreme cold preservation of an organ and protect it from I/R injury after transplantation.

A novel method to prevent I/R injury J Ma et al

Results PTD maintains its transduction ability during cold preservation The generated recombinant proteins have an N-terminal 6 ! histidine (6 ! His) tag, followed by a PTD tag (YARAAARQARA) and the peptide sequences of HO-1, mutant HO-1 (HO-1(M)), EGFP, or b-Gal. On both sides of the PTD tag, a single residue of glycine was introduced to increase the rotation flexibility of the PTD tag (Figure 1a). The overnight culture of the E. coli bacteria containing pET-28b(+)-PTD-HO-1 plasmids with optimal working concentration of IPTG (0.7 mM) turned into green color, due to the formed biliverdin, one of the

metabolites of HO-1; whereas the color of the same bacteria culture without IPTG induction remained yellow (Figure 1b). The quality of purified PTD-EGFP, PTD-HO-1 and PTD-HO-1(M) proteins were demonstrated at a 12% sodium dodecyl sulfate polyacrylamide gel electropheresis (SDS-PAGE) gel system, which was stained with Coomassie blue (Figure 1c) or was transferred to a nitrocellulose membrane and detected with anti-human HO-1 antibody for western blot (Figure 1d). Transduction of 293 cells with PTD-HO-1 protein at 37 1C or at 4 1C showed an average enzymatic activity of HO-1 (by measurement of generated bilirubin) at 693.8 and 429.5 pmol mg h"1, respectively (Figure 1e).

321

Subcellular localization of target HO-1 protein through PTD-mediated protein transduction To examine the transduction capability of generated PTD-HO-1 protein, primary human endothelial cells were treated either with CoPPIX for the induction of endogenous HO-1 or exogenous HO-1 through PTDmediated protein transduction for 24 h. The localization of target protein was then detected by western blot after separation of subcellular protein fractions. As shown in Figure 2a, the PTD-mediated HO-1 protein transduction mainly located in membrane organelles (including endoplasmic reticulum), nucleus and cytoskeleton. The subcellular localization of HO-1 protein through PTDmediated protein transduction was comparable with those of endogenous HO-1 protein induced by CoPPIX, by which HO-1 was mainly detected in membrane organelles and nucleus, less was detected in cytoskeleton. In contrast, there was minimal expression of endogenous HO-1 protein in membrane organelles in cells treated with control protein. The amount of b-actin in the cytoplasm fraction was used as a loading control (Figure 2b).

Figure 1 Design, expression and purification of PTD-fused recombinant proteins. (a) A schema shows the linearized structure of PTD-fused recombinant proteins. His, histidine; PTD, protein transduction domain; EGFP, enhanced green fluorescent protein; bGal, b-galactosidase; HO-1, heme oxygenase-1; HO-1(M), mutant heme oxygenase-1 which has no HO enzymatic function. Please note the length of schema is not correlated with the actual length of each domain. (b) Overnight culture of pET-28b(+)-PTD-HO-1 containing bacteria induced by IPTG turned green, because of the generated biliverdin by HO-1 enzymatic function; without IPTG induction, the bacteria culture maintained in yellow color. (c) Purified proteins were analyzed by SDS-PAGE gel (stained with Coomassie blue) and (d) by western blotting with the detecting antibody for HO-1. (e) The HO-1 enzymatic activity of EGFP or HO1-transduced 293 cells. When transduction was done at 37 1C, the average HO-1 enzymatic activities of no transduction, transduction of PTD-EGFP or PTD-HO-1 was 24.75, 20 or 693.75 pmol mg h"1, respectively. When the transduction was performed at 4 1C, the enzymatic activity of HO-1-transduced 293 cells was 429.5 pmol mg h"1. # and *Po0.01 as PTD-HO-1 (37 1C) or PTDHO-1 (4 1C) compared with no transduction or PTD-EGFP (37 1C) groups, n ¼ 3 for each group.

Figure 2 Subcellular localization of targeted HO-1 protein. HUVEC cells were treated either with CoPPIX (20 mM), PTD-EGFP (1 mg ml"1) or PTD-HO-1 (1 mg ml"1) for 24 h. Cytosolic proteins (CP), membranes and membrane organelles (M), nucleic proteins (NP) and cytoskeleton (CS) fractions were separated (see Materials and methods). (a) Amount of HO-1 protein in different subcellular fractions was analyzed by western blotting. (b) b-actin in the cytoskeleton fraction was used as a loading control. Gene Therapy


322

Transduction of HO-1 protein to heart grafts during cold preservation Although it has been shown that PTD can carry target molecule to cell/tissue in vivo, it is still unclear whether it is able to maintain its function in a cold-preserved organ. In this study, PTD-EGFP or PTD-HO-1 was injected through the coronary artery after the collection of the heart graft in a rat model. Heart grafts were preserved in cold HTK solution. The transduction ability of PTD was first examined at different time points after administration of PTD-EGFP by fluorescent microscopy. The EGFP protein was found in the vessel wall of graft as early as 10 min after administration. At 30 min, the adjacent cardiomyocytes around the vessels were found to be positive for EGFP protein. The positive cardiomyocytes increased markedly at 1 h. At this time point, approximately 20–30% parenchymal cells of the heart graft showed an EGFP signal. This strong EGFP signal persisted for at least 6 h at cold preservation (Figure 3a). In parallel, 18 h after administration of PTD-HO-1 to heart grafts, the blood vessels and cardiomyocytes were positive for PTD-HO-1, as shown in immunostaining (Figure 3b). Protein extract from these PTD-HO-1-transduced heart grafts contained high concentration of HO-1 protein, as detected by western blotting, whereas no HO-1 protein was detected in nontransduced or PTD-EGFP-transduced grafts (Figure 3c). The average HO enzymatic activity of PTD-HO-1transduced grafts measured by the generated bilirubin in the presence of heme was 116.7 pmol mg h"1, whereas the HO enzymatic activity of non-transduced or PTDEGFP-transduced grafts were 5.6 and 8.4 pmol mg h"1, respectively (n ¼ 3, Po0.01). PTD-HO-1 prolongs cold preservation time of heart grafts The heart grafts received PTD-EGFP or PTD-HO-1 (200 mg per graft) through the coronary artery and were cold-preserved for 15 or 18 h before transplantation. After 15 h of preservation, six of six PTD-HO-1-transduced grafts survived after reperfusion, whereas only three of six non-transduced grafts and three of seven PTD-EGFP-transduced grafts survived after reperfusion (Table 1). When the preservation time was extended to 18 h, nine of nine PTD-HO-1-transduced heart grafts survived after reperfusion, whereas none of non-transduced grafts (n ¼ 9) and none of PTD-HO-1(M)-transduced grafts (grafts transduced with mutant HO-1 protein, which has non-enzymatic activities of HO) survived after reperfusion (n ¼ 3, Po0.05, Table 2). In addition, one of nine PTD-EGFP-transduced grafts survived after reperfusion (Po0.01). PTD-HO-1 suppresses endothelial cell activation and early neutrophil infiltration after I/R To explore the possible mechanisms that may be involved in PTD-HO-1 mediated beneficial effects in I/R injury, we examine the histomorphology of transplanted heart grafts after 15 h of cold preservation and 2 h of reperfusion. Transduction of PTD-HO-1 was associated with markedly decreased ICAM-1 expression on the surface of endothelia of blood vessels, as compared with that in non-transduced or PTD-EGFP-

Gene Therapy

Figure 3 PTD can carry target protein to parenchyma of coldpreserved heart grafts. (A) Transduction of PTD-EGFP in coldpreserved heart grafts. (a) No transduction, (b) 100 mg for 1 h, (c) 200 mg for 1 h, (d) 100 mg for 10 min, (e) 100 mg for 30 min and (f) 100 mg for 6 h (scale bar ¼ 40 mm). (B) Transduction of PTD-HO-1 in cold-preserved heart grafts. The left is the heart graft without transduction, and the right is with 200 mg PTD-HO-1 at 18 h after administration. Arrow highlights the transduction of PTD-HO1 in a blood vessel (scale bars ¼ 40 mM). (C) HO-1 protein levels of no transduction (HTK solution only), PTD-EGFP or PTD-HO-1transduced heart grafts were analyzed by western blotting. Three grafts from each group were shown here. (D) The HO-1 enzymatic activities of no transduction, PTD-EGFP or PTD-HO-1-transduced cold-preserved heart grafts were 5.6, 8.4 and 116.7 pmol mg h"1, respectively (n ¼ 3). # versus PTD-EGFP or HTK, Po0.01.

transduced grafts (Figure 4a). Interestingly, non-transduced or PTD-EGFP-transduced heart grafts showed high numbers of infiltrating and activated neutrophils (MPO positive). In contrast, transduction of PTD-HO-1 accompanied with only small amount of neutrophils that attached to the endothelia of graft vessels or infiltrated into myocardial tissues (Po0.01 as compared with nontransduced or PTD-EGFP-transduced grafts, Figure 4b). In addition, there were also significantly less infiltrating leukocytes (CD45 positive) or macrophages (CD68 positive) in PTD-HO-1-transduced grafts as compared with non-transduced or PTD-EGFP-transduced grafts (Figures 4c and d).


323 Table 1 The survival of heart grafts (15 h of cold ischemia) after Txa Group

Treatment

n

Survival after reperfusion (%)

7-day survival (%)

P-valueb

1 2 3

HTK solution PTD-EGFP PTD-HO-1

6 7 6

3/6 (50) 3/7 (43) 6/6 (100)

3/6 (0) 3/7 (11) 6/6 (100)

vs group 2: 0.0325

7-day survival (%)

P-valueb

a

Transduction of PTD-HO-1 prolonged cold preservation time of heart grafts. Comparisons of Kaplan–Meier survival curves with log-rank test.

b

Table 2 The survival of heart grafts (18 h of cold ischemia) after Txa Group

Treatment

n

1 2 3 4

HTK solution PTD-EGFP PTD-HO-1 PTD-HO-1(M)

9 9 9 3

a

Survival after reperfusion (%) 0/9 1/9 9/9 0/3

(0) (11) (100) (0)

0/9 1/9 9/9 0/3

(0) (11) (100) (0)

vs group 2: 0.0013 vs group 3: 0.0068

Transduction of PTD-HO-1 prolonged extreme cold preservation time of heart grafts. Comparisons of Kaplan–Meier survival curves with log-rank test.

b

PTD-HO-1 suppresses the I/R-associated apoptosis I/R injury causes apoptosis of parenchymal cells of a transplant organ. After 15 h of cold ischemia and 2 h of reperfusion led to a massive parenchymal cell apoptosis in non-transduced or PTD-bGal-transduced grafts. But, transduction of the heart graft with PTD-HO-1 significantly reduced the number of apoptotic cells in the grafts (Figure 5a). There were average 50.0% parenchymal cells showing TUNEL positive in the non-transduced grafts and 52.4% in PTD-bGal-transduced grafts (n ¼ 3), whereas there were only 18.0% parenchymal cells showing TUNEL positive in PTD-HO-1-transduced grafts (n ¼ 3, Po0.01, Figure 5b). The less apoptotic cells detected in PTD-HO-1-transduced grafts were associated with the induction of Bcl-xL and Bcl-2 expression, as detected by western blot (Figure 5c). In parallel, there were significantly less infarct areas (5.4%, n ¼ 3) in PTD-HO-1-transduced grafts as compared with non-transduced (37.3%) or PTD-EGFP-transduced grafts (35%, n ¼ 3, Po0.01, Figures 5d and e). The sera of the recipients were collected and measured for the level of CK-MB. The average levels of CK-MB of rats bearing non-transduced or PTD-EGFP-transduced grafts were 2201.6 or 2154.4 IU l"1, respectively. In contrast, the levels of CK-MB in rats bearing PTD-HO-1-transduced grafts were 1094.5 IU l"1 (n ¼ 6, Po0.05, Figure 5f).

Discussion With the persistent demand for transplant organs, the criteria for donor acceptance are continuously being expanded. Prolonged preservation and high-risk organs are included for transplantation, which may cause intensive I/R injury during transplantation.2 I/R injury will not only cause undesirable organ loss in the early postoperative phase, but also compromise the outcome of long-term survival of the transplant.27 Here, we show that transduction of a newly generated HO-1 protein with potential for clinical application can prolong cold preservation of an organ and protect it from I/R injury after transplantation.

Previous studies have shown that induction of HO-1 overexpression in grafts could protect grafts from I/R injury.16–18,28–30 In most of these studies, the introduction of HO-1 in grafts is achieved by metalloporphyrin (mainly cobalt protoporphyrin), gene transfer or transgenic engineering. These methods need to treat grafts in advance or are limited on transgenic animal models. Here, we demonstrate a clinically practical method. The PTD can quickly transduce cells or tissues with fused protein at 4 1C (Figures 1–3). In addition, PTD-fused proteins can maintain their biological functions after their entry into the cells. The beneficial properties of PTD make it possible to be applied in the field of organ transplantation. A single dose of PTD-HO-1 (200 mg) administration at the time of organ collection is sufficient to prolong the preservation time of grafts and prevent these grafts from I/R injury in our model. There are several advantages to use protein transduction technology to introduce functional proteins into grafts for the prevention of the I/R injury. First, protein transduction is quickly achieved. As we have shown, PTD-EGFP was found on the blood vessels only 10 min after administration. At 1 h after administration, blood vessels and more than 20% myocardial cells were positive for PTD-EGFP (Figure 2). The method needs no pre-conditioning for donors, thus it is more practical for the clinical application. Second, by protein transduction, one may determine the quantity of protein to introduce into grafts. The transduction of PTD-fused protein is dose-dependent, so that the intracellular levels of pharmaceutically active proteins are more easily controlled by protein transduction than by chemical induction or gene transfer, as the latter mainly depends on cellular machinery of graft to express target proteins. Third, transduction of purified proteins is a safe procedure as compared with metalloporphyrin induction31 or viral vector-mediated gene transfer.32 The benefit of transduction of HO-1 protein against I/R injury is partially through HO-1’s anti-inflammatory and antioxidative properties. Transduction of HO-1 suppresses I/R-induced endothelial activation and Gene Therapy


324

Figure 4 Histomorphology of grafts after transplantation. (a) Grafts were cold preserved for 15 h and then transplanted into syngeneic rats. Two hours after transplantation, expression of CD54 in grafts or biomarkers (MPO, CD45 or CD68) of infiltrating cells were examined (scale bars ¼ 40 mM). Representative results from three grafts per group are shown here. (b–d) The numbers of infiltrating cells (MPO, CD45 or CD68 positive) per ! 200 field were quantized. 15 random fields from three grafts were counted. # versus HTK or PTD-EGFP controls, Po0.01.

subsequently the infiltration of neutrophils, leucocytes and macrophage into the revascularized grafts (Figure 4). This protective effect of HO-1 may also be from its antiapoptosis effect. I/R injury causes apoptosis and necrosis of parenchymal cells, but HO-1 can counter this kind of injury through its cell protective properties. The antiapoptosis effect of HO-1 at histology levels (TUNEL assay, Figures 5a and b) is accordant with the observation of increased cell survival promoting proteins, such as Bcl-xL and Bcl-2, and less infarction at 7 days after transplantation (Figures 5c–e) and lower levels of CK-MB in the recipient’s sera at 2 h after transplantation (Figure 5f) as well. Interestingly, the beneficial effects of transduced HO-1 protein depend mainly on its enzymatic activity, as transduction of mutant HO-1 protein (without enzymatic activity) lost the protective effects of HO-1 protein in the scenario of transplant-associated I/R injury. The findings indicate the dominant role of enzymatic activities of generated protein. In addition, Gene Therapy

the enzymatic products of HO may be used to achieve similar effects.15 Taken together, protein transduction represents a novel method in the prevention of the I/R injury in transplantation setting. Transduction of a functional HO1 protein significantly suppresses cellular infiltration and parenchymal cell apoptosis in a graft suffering from I/R injury. A clinical protocol can be established to extend the cold preservation of grafts and to reduce the I/R injury by using marginal grafts in organ transplantation.

Materials and Methods Cloning of protein expression vectors A 72-mer forward primer containing the oligonucleotide for PTD peptide and endonuclease sites for NheI and EcoRI (50 -AAGCTAGCGGCTATGCTCGCGCTGCTGCTC GCCAGGCTCGCGCTGGTGAATTCCGCCACATGGTG


325

Figure 5 Transduction of HO-1 protected grafts from I/R injury. (a) PTD-HO-1 inhibited apoptosis of parenchymal cells (15 h of cold preservation; 2 h after transplantation). Upper photographs showed nuclei of apoptotic cells (FITC positive) and lower photographs showed all cell nuclei (DAPI positive) in the same field (scale bar ¼ 40 mM). Representative results from three grafts per group are shown here. (b) The apoptotic index (the ration of apoptotic cells to total cells) of no transduction, PTD-bGal or PTD-HO-1-transduced grafts were compared, Po0.01 as PTD-HO-1 compared with no transduction or PTD-bGal-transduced groups. Random fields (15) from three grafts were counted. (c) Detection of the levels of Bcl-xL and Bcl-2 expression in grafts (15 h of cold preservation and 2 h after transplantation). b-actin was used as loading control. (d) 7 days after transplantation, infarction in survival grafts were analyzed by TTC staining (n ¼ 3). (e) The percentage of myocardial infarct area to total section area were compared, #Po0.01 as PTD-HO-1-transduced group compared with no transduction or PTD-EGFP-transduced groups. (f) Serum CK-MB levels (15 h of cold preservation and 2 h after transplantation) were shown in scatter plot. Serum CK-MB levels of normal rats (without transplantation) are indicated as baseline levels. #Po0.01 as PTD-HO-1-transduced group compared with no transduction or PTD-EGFP-transduced groups.

AGCAAGG-30 ) and a 29-mer reversed primer containing endonuclease site for HindIII (50 -GCAAGCTTCTTGTA CAGCTCGTCCATGCC-30 ) were used to amplify DNA fragment from a template DNA containing EGFP gene (pEGFP-C3, Clontech Laboratories, Palo Alto, CA, USA) by polymerase chain reaction (PCR) under optimal conditions. Taq polymerase (Qiagen, Hilden, Germany) was used in PCRs. The PCR product was ligated into a TOPO-TA cloning vector (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s instructions. Positive plasmids were treated with sufficient NheI and HindIII endonucleases, then the DNA fragment of PTDEGFP was inserted into a pET-28b(+) expression plasmid (Novagen, Wisconsin, WI, USA). A forward primer (50 -TAGAATTCATGGAGCGTCCGCAACCCGAC-30 ) and a reversed primer (50 -CGAAGCTTCATGGCATAAAGCC CTACAGC-30 ) were used to amplify DNA fragments of human HO-1 or mutant HO-1 by PCR. Human HO-1 gene cloned from human placental cDNA library15 was used as DNA templates to amplify HO-1. Gene for mutant HO-1 (without enzymatic activity, H25A and H132A) was obtained by PCR-based site-directed mutagenesis,33 by using the primer sets as 50 -ACCAAG GAGGTGGCCACCCAGGCAG-30 and 50 -CTGCCTGGG TGGCCACCTCCTTGGT-30 for H25A mutagenesis and 50 -GCTGCTGGTGGCCGCCGCCTACACC-30 and 50 -GG TGTAGGCGGCGGCCACCAGCAGC-30 for H132A mutagenesis. A forward primer (50 -GCGAATTCGTCACC

ATGTCGTTTACTTTG-30 ) and a reversed primer (50 GCAAGCTTTTATTTTTGACACCAGACCAA-30 ) were used to amplify for DNA fragments of b-Gal by PCR, by using the pSV-b-Galactosidase vector (Promega, Mannheim, Germany) as DNA templates. pET-28b(+)PTD-EGFP plasmid was opened by EcoRI and HindIII and the DNA fragment containing pET-28b(+)-PTD was purified by a gel purification kit (Qiagen, Hilden, Germany). DNA fragment of human HO-1, mutant HO1 or b-Gal was ligated with pET-28b(+)-PTD to generate expression plasmids for PTD-HO-1, PTD-HO-1(M) or PTD-bGal. Accuracy of these plasmids was confirmed by DNA sequencing (GeneArt, Regensburg, Germany).

Recombinant protein expression and purification Expression plasmids were transformed into an E. coli strain, Rosetta(DE3)pLysS (Novagen, Wisconsin, WI, USA). The transformed bacteria were cultured in LB Broth with 50 mg ml"1 kanamycin at 37 1C, with 200 r.p.m. vibration. When optical density of the bacteria at 590 nm reached 0.6, 0.7 mM of Isopropy b-D-thiogalactoside (IPTG) was added into the culture to induce the expression of recombinant proteins and the bacteria were cultured overnight. The whole procedure of purification was carried out at 4 1C. A releasing buffer containing PBS, pH 7.4, 20 mM imidazole, 6 M urea and complete protease inhibitors without EDTA (Roche, Mannheim, Germany) was used Gene Therapy


326

to lyses bacteria pellets. The cellular lysate was further sonicated at 60 cycles and 90% energy output at 4 1C for 5 min. The bacterial lysate was clarified by centrifuge at a speed of 20 000 r.p.m. for 20 min at 4 1C. The clarified supernatant was then loaded on a 1 ml HiTrap His column (Amersham, GE, Munich, Germany) by using a ¨ KTAxpress, Amersham, GE, chromatography system (A Munich, Germany) at a speed of 0.5 ml min"1. The column was washed with 40 ml of releasing buffer and then eluted with an elution buffer containing PBS, pH 7.4, 500 mM imidazole, 6 M urea and complete protease inhibitors without EDTA, with a speed of 0.5 ml min"1. The first 2.5 ml of elution was quickly loaded on a prebalanced PD-10 desalting column and then collected with 3.5 ml of HTK solution (Custodiol-, Ko¨hler Chemie, Alsbach, Germany). The desalted protein solutions were snap frozen in liquid nitrogen with 10% glycerol and stored at "80 1C.

Rat heterotopic heart transplantation LEW rats were originally purchased from Charles River, Sandhofer, Germany and maintained in the Laboratory Animal Unit, University of Regensburg. All experimental procedures were performed in S2 Laboratory according to institutional guidelines and approved by local authority (Regierung der Oberpfalz). The heterotopic heart transplantations were performed using LEW rats as donors or recipients. The surgical procedure was described previously.20 In brief, after perfusion of donor heart grafts in situ with Histidine–Tryptophan–Ketoglutarate (HTK) solution (Custodiol, Ko¨hler Chemie, Alsbach, Germany), various doses of PTD-EGFP, PTD-bGal, PTD-HO-1 or PTD-HO-1(M) in 300 ml of HTK solution were administered into the heart grafts through the coronary artery. HTK solution (300 ml) served as no transduction control. Grafts were then preserved in cold HTK solution (4 1C) for 15 or 18 h before transplantation. Protein analysis by SDS-PAGE and western blot Protein-transduced cells or heart grafts were homogenized in cell lysis buffer (Cell Signaling) with PMSF (1 mM) and clarified by centrifuge. Supernatants were separated on a 12% SDS-PAGE gel. After electrophoresis, the gel was either stained with Coomassie blue staining solution (0.1% Coomassie blue, 20% methanol and 10% acetic acid), or transferred onto a nitrocellulose membrane (Schleicher & Schuell, Dassel, Germany). The nitrocellulose membranes were firstly incubated with a mouse monoclonal anti-HO-1 antibody (OSA-110, Stressgen, Madison, WI, USA), or a mouse monoclonal anti-Bcl-2 antibody (7/Bcl-2, BD Transduction Laboratories, Germany), or a mouse monoclonal anti-Bcl-xL antibody (YTH-2H12, R&D Systems, Wiesbaden-Nordenstadt, Germany) for 1 h at room temperature, and further incubated with a secondary polyclonal goat anti-mouse antibody conjugated with horseradish peroxidase (Dako, Hamburg, Germany) for 1 h at room temperature. ECL western blotting detection Reagents (Amersham Biosciences, GE, Munich, Germany) was used to detect HO-1 protein on membrane. Primary endothelial cell culture and separation of subcellular protein fractions To determine the subcellular localization of transduced HO-1 protein. Human umbilical endothelial cells Gene Therapy

(HUVEC, kindly provided by Dr Carla Lehle, University of Regensburg, Regensburg, Germany) were cultured in endothelial growth medium (PromoCell, Heidelberg, Germany). All experiments were performed in passage three to five from the same donor. The expression of endogenous HO-1 was induced by adding the CoPPIX (20 mM) in the culture medium for 24 h. The PTDmediated HO-1 protein delivery was achieved by adding PTD-HO-1 (1 mg ml"1) in the culture medium for 24 h. Cytosolic proteins, membranes and membrane organelles, nucleic proteins and cytoskeleton protein fractions were separated by using ProteoExtract Subcellular Proteome Extraction Kit according to the manufacturer’s instructions (Calbiochem, Darmstadt, Germany). Amount of HO-1 in subcellular protein fractions was detected by western blot as described above.

HO enzymatic activity Protein-transduced cells were incubated at 37 or 4 1C for 2 h, then washed with pre-cold Tris-HCl buffer (20 mM, pH 7.4). For protein-transduced heart grafts, the grafts were preserved at 4 1C for 18 h and then were perfused through coronary artery with pre-cold Tris-HCl buffer. Either cells or grafts were homogenized in 20 mM Tris-HCl buffer with 0.5% of Triton X-100, 0.1% of sodium cholate and complete anti-protease inhibitors (Roche, Mannheim, Germany). A reaction mixture (1 ml) containing homogenate (3 mg of protein), hemin (20 mM), rat liver cytosol (2 mg of protein), glucose-6phosphate (2 mM), glucose-6-phosphate dehydrogenase (0.25 U) and NADPH (0.8 mM) was incubated for 60 min at 37 1C in dark. Controls included reaction mixture without NADPH generating system and reaction mixture without homogenates. At the end of the incubation period, any insoluble material was removed by centrifugation. The generated bilirubin was calculated by using an extinction coefficient of 40 mM"1 cm"1 between 470 and 530 nm. The results were interpreted as (pmol of generated bilirubin)/(mg of protein) per hour. Histological analysis and immunohistochemistry Surviving grafts at various time points were removed, snap frozen in OTC solution and stored at "80 1C. Tissues were sliced into 5 mM sections with a cryostat (Leica Microsystems, Wetzlar, Germany). Mouse anti-rat CD68 (ED1, infiltrating macrophage; Serotec, Dusseldorf, Germany), HO-1 (OSA-111; Stressgen), CD45 (OX-1, leukocyte; BD pharmingen, Heidelberg, Germany), myeloperoxidase (MPO, activated neutrophil; HyCult Biotechnology, Uden, Holland), CD54 (ICAM-1, activated endothelial cell, BD pharmingen) monoclonal antibodies were used to detect the transduction of PTD-fused proteins and phenotypes of graft-infiltrating cells by horseradish peroxidase immunostaining. TUNEL assay TUNEL assay was performed according to the manufacturer’s instructions (In situ Cell Death Detection Kit, Roche Diagnostics, Mannheim, Germany). Apoptotic cells in graft sections were quantized by counting the ratio of TUNEL-positive cells to total cells in 15 random microscopic fields ( ! 200).


Microscopy Images were digitized with a high-resolution camera (Spot 2000) under software control (Metamorph, Universal Imaging Corporation, West Chester, New York, USA) with a fluorescence microscope (Leitz DM RBE) using appropriate filters. Exposure and image processing was always identical for controls and stained sections digitized during one session. Assessment of myocardial infarction Seven days after transplantation, survival grafts were removed and sliced into 1 mm cross sections. The hearts sections were then incubated with 1% triphenyltertrazolium chloride (TTC, Sigma-Aldrich, Munich, Germany) in PBS at 37 1C for 20 min. Viable myocardium stained red, and the infarct tissue appeared pale. Hemophaged area was unable to be stained by TTC and appeared black. The percentage of the infarct areas (pale or black) to the whole cross section area was analyzed by NIH Image software.

327 7

8 9

10

11

12

13

Serum levels of creatine kinase-MB (CK-MB) Sera from recipients (15 h of cold preservation and 2 h after transplantation) were collected and stored at "80 1C until measurement. Levels of serum CK-MB isoenzyme were measured at Institute of Clinical Chemistry and Laboratory Medicine, University of Regensburg Medical Center. The results were interpreted in IU l"1. Statistics Survival curves of different treatment groups were analyzed by Kaplan–Meier method and compared by log-rank test. Data from the rest of the experiments were analyzed by using one-way ANOVA and Bonferroni’s multiple comparisons. Po0.05 was considered statistically significant.

14

15

16

17

18

Abbreviations CK-MB, creatine kinase-MB; CoPPIX, cobalt protoporphyrin IX; HO, heme oxygenase; I/R, ischemia and reperfusion; PTD, protein transduction domain; TTC, triphenyltertrazolium chloride

19

20

References 1 Lefer AM, Tsao PS, Lefer DJ, Ma XL. Role of endothelial dysfunction in the pathogenesis of reperfusion injury after myocardial ischemia. FASEB J 1991; 5: 2029–2034. 2 Tilney NL, Guttmann RD. Effects of initial ischemia/reperfusion injury on the transplanted kidney. Transplantation 1997; 64: 945–947. 3 Jaeschke H, Farhood A, Smith CW. Neutrophils contribute to ischemia/reperfusion injury in rat liver in vivo. FASEB J 1990; 4: 3355–3359. 4 Jordan JE, Zhao ZQ, Vinten-Johansen J. The role of neutrophils in myocardial ischemia-reperfusion injury. Cardiovasc Res 1999; 43: 860–878. 5 Takada M, Nadeau KC, Shaw GD, Marquette KA, Tilney NL. The cytokine-adhesion molecule cascade in ischemia/reperfusion injury of the rat kidney. Inhibition by a soluble P-selectin ligand. J Clin Invest 1997; 99: 2682–2690. 6 Scarabelli TM, Stephanou A, Pasini E, Comini L, Raddino R, Knight RA et al. Different signaling pathways induce apoptosis

21

22

23

24

25

in endothelial cells and cardiac myocytes during ischemia/ reperfusion injury. Circ Res 2002; 90: 745–748. Gottlieb RA, Burleson KO, Kloner RA, Babior BM, Engler RL. Reperfusion injury induces apoptosis in rabbit cardiomyocytes. J Clin Invest 1994; 94: 1621–1628. Maines MD. The heme oxygenase system: a regulator of second messenger gases. Annu Rev Pharmacol Toxicol 1997; 37: 517–554. Sun J, Loehr TM, Wilks A, Ortiz de Montellano PR. Identification of histidine 25 as the heme ligand in human liver heme oxygenase. Biochemistry 1994; 33: 13734–13740. Wilks A, Ortiz de Montellano PR, Sun J, Loehr TM. Heme oxygenase (HO-1): His-132 stabilizes a distal water ligand and assists catalysis. Biochemistry 1996; 35: 930–936. Otterbein LE, Bach FH, Alam J, Soares M, Tao Lu H, Wysk M et al. Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat Med 2000; 6: 422–428. Yachie A, Niida Y, Wada T, Igarashi N, Kaneda H, Toma T et al. Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. J Clin Invest 1999; 103: 129–135. Vile GF, Basu-Modak S, Waltner C, Tyrrell RM. Heme oxygenase 1 mediates an adaptive response to oxidative stress in human skin fibroblasts. Proc Natl Acad Sci USA 1994; 91: 2607–2610. Soares MP, Lin Y, Anrather J, Csizmadia E, Takigami K, Sato K et al. Expression of heme oxygenase-1 can determine cardiac xenograft survival. Nat Med 1998; 4: 1073–1077. Tsui TY, Siu YT, Schlitt HJ, Fan ST. Heme oxygenase-1-derived carbon monoxide stimulates adenosine triphosphate generation in human hepatocyte. Biochem Biophys Res Commun 2005; 336: 898–902. Katori M, Buelow R, Ke B, Ma J, Coito AJ, Iyer S et al. Heme oxygenase-1 overexpression protects rat hearts from cold ischemia/reperfusion injury via an antiapoptotic pathway. Transplantation 2002; 73: 287–292. Amersi F, Buelow R, Kato H, Ke B, Coito AJ, Shen XD et al. Upregulation of heme oxygenase-1 protects genetically fat Zucker rat livers from ischemia/reperfusion injury. J Clin Invest 1999; 104: 1631–1639. Yet SF, Tian R, Layne MD, Wang ZY, Maemura K, Solovyeva M et al. Cardiac-specific expression of heme oxygenase-1 protects against ischemia and reperfusion injury in transgenic mice. Circ Res 2001; 89: 168–173. DeBruyne LA, Magee JC, Buelow R, Bromberg JS. Gene transfer of immunomodulatory peptides correlates with heme oxygenase-1 induction and enhanced allograft survival. Transplantation 2000; 69: 120–128. Tsui TY, Wu X, Lau CK, Ho DW, Xu T, Siu YT et al. Prevention of chronic deterioration of heart allograft by recombinant adenoassociated virus-mediated heme oxygenase-1 gene transfer. Circulation 2003; 107: 2623–2629. Ford KG, Souberbielle BE, Darling D, Farzaneh F. Protein transduction: an alternative to genetic intervention? Gene Therapy 2001; 8: 1–4. Schwarze SR, Ho A, Vocero-Akbani A, Dowdy SF. In vivo protein transduction: delivery of a biologically active protein into the mouse. Science 1999; 285: 1569–1572. Vocero-Akbani AM, Heyden NV, Lissy NA, Ratner L, Dowdy SF. Killing HIV-infected cells by transduction with an HIV proteaseactivated caspase-3 protein. Nat Med 1999; 5: 29–33. Nagahara H, Vocero-Akbani AM, Snyder EL, Ho A, Latham DG, Lissy NA et al. Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nat Med 1998; 4: 1449–1452. Vives E, Brodin P, Lebleu B. A truncated HIV-1 tat protein basic domain rapidly translocates through the plasma membrane and accumulates in the cell nucleus. J Biol Chem 1997; 272: 16010–16017. Gene Therapy


328 26 Ho A, Schwarze SR, Mermelstein SJ, Waksman G, Dowdy SF. Synthetic protein transduction domains: enhanced transduction potential in vitro and in vivo. Cancer Res 2001; 61: 474–477. 27 Azuma H, Nadeau K, Takada M, Mackenzie HS, Tilney NL. Cellular and molecular predictors of chronic renal dysfunction after initial ischemia/reperfusion injury of a single kidney. Transplantation 1997; 64: 190–197. 28 Blydt-Hansen TD, Katori M, Lassman C, Ke B, Coito AJ, Iyer S et al. Gene transfer-induced local heme oxygenase-1 overexpression protects rat kidney transplants from ischemia/reperfusion injury. J Am Soc Nephrol 2003; 14: 745–754. 29 Pachori AS, Melo LG, Hart ML, Noiseux N, Zhang L, Morello F et al. Hypoxia-regulated therapeutic gene as a preemptive treatment strategy against ischemia/reperfusion tissue injury. Proc Natl Acad Sci USA 2004; 101: 12282–12287.

Gene Therapy

30 Tullius SG, Nieminen-Kelha M, Buelow R, Reutzel-Selke A, Martins PN, Pratschke J et al. Inhibition of ischemia/ reperfusion injury and chronic graft deterioration by a single-donor treatment with cobalt-protoporphyrin for the induction of heme oxygenase-1. Transplantation 2002; 74: 591–598. 31 Vreman HJ, Cipkala DA, Stevenson DK. Characterization of porphyrin heme oxygenase inhibitors. Can J physiol pharmacol 1996; 74: 278–285. 32 Cavazzana-Calvo M, Thrasher A, Mavilio F. The future of gene therapy. Nature 2004; 427: 779–781. 33 Weiner MP, Costa GL, Schoettlin W, Cline J, Mathur E, Bauer JC. Site-directed mutagenesis of double-stranded DNA by the polymerase chain reaction. Gene 1994; 151: 119–123.