A highly sensitive and specific tetraplex PCR assay

0 downloads 0 Views 569KB Size Report
Jun 13, 2014 - horse and pork species identification in sausages: Development and validation ..... We believe that this assay would be used by food regulatory bodies for tracing poultry, horse ... European Food Research and · Technology ...

Meat Science 98 (2014) 296–300

Contents lists available at ScienceDirect

Meat Science journal homepage: www.elsevier.com/locate/meatsci

A highly sensitive and specific tetraplex PCR assay for soybean, poultry, horse and pork species identification in sausages: Development and validation M. Safdar ⁎,a, Y. Junejo a,c, Kaifee Arman a, M.F. Abasıyanık b a b c

Department of Medical Biology and Genetics, University of Gaziantep, Gaziantep, Turkey Department of Genetics and Bioengineering, Faculty of Engineering, Fatih University, Büyükçekmece, 34500 Istanbul, Turkey National Center of Excellence in Analytical Chemistry, University of Sindh Jamshoro, Jamshoro 76080, Pakistan

a r t i c l e

i n f o

Article history: Received 1 December 2013 Received in revised form 26 May 2014 Accepted 5 June 2014 Available online 13 June 2014 Keywords: Species-specific primer Sensitive Tetraplex PCR Species identification Sausage

a b s t r a c t A tetraplex PCR assay was developed for a rapid and reliable identification of horse, soybean, poultry, and pork species in sausages simultaneously. The method merges the use of horse (Equus caballus), soybean (Glycine max), poultry (Gallus gallus), and pork (Sus scrofa) specific primers that amplify small fragments (horse; 85 bp, soybean; 100 bp, poultry; 183 bp and pork; 212 bp) of the mitochondrial cyt b, lectin, 12S rRNA and ATPase subunit 6 genes respectively. Good quality DNA was isolated from reference sausage to optimize the assay. Tetraplex analysis of the reference sausage samples showed that the detection limit of the assay was 0.01% for each species. Taken together, all data indicated that this tetraplex PCR assay was a simple, rapid, sensitive, specific, and costeffective detection method for horse, soybean, poultry, and pork species in commercial sausages. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction Food composition and authenticity assessment is an important concern to protect the consumers from illegal or unwanted substitution; for economic, religious and health concerning reasons. Chicken, pork and horse meat are being used as a substitute ingredient for red meat, whereas, vegetable proteins (soybean) are used as an alternative of muscle proteins, due to their low cost of production (Arslan, Irfan-Ilhak, & Calicioglu, 2006; Mane, Mendiratta, & Tiwari, 2009). Soy allergy is an arising public health concern among food allergies as even minute quantity of soy, may trigger allergic reactions in children and adults (Abdullah, Radu, Hassan, & Khair Hashim, 2006; Poms, Anklam, & Kuhn, 2004). Muslim and Jewish populations avoid consumption of pork and horse meat, even in minute quantities, due to their religious faiths (Teletchea, Maudet, & Hanni, 2005). In this background, there is a need of a rapid, economic and highly sensitive method for identification of meat species in sausages. Many analytical methods; chemical, electrophoretical, chromatographic, and immunological have been used for soy, poultry, pork and horse species identification in foods, but each method having its own limitations (Arslan et al., 2006; Ballin, Vogensen, & Karlsson, 2012; ⁎ Corresponding author. Tel.:+90 5075125460. E-mail addresses: [email protected], [email protected] (M. Safdar).

http://dx.doi.org/10.1016/j.meatsci.2014.06.006 0309-1740/© 2014 Elsevier Ltd. All rights reserved.

Espineira, Herrero, Vieites, & Santaclara, 2010). In parallel, several researchers have employed conventional gel electrophoresis-based PCR-detection for qualitative analysis of soy protein and meat species in sausages (Che Man, Aida, Raha, & Son, 2007; Miguel & Enrique, 2014; Murugaiah et al., 2009; Nakyinsige, Che Man, & Sazili, 2012). In contrast to conventional PCR techniques, real-time PCR-approaches identify even minute traces of soy protein and meat species in sausages (Espineira et al., 2010; Miguel, García, González, Hernández, & Martín, 2005; Safdar & Abasıyanık, 2013a, 2013b). However, the high cost of the equipment and reagents is a matter of concern for applying this technique in most laboratories (Safdar & Abasıyanık, 2013a, 2013b; Zhang, Fowler, Scott, Lawson, & Slater, 2007). Alternatively, multiplex PCR is a rapid, economical and simple approach for commercial analysis of sausages (Safdar & Abasıyanık, 2013a, 2013b; Sónia, Joana, Isabel, Beatriz, & Oliveira, 2010). Therefore it is the urge of time for the requirement of a technique which endorses simple, cost-effective and prompt methods to use DNA-based commercial analysis and surveillance of sausages. Some researchers have applied simultaneous PCR for the detection of meat species in sausages (Di Pinto, Forte, Conversano, & Tantillo, 2005; Sónia et al., 2010). But as far as our knowledge, there has been no study related to tetraplex PCR for sensitive and specific horse, soybean, poultry and pork species identification in sausages simultaneously. That's why the tetraplex PCR assay has been reported to specifically identify horse, soybean, poultry and pork by using small fragments of

M. Safdar et al. / Meat Science 98 (2014) 296–300

DNA in simultaneous reaction (one tube) in sausages. The objective of the present study was to develop a tetraplex PCR assay which shows a potential tool for rapid, specific, sensitive and cost-effective detection of small fragment of horse, soybean, poultry and pork mitochondrial DNA origins in sausages.

297

(Vilber Lourmat BP 66, France) and image was taken by a camera (Sony Cyber shot DSC T520). 3. Results and discussion 3.1. DNA extraction

2. Material and methods 2.1. Preparation and selection of samples To validate the tetraplex PCR, the reference sausage samples were prepared from beef, chicken, horse, pork meats and soybean protein, and additives, such as spices and beef meat in our laboratory (Table 1). To determine the detection limit of soybean, poultry, horse and pork in reference sausages, samples were mixed in the range of 20% to 0.01%. Twenty commercial sausages were obtained from local supermarkets in Turkey. They all were directly transported to the Genetic Research Laboratory of Fatih University and stored at −20 °C until the extraction of the DNA in order to prevent the enzymatic degradation of DNA. 2.2. DNA isolation Total DNA was extracted from samples following manufacturer's instructions using the DNeasy® Tissue Kit (Qiagen, Hilden, Germany). DNA concentration was measured with a NanoDrop2000 spectrophotometer (NanoDrop2000, UV–Vis spectrophotometer, USA). The samples were exposed to ultraviolet light at 260 and 280 nm. 260:280 was used to calculate the quantification of nucleic acids by the following formula: DNA concentration = OD260 × extinction coefficient (50 μg/ml) × dilution factor. 2.3. Primers Horse, soybean, pork and poultry primers published respectively by Koppel, Ruf, and Rentsch (2011), Zhang et al. (2007), Lahiff et al. (2001) and Dalmasso et al. (2004) were used (Table 2). All primers used in this study were synthesized by the Metabion Company (Germany). To check the specificity of each primer BLAST program was used.

The results showed that extracted DNA was suitable for PCR amplification. The DNA extraction method was considered satisfactory and was able to remove PCR inhibitors, which could interfere with PCR reaction. For example, polysaccharides and polyphenols are common PCR inhibitors in plant sources such as proteins (Di Pinto et al., 2007) while, oil and fats are common components of many food ingredients which are known to inhibit polymerases (Arlorio, Cereti, Coïsson, Travaglia, & Martelli, 2007). The purity and yields of the total DNA extract obtained from reference and commercial sausage samples were high (purity = A260/A280 and 260/230 ratio ranged between 1.8 and 2.0 and yield = 40–50 ng/μl). 3.2. Specificity of simplex and tetraplex PCR In an elementary phase of this research, simplex and tetraplex PCRs were done by using the DNA extracted from reference sausages. The PCR product was run on agarose gel for visualizing the proper amplification. The amplification of total DNA of reference sausages yielded the PCR fragments of 100 bp, 183 bp, 85 bp and 212 bp for soybean, poultry, horse, and pork species, respectively (Fig. 1). 3.3. Sensitivity In order to find out the sensitivity of our employed method, tetraplex PCR assays were carried out for soybean, poultry, horse, and pork species identification in reference sausages. Reference sausages were prepared by homogenized mixing in appropriate ratios of 0.01 to 20% (Table 1) of each species (horse, soybean, poultry and pork) meats in beef meats to test the sensitivity of the assay for commercial sausages. The PCR product was run on agarose gel in order to check the sensitivity. Reference sausage sample sensitivity results showed that the sensitivity threshold was 0.01% for each species (Fig. 2). 3.4. Primer specificity

2.4. Simplex and tetraplex PCR For the both simplex and tetraplex detection of species, PCR amplification was performed in a final volume of 25 μl (5 × HOT FIREPol EvaGreen® qPCR Mix Plus (ROX), Solis Bio Dyne, 10 pmol of pork, poultry, soybean and horse primers of each species and 120 ng of DNA template). Amplification was performed in a Thermo cycler Techne with the following cycling conditions; after an initial heat denaturation step at 94 °C for 10 min, 35 cycles were programmed as follows: 94 °C for 30 s, 59.7 °C for 1 min, 72 °C for 1 min and final extension at 72 °C for 5 min. PCR amplified products were analyzed by electrophoresis on 2% agarose (Helicon, USA) gel run in 0.5× TBE buffer (Trisbase, boric acid, NaEDTA) for 50 min at 100 V and stained with ethidium bromide (10 ng/ml) for 20 min. The agarose gel was visualized under UV light

Table 1 Composition of reference sausages for sensitivity. Horse (%)

Soybean (%)

Poultry (%)

Pork (%)

20 10 1 0.1 0.01

20 10 1 0.1 0.01

20 10 1 0.1 0.01

20 10 1 0.1 0.01

The primer specificity results revealed that no cross-reactivity was seen with respective species DNA (horse, poultry, pork and soybean) from other species DNA (sheep, goat, cow, donkey, fish, cat, dog, pig, buffalo, deer, mouse, rabbit, rat, wheat, maize and human). PCR products were not obtained for the samples of negative controls with any of the species-specific primer sets. Every test was repeated four times which gave reproducible results (data not shown). 3.5. Applying tetraplex PCR system on sausages The application of the assays on commercial sausages has been depicted in Fig. 3A–D and Table 3, which show the accurate species composition of the submitted sausage samples. The results of tetraplex assays showed that horse and pork origin samples contained the same contents as labeled and had no contamination. The results of beef sausage tested samples showed that 3/5 samples were contaminated with poultry origins while 2/5 samples were contaminated with soybean protein origin contents. Similarly, 3/5 samples of beef and poultry mixed sausages were also adulterated with soybean protein origin contents. Finally, the results of beef, poultry and soybean mixed sausage tested samples showed that 100% samples were verified correctly as labeled using tetraplex PCR assay. These results revealed some interesting and shocking findings. The samples which were claiming to have 100% beef content were found

298

M. Safdar et al. / Meat Science 98 (2014) 296–300

Table 2 Oligonucleotide primers for soybean, poultry, horse, and pork species. Primes

Species

Genes

Position

Oligonucleotides primers

Amplicons (bp)

Sources

Pork

Sus scrofa

ATPase subunit 6

AF039170

212

Lahiff et al. (2001)

Poultry

Gallus gallus

12S rRNA

183

Dalmasso et al. (2004)

Soybean

Glycine max

Lectin gene

5′ CTTCTTTCTCGCACCAAT 3′ 5′ CTCAACAGCGACGACTTG 3′

100

Zhang et al. (2007)

Horse

Equus caballus

cytb

Gallus gallus NC_001323 1799–1981 Glycine max NC_016089 1124849 1124948 DQ297663

5′GCCTAAATCTCCCCTCAATGGTA 3′ 5′ATGAAAGAGGCAAATAGATTTTCG 3′ 5′ TGA GAA CTA CGA GCA CAA AC 3′ 5′ GGG CTA TTG AGC TCA CTG TT 3′

85

Koppel et al. (2011)

5′ CCA GAA TGG TAC TTC CTG TTT GC 3′ 5′ TAG AGA GGA TTA GGG CTA ATA CGC 3′

The primer sequences for pork, poultry, soybean and horse were published earlier.

to be adulterated with poultry and soybean. At the same time sausage samples which declared to have only beef and poultry contents were surprisingly found to be mixed with soybean. These adulterants are most likely to get incorporated into the commercial sausage samples from either the place of origin or at the processing level. Inclusion of these contaminations may be intentional or unintentional during the processing of sausages at the manufacturer's level. Intentionally the inclusion of other origins is done to reduce the cost of the production of sausages. However, these traces may be mixed unintentionally with other origins during grinding and processing such as improper cleaning and handling of utensils employed in commercial sausage manufacturing. Our study urges the need for rapid, sensitive, specific and obviously cost-effective identification techniques to examine sausages and their label of authenticity for the detection of poultry, horse, pork and soybean species. Due to risk associated to human health with soy allergies (child and adult), and the mixing of cheap meat (poultry) in costly meat (beef), and horse and pork meat adulterations (religious beliefs), the customer demand for more sensitive, specific, economical and reliable techniques for animal and plant species identification in sausages. Several researchers have previously reported species-specific PCR-based assays for meat species identification in sausages (Donna-Mareè, Harris, & Louwrens, 2013; Fátima, Beatriz, María, Juan, & Montserrat, 2011; Safdar, 2013; Sónia, Joana, Beatriz, Oliveira, & Isabel, 2013; Zulal, Yetiman, Sahin, & Yetim, 2012). However, there are several attracting advantages to our PCR assays over earlier reported approaches. The tetraplex PCR assays detect poultry, horse, pork and soybean from sausages in a single reaction step and do not require any additional processing aids such as special expertise, unique equipment or chemicals. Species-specific DNA detection can be performed by simple agarose gel analysis as an initial screening tool used as in our tetraplex PCR assays. This assay format minimizes the cost drastically for performing this analysis on a large scale. The detection limit of this particular

Fig. 1. Specificity of simplex and tetraplex assay of DNA from sausages: M: marker, 100 bp, (1) Sus scrofa, (2) Gallus gallus, (3) Glycine max, (4) Equus caballus. (NC) Negative control (reagents with primers but no DNAs), (PC1) tetraplex of Sus scrofa, Gallus gallus, Glycine max, Equus caballus, (PC2) tetraplex of Sus scrofa, Gallus gallus, Glycine max, Equus caballus repeat.

assay on reference sausage samples was 0.01% which indicated this method to be highly sensitive and reliable. As compared to our study, other researchers showed lower detection limits for identification of meat species in sausages. A minimum detection limit of 0.1% for food products was found in different literatures (Dalmasso et al., 2004; Ghovvati, Nassiri, Mirhoseini, Heravi, & Javadmanesh, 2009; Sónia et al., 2010; Sónia et al., 2013). Some other researchers showed 0.25 ng detection limits in their experiments by using multiplex PCR (Di Pinto et al., 2005; Matsunaga et al., 1999). 1% detection limit was also being mentioned (Cheng et al., 2014). Dalmasso et al. found a minimum detection limit of 2% in their experiment (Dalmasso, Civera, Neve, & Bottero, 2011). Thus our new method is much more attractive as compared to others due to its minimum detection limit of 0.01%. The development of real-time PCR provides the detailed information regarding the identification and quantification of meat species in sausages (Safdar & Abasıyanık, 2013a, 2013b; Sónia et al., 2010). However, real-time PCR assays have the disadvantage of being much more expensive than conventional PCR using species specific primers and probes (Monti, Martini, & Tedeschi, 2013; Pafundo, Gulli, & Marmiroli, 2009; Safdar, Junejo, Arman, & Abasıyanık, 2014). In addition, suitable equipment and trained professionals are required to carry out the analysis which limits the use of the technique in many food control laboratories that cannot afford these expensive equipment. In contrast, the tetraplex PCR assay using species-specific primers can be easily carried out with minimum effort but much gain to verify the identity of sausages. Moreover, the high sensitivity, specificity and reproducibility of the tetraplex PCR assay suggested that this method is feasible and ideal for rapid analysis of commercial sausage samples to identify the fraud or risk of diseases. 4. Conclusion The findings of this study suggest that tetraplex PCR assay could be used to detect sources of animal and plant species (poultry, horse, pork and soybean) in commercial sausages. The assays developed in this

Fig. 2. Evaluation of tetraplex assay sensitivity for soybean, poultry, horse and pork from reference sausages; M: marker 100 bp. NC: negative control (reagents with primers without DNAs) (1) 100% (2) 20%, (3) 10%, (4) 1%, (5) 0.1%, (6) 0.01%.

M. Safdar et al. / Meat Science 98 (2014) 296–300

299

Fig. 3. Applicability of tetraplex PCR on commercial sausages. M: marker 100 bp, NC: negative control (reagents with primers without DNAs), PC: positive control (reagents with primers and respective species DNAs); A (B1–B5:100% beef samples), B (P1–P5:100% poultry samples), C (PS1–PS5:100% poultry and soya mixed samples), D (H1, H2:100% horse samples while PR1–PR3:100% pork samples).

study could be used for rapid and routine detection of animal and plant species in commercial sausages simultaneously with a detection limit of 0.01%. The assay was validated under various matrices and it could be applied in practical identification of these species in food and feed products. We believe that this assay would be used by food regulatory bodies for tracing poultry, horse, pork and soybean derived materials.

Acknowledgments The authors would like to thank the Office of Scientific Research Projects at Fatih University for funding this project (Grant No. P50091102_G (1884)) and the Department of Genetics and Bioengineering for providing logistic supports.

Table 3 Results of tetraplex PCR performed on commercial sausages. No. of samples

Labeled

Results

B1 B2 B3 B4 B5 P1 P2 P3 P4 P5 PS1 PS2 PS3 PS4 PS5 PR1 PR2 PR3 H1 H2

Beef Beef Beef Beef Beef Poultry Poultry Poultry Poultry Poultry Beef + poultry Beef + poultry Beef + poultry Beef + poultry Beef + poultry Pork Pork Pork Horse Horse

Poultry Poultry, soybean N/A Soybean Poultry Poultry, soybean Poultry Poultry, soybean Poultry Poultry, soybean Poultry, soybean Poultry, soybean Poultry, soybean Poultry, soybean Poultry, soybean Pork Pork Pork Horse Horse

N/A: no species.

+ + + + +

soybean soybean soybean soybean soybean

References Abdullah, T., Radu, S., Hassan, Z., & Khair Hashim, J. (2006). Detection of genetically modified soya in processed foods sold commercially in Malaysia by PCR-based method. Food Chemistry, 98, 575–579. Arlorio, M., Cereti, E., Coïsson, J. D., Travaglia, F., & Martelli, A. (2007). Detection of hazelnut (Corylus spp.) in processed foods using real-time PCR. Food Control, 18, 140–148. Arslan, A., Irfan-Ilhak, O., & Calicioglu, M. (2006). Effect of method of cooking on identification of heat processed beef using polymerase chain reaction (PCR) technique. Meat Science, 72, 326–330. Ballin, N. Z., Vogensen, F. K., & Karlsson, A. H. (2012). PCR amplification of repetitive sequences as a possible approach in relative species quantification. Meat Science, 90, 438–443. Che Man, Y. B., Aida, A. A., Raha, A. R., & Son, R. (2007). Identification of pork derivatives in food products by species-specific polymerase chain reaction (PCR) for halal verification. Food Control, 18, 885–889. Cheng, X., He, W., Huang, F., Huang, M., & Zhou, G. (2014). Multiplex real-time PCR for the identification and quantification of DNA from duck, pig and chicken in Chinese blood curds. Food Research International, 60, 30–37. Dalmasso, A., Civera, T., Neve, F. L., & Bottero, M. T. (2011). Simultaneous detection of cow and buffalo milk in mozzarella cheese by real-time PCR assay. Food Chemistry, 124, 362–366. Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati, S., & Bottero, M. (2004). A multiplex 217 PCR assay for the identification of animal species in feedstuffs. Molecular and Cellular Probes, 18, 81–87. Di Pinto, A., Forte, V. T., Conversano, M. C., & Tantillo, G. M. (2005). Duplex polymerase chain reaction for detection of pork meat in horse meat fresh sausages from Italian retail sources. Food Control, 16, 391–394. Di Pinto, A., Forte, V. T., Guastadisegni, M. C., Martino, C., Schena, F. P., & Tantillo, G. (2007). A comparison of DNA extraction methods for food analysis. Food Control, 18, 76–80. Donna-Mareè, C., Harris, A. S., & Louwrens, C. H. (2013). A high incidence of species substitution and mislabelling detected in meat products sold in South Africa. Food Control, 32, 440–449. Espineira, M., Herrero, B., Vieites, J. M., & Santaclara, F. J. (2010). Validation of end-point and real-time PCR methods for the rapid detection of soy allergen in processed products. Food Additives and Contaminants, Part A: Chemistry, Analysis, Control, Exposure and Risk Assessment, 27, 426–432. Fátima, C. L., Beatriz, H., María, M., Juan, M. V., & Montserrat, E. (2011). Authentication of species in meat products by genetic techniques. European Food Research and Technology, 232, 509–515. Ghovvati, S., Nassiri, M. R., Mirhoseini, S. Z., Heravi, Moussavi A., & Javadmanesh, A. (2009). Fraud identification in industrial meat products by multiplex PCR assay. Food Control, 20, 696–699. Koppel, R., Ruf, J., & Rentsch, J. (2011). Multiplex real-time PCR for the detection and quantification of DNA from beef, pork, horse and sheep. European Food Research and Technology, 232, 151–155. Lahiff, S., Glennon, M., O'Brien, L., Lyng, J., Smith, T., Maher, M., & Shilton, N. (2001). Species-specific PCR for the identification of ovine, porcine and chicken species in meat and bone meal (MBM). Molecular and Cellular Probes, 15, 27–35. Mane, B. G., Mendiratta, S. K., & Tiwari, A. K. (2009). Polymerase chain reaction assay for identification of chicken in meat and meat products. Food Chemistry, 116, 806–810.

300

M. Safdar et al. / Meat Science 98 (2014) 296–300

Matsunaga, T., Chikuni, K., Tanabe, R., Muroya, S., Shibata, K., Yamada, J., & Shinmura, Y. (1999). A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Science, 51, 143–148. Miguel, A. S., & Enrique, S. (2014). Authenticity of meat products: Tools against fraud. Food Research International, 60, 19–29. Miguel, A. R., García, T., González, I., Hernández, P. E., & Martín, R. (2005). TaqMan realtime PCR for the detection and quantitation of pork in meat mixtures. Meat Science, 70, 113–120. Monti, M., Martini, M., & Tedeschi, R. (2013). EvaGreen real-time PCR protocol for specific ‘Candidatus Phytoplasma mali’ detection and quantification in insects. Molecular and Cellular Probes, 27, 129–136. Murugaiah, C., Noor, Z. M., Mastakim, M., Bilung, L. M., Selamat, J., & Radu, S. (2009). Meat species identification and Halal authentication analysis using mitochondrial DNA. Meat Science, 83, 57–61. Nakyinsige, K., Che Man, Y. B., & Sazili, A. Q. (2012). Halal authenticity issues in meat and meat products. Meat Science, 91, 207–214. Pafundo, S., Gulli, M., & Marmiroli, N. (2009). SYBR Green real-time PCR to detect almond in traces in processed food. Food Chemistry, 116, 811–815. Poms, R. E., Anklam, E., & Kuhn, M. (2004). Polymerase chain reaction techniques for food allergen detection. Journal of AOAC International, 87, 1391–1397. Safdar, M. (2013). Multiplex analysis of animal and plant species in feedstuffs and foodstuffs by modern PCR techniques: Qualitative PCR and real time PCR. (MS Thesis). Istanbul, Turkey: Fatih University.

Safdar, M., & Abasıyanık, M. F. (2013a). Simultaneous identification of pork and poultry origins in pet foods by a quick multiplex real-time PCR assay using EvaGreen fluorescence dye. Applied Biochemistry and Biotechnology, 171, 1855–1864. Safdar, M., & Abasıyanık, M. F. (2013b). Development of fast multiplex real-time PCR assays based on EvaGreen fluorescence dye for detection of beef and soybean origins in sausages. Food Research International, 54, 1652–1656. Safdar, M., Junejo, Y., Arman, K., & Abasıyanık, M. F. (2014). Rapid bovine and caprine species identification in ruminant feeds by duplex real-time PCR melting curve analysis using EvaGreen fluorescence dye. Molecular Biotechnology, http://dx.doi.org/10.1007/ s12033-014-9756-y. Sónia, S., Joana, S. A., Beatriz, M., Oliveira, P. P., & Isabel, M. (2013). A SYBR Green real-time PCR assay to detect and quantify pork meat in processed poultry meat products. Meat Science, 94, 115–120. Sónia, S., Joana, S. A., Isabel, M., Beatriz, M., & Oliveira, P. P. (2010). Quantitative detection of poultry meat adulteration with pork by a duplex PCR assay. Meat Science, 85, 531–536. Teletchea, F., Maudet, C., & Hanni, C. (2005). Food and forensic molecular identification: Update and challenges. Trends in Biotechnology, 23, 359–366. Zhang, C., Fowler, M. R., Scott, N. W., Lawson, G., & Slater, A. (2007). A TaqMan realtime PCR system for the identification and quantification of bovine DNA in meats, milks and cheeses. Food Control, 18, 1149–1158. Zulal, K., Yetiman, Ahmet E., Sahin, Fikrettin, & Yetim, Hasan (2012). Detection of chicken and turkey meat in meat mixtures by using real-time PCR assays. Journal of Food Science, 77, C167–C173, http://dx.doi.org/10.1111/j.1750-3841.2011.02536.x.

Suggest Documents