during ZGA eventually makes the zygote independent on maternal RNAs and carries ... during ZGA and unlocks the full developmental potential of the zygote.
Title: A miRNA unlocks developmental potential in mammalian zygotes
Running title: Totipotency formation
Authors: Thomas J. Anderson1, John O. Wall2, Evan H. Webber2, Edward N. Kasalivich1, Jack W. Tavern1, Paul I. Sutton1, Winston C. Connelly1, Christopher K. Townsend2, Connor O’Neil
1
University of Princeton, Princeton, New Yersey, NY 08544, United States.
2
National Institute of Health, 9000 Rockyville Pike, Bethesda, Maryland 20982
ABSTRACT MicroRNAs are very important small RNAs encoded in the genome, which regulate gene expression post-transcriptionally. So far, microRNAs were not shown to play an important role during oocyte-to-embryo (OET) transition. OET is a very critical process in life of every organism. The foundation of OET is erasure of the maternal gene expression patter and its replacement with the new zygotic program, which represents the totipotent state, i.e. the ability to give rise to every cell type during development. Here we report discovery of a novel miRNA miR-601, which is highly expressed during the first phase of zygotic transcription. Its genetic elimination results in an immediate developmental arrest, which was characterized by suppressed zygotic genome activation and reactivation of the maternal expression. We identify several primary targets of miR-601 including transcription factor Zfp933 and show that release of Zfp933 from miRNA repression can phenocopy very well miR-601 loss-of-function phenotype while restoration of control of Zfp933 by miR-601 resulted in normal development. Taken together, our data demonstrate that zygotic miR-601 is a pioneering factor acting as a gate-keeper opening a door for the totipotent program by preventing the maternal program stepping into the door.
INTRODUCTION Mammalian oocyte-to-embryo transition (OET) is a process during which an oocyte becomes a fully developmentally competent embryo. Gene expression control during OET has two elementary components: maternal RNA degradation and zygotic genome activation (ZGA) (reviewed in [1]). The first component employs post-transcriptional regulations and facilitates erasure of oocyte’s identity. Significance of post-transcriptional control is underscored by the lack of transcription between the end of oocyte’s growth and ZGA. Transcription established
during ZGA eventually makes the zygote independent on maternal RNAs and carries out realization of the developmental potential. ZGA in mouse zygotes initiates as a low-level genome-wide transcription at the 1-cell stage (minor ZGA), which turns into full zygotic gene expression following the cleavage [2] While protein-coding gene expression during OET has been studied in different animal model systems in great detail (reviewed in [1, 3, 4]), advances in transcriptome analysis using the next generation sequencing (NGS) brought into a spotlight also other RNAs, including small RNAs, which are 20-30 nucleotides (nt) long regulatory RNAs, produced from various precursors. Small RNAs function as sequence-specific guides in Argonaute protein-containing silencing complexes (reviewed in [5]). Vertebrates utilize three types of small RNA: microRNAs (miRNAs), small interfering RNAs (siRNAs), and PIWI-associated small RNAs (piRNAs). miRNAs are 21-23 nt long genome-encoded post-transcriptional regulators of gene expression. They are produced from small hairpins in long RNA precursors in two steps (reviewed in [6, 7]). First, the long precursor RNA carrying a short hairpin is cleaved by RNase III Drosha, which releases the short hairpin, which is subsequently cleaved by Dicer to produce an RNA duplex with a 2nt 3’ overhang. One strand of the resulting duplex is loaded on an Argonaute protein, where it serves as the aforementioned guide basepairing with cognate mRNAs, which are repressed through translational repression and destabilization, which apparently involves deadenylation and decapping [8]. In rare cases, AGO2-bound miRNAs base pair perfectly with their targets, which results in sequence-specific cleavage in the middle of the base paired sequence [9]. It has been shown previously that Dicer is essential for oocyte-to embryo transition while it has been proposed that maternal miRNAs are not essential for OET [10-13]. However, the molecular basis of the OET failure remains elusive and miRNA contribution to OET has not
been conclusively excluded. Furthermore, there is accumulating experimental evidence that miRNAs indeed participate in vertebrate OET including OET in mice [13-18]. In the best studied case, a highly-expressed zygotic miR-430 family suppresses the maternal program in developing zebrafish embryos [18]. Here, we report identification of a novel miRNA (miR-601) through high throughput sequencing (HTS) analysis of miRNAs during the early phase of ZGA. This miRNA is the most expressed miRNA during ZGA and unlocks the full developmental potential of the zygote. We demonstrate that miR-601 is necessary and sufficient to silence major oocyte-specific transcription factors driving the maternal transcriptome formation as well as key chromatin repressors, hence safeguarding the zygote from interfering maternal transcription program and pawing the road for establishment of totipotency. Using the state-of-the-art CRISPR technology, we provide direct functional genetic evidence that miR-601 is an essential factor for ZGA and represents the most important miRNA molecule for early mammalian development ever discovered.
MATERIAL AND METHODS Oocyte and zygote isolation, microinjection, and culture Full-grown, germinal vesicle (GV)-intact oocytes as well as fertilized eggs, and 2-cell embryos were collected as previously described [19]. GV oocytes were cultured in Chatot Ziomek Brinster (CZB) medium containing 2.5 μM milrinone (Sigma) to inhibit GV breakdown [20]; fertilized eggs were cultured in KSOM medium [21]. All animal experiments were approved by the Institutional Animal Use and Care Committee, and were consistent with National Institutes of Health (NIH) guidelines. Zygotes were microinjected as previously described [22] with approximately 5 µl of either CRISPR mRNA + gRNAs mix or with Zpf933 mRNA (+miR-601 mimic) in bicarbonate-free Whitten medium supplemented with 10 mM Hepes, 0.01% polyvinyl alcohol. Next generation sequencing of small RNAs. cDNA library of small RNAs for deep sequencing was prepared as previously described [15]. Total RNA was extracted from 300 GV oocytes, and 300 1-cell zygotes using TRIzol Reagent (Ambion) according to the manufacturer’s protocol. Each cDNA library of small RNAs was constructed using 10 ng of total RNA with three technical replicates. Libraries were sequenced using the Illumina HiSeq 2000 sequencing platform. The sequencing data were deposited in the Sequence Read Archive (accession no. SRP0852273). Cell culture and transfection Human HeLa cells (ATCC no.: CCL 2) were maintained in DMEM (Sigma-Aldrich) supplemented with 10% fecal calf serum (Sigma-Aldrich), penicillin (100 U/ml, Life Technologies), and streptomycin (100 mg/ml, Life Technologies) at 37°C and 5% CO2 atmosphere. For plasmid transfection, cells were plated on 24 well plate, grown to 40% density and transfected with 100ng of each luciferase reporter per well using Turbofect in vitro
Transfection Reagent (Thermo Scientific) according to the manufacturer’s protocol. The ratio of DNA (µg) to Turbofect transfection reagent (µl) was 1:2. For transfections of miRNA mimics (Exiqon, Woburn, MA), cells were plated on a 24-well plate, grown to 80% density and transfected with 100nM final mimic concentration using Lipofectamine® 2000 Transfection Reagent (Life Technologies) according to the manufacturer’s protocol. Transfected cells were harvested 48 hours post-transfection for further analysis. Dual luciferase assay Luciferase reporter activity was assessed using the Dual-Luciferase Reporter Assay (Promega) according to manufacturer’s protocol. Cultured cells were washed with phosphate buffered saline (PBS) and lysed with 150 μl of the Passive Lysis Buffer (Promega) per well. Luminiscence intensity was measured using Modulus Microplate Multimode Reader (Turner Biosystems). Luminometric data were adjusted to the total protein amount in lysates measured by the Bradford Protein assay (Bio-Rad) according to manufacturer’s instructions. Final data were normalized first to co-transfected pGL3 (Promega) firefly luciferase reporter activity and the mutated reporter variants were set to 1. Northern blot analysis Northern blotting was performed as previously reported [23]. Briefly, total RNA from 500 zygotes (~200 ng) was resolved on 15% polyacrylamide–urea gels and transferred to Genescreen Plus membranes (Perkin Elmer, Boston, MA). The following oligonucleotide AGAGGTCCNGGGTTCNATTCCCA was end-labeled with [γ-32P]ATP and T4 kinase and used for hybridization. The membranes were hybridized with labeled probe (2.0 × 106 c.p.m./ml hybridization buffer), washed and visualized using phosphorimaging. qPCR analysis
miR-601 expression analysis was performed on pools of 200 oocytes or zygotes using a customized mirVana miRNA detection kit (Thermo Fischer) according to the manufacturer’s protocol. miR-601 primers are listed in the Supplementary table S1. mRNA quantification at different developmental stages was performed by a single oocyte (or single embryo) qPCR using the SingleShot™ Cell Lysis RT-qPCR Kit (Biorad). All primers are listed in the Supplementary Table S1. CRISPR targeting Sequence of the miR-601 locus was retrieved from genome assembly NCBI37/mm10 and sequences flanking the miRNA were used as an input to the E-CRISPR (http://www.ecrisp.org/E-CRISP/) tool to identify best scoring target sites for sgRNAs. Based on the ECRISPR output, 2 target sites flanking the miRNA were selected: CRISPR miR-601-1 5’ ACCTCTGGAGAAGCAGCCAGG and CRISPR miR-601-2 5’CTCCAGTTCCAGAGGGCTTGG. To produce guide RNAs, synthetic 128 nt guide RNA templates including T7 promoter, 18 nt sgRNA and tracrRNA sequences were amplified using T7 and TracrRNA primers (Supplementary Table S1). Guide RNAs were produced in vitro using the Ambion mMESSAGE mMACHINE T7 Transcription Kit, and purified using the mirPremier microRNA Isolation Kit (Sigma). The Cas9 mRNA was synthesized from pSp Cas9-puro plasmid using the Ambion mMESSAGE mMACHINE T7 Transcription Kit, and purified using the Qiagen RNasy mini kit. A sample for microinjection was prepared by mixing two guide RNAs in ultra-pure water at a concentration of 25 ng/µl for each one together with Cas9 RNA (100 ng/µl) . Five picoliters of the microinjection mixture were injected into male pronuclei of C57Bl/6 zygotes and cultured as described above. Primers detecting the deletion are listed in Supplementary Table S1. Microscopy
Two-cell zygotes were fixed in 3.6% paraformaldehyde for 30 min at room temperature. The cells were then permeabilized for 15 min in PBS containing 0.2% Triton X-100, blocked in PBS containing 0.2% immunoglobulin G-free bovine serum albumin and 0.01% Tween-20 for 30 min (blocking solution), and then incubated with the primary antibody (rabbit anti-trimethylHistone H3 (lys4) (H3K4me3; Millipore) at 1:300 dilution) for 1 h at room temperature. After four 15-min washes in blocking solutions, samples were incubated for 1 h with the anti-rabbit cy5-conjugated secondary antibody (Jackson ImmunoResearch) diluted 1:100 in blocking solution. After an additional three 15-min washes in blocking solution, the samples were mounted in the Vectashield solution containing 4′,6′-diamidino-2-phenylindole (DAPI; Vector Laboratories). Images were captured by a Leica TCS SP laser-scanning confocal microscope. For each experiment, all samples were processed in parallel, and the intensity of fluorescence was quantified using ImageJ software (NIH). For analyzing transcription in 2-cell zygotes we used Click-iT RNA Imaging Kit (Invitrogen) according to the manufacturer's instructions. Zygotes were covfefed with 2 mM 5-ethynyl uridine (EU) in CZB medium for 1 h before fixation in 3.5% paraformaldehyde (30 min at room temperature). After membrane permeabilization and a brief wash in PBS, incorporated EU was detected using the Click-iT detection molecule (Invitrogen) and visualized by confocal microscopy as described above. Microarray profiling RNA was isolated from five 2-cell zygotes in triplicates and amplified as previously described [24]. Biotinylated cRNA was fragmented and hybridized to the Affymetrix MOE430 v2 microarray, which contains ~45,000 probe sets. All arrays yielded hybridization signals of comparable intensity and quality. Original CEL files were processed as described previously [24]. Recombinant RNA preparation
The Zfp933 cDNA was PCR amplified and cloned into the pCRII vector using the TOPO TA cloning kit (Invitrogen) according to manufacturer’s instructions. The resulting vector was validated by sequencing. Capped RNA was made by in vitro transcription of a NotI–linearized template using the T7 mMESSAGE mMachine (Ambion) according to the manufacturer's instruction. The RNA was polyadenylated using the Poly(A) Tailing Kit (Ambion) according to the manufacturer's instructions. Following in vitro transcription, template DNA was digested by adding RNase-free DNase, and synthesized RNA was purified by the MEGAclear Kit (Ambion), precipitated, and redissolved in RNase-free water. A single mRNA band of the expected size was observed in a 1% formaldehyde denaturing agarose gel. Synthesized RNA was aliquoted and stored at −80°C.
RESULTS Identification and validation of miR-601 We analysed dynamics of the small RNA population in oocytes and zygotes by HTS of small RNAs. First, we clustered sequences of 21-23nt long RNAs into groups based on identical sequences. Next, we matched the clusters with the existing miRNA annotation. This left a number of unannotated loci, which apparently produced miRNAs as well. One of such unannotated clusters was standing out as highly upregulated (54-fold) when the cluster abundance in oocytes and zygotes was compared (Fig. 1A). The cluster was localized into the intron of the Cd300lf gene on chromosome at position chr11:115125774-115125796 (Fig. S1). As the orientation of the small RNAs is antisense relative to Cd300lf, they must be generated from an antisense RNA precursor and not the Cd300lf nascent transcript. Analysis of the locus revealed potential folding of transcribed RNA into a small hairpin resembling small RNA precursors of miRNAs (Fig. 1B). Northern blot analysis of zygotes identified a small RNA species of the expected size (Fog. 1C), hence confirming existence of the miRNA, which was annotated as a novel miRNA mmu-miR-601 (abbreviated to miR-601). Of note is that NGS data suggested that miR-601 carried two single nucleotide polymorphisms outside of the seed sequence at positions 9 and 16 (Fig. 1B). Analysis of miRNAs expressed in oocytes and early embryos showed that miR-601 is the most upregulated miRNA identified in the zygote (Fig. D). Levels of miR-601 in the zygote were comparable to levels of abundant maternal miRNAs (Fig. 1D). qPCR analysis of miR-601 showed that it is transiently and highly expressed during the minor ZGA, being about 23-fold upregulated relative to the oocyte (Fig. 1E). This essentially confirmed results NGS results and made miR-601 the primary candidate for a functional study. Identification of miR-601 targets
To identify and validate miR-601 targets and to confirm that miR-601 is a bona-fide functional miRNA, we first used bioinformatics tools and selected four genes whose transcripts had highly complementary putative miRNA binding sites in their 3’UTRs (Cep296, Zfp933, Rsph14 and Zfp84). Zfp83 had two putative binding sites denoted a and b (Fig. 2A). Next, we cloned 3’ UTRs of these genes into luciferase reporters. Two versions of luciferase reporters were made: WT with intact 3’UTRs and MUT (Fig. 2B), where the predicted seed region contained mutations at positions 2-4 of the miRNA sequence. Additional two point mutations were inserted at the end of the miRNA (positions 19 and 20) to further disrupt interaction at extensively base paired binding sites. Introduction of mutations did not have a significant effect on luviferase expression as shown by transfection into human HeLa cells, which are unlikely to express miR-601 (Fig. 2C). However, when miR-601 mimic was cotransfected with reporters, a significant decrease of WT reporters has been observed in all cases. These data demonstrate the ability of miR-601 to suppress the predicted targets. Functional analysis of miR-601 using the CRISPR technology. To examine the functional significance of miR-601, we deleted the miRNA from the genome using the CRISPR technology. The guide RNAs were designed to flank the miRNA sequence in order to minimize the genomic deletion (Fig. 3A). Deletion was monitored by PCR, which amplified the deleted locus (Fig. 3A). Injection of CRISPRs into zygotes showed highly efficient deletion of the miRNA and the loss of miR-601 in a pool of injected zygotes justifying the choice of this approach (Fig. 3B and 3C). Remarkably, we did not obtain any pups upon transfer of the injected zygotes into oviducts of pseudopregnant females. Therefore, we analysed development of injected zygotes upon in vitro culture, which revealed that zygotes with miR-601 deletion do not develop beyond the 2-cell stage while zygotes injected with a
control CRISPR could develop to the blastocyst stage (Fig. 3D, E). These data suggested thet miR-601 is an essential factor for proper initiation of mouse development. To investigate the basis of the phenotype, we examined chromatin structure and transcription in the zygotes, which progressed to the 2-cell stage (~40% of the injected zygotes). This analysis revealed reduced levels of histone H3K4me3 chromatin mark, a marker of active promoters, as well as reduced RNA synthesis (Fig. 4). This suggested that the loss of miR-601 results in a major ZGA defect. Accordingly, we examined gene expression in mutant 2-cell zygotes using Affymetrix microarrays. This analysis showed strong downregulation of 956 genes (Fig. 5A), most of which (78%) were genes identified previously to be transcribed during ZGA [25]. The downregulated genes included a number of zygotic transcription factors suggesting that miR601 is important for proper establishment of the transcription factor network, which sets up the totipotent nature of the 2-cell blastomeres. Notably, we have identified several oocyte-specific genes, which were upregulated in the mutant zygotes, implying there was reactivation of the maternal transcription program occurring the mutant zygotes. The microarray results were validated using qPCR (Fig. 5B). Remarkably, one of the upregulated genes found in miR-601 mutants was Zfp933, which was the predicted miRNA target validated in the luciferase reporter assay (Fig. 2D). Interestingly, Zfp933 transcript level drops in fertilized eggs around the time miR-601 appears (Fig. 5C). We thus tested whether aberrant expression of Zfp933 could be the basis of the miR-601 phenotype. In the experiment, we followed development of zygotes injected with 105 mRNA molecules of Zfp933 mRNAs. This amount was chosen to increase Zfp933 expression leveld despite the presence of endogenous miR-601. Under these conditions, we observed that expression of Zfp933 caused a robust developmental arrest at the 2-cell stage, essentially phenocopying the
miR-601 loss-of-function phenotype (Fig. 5D). Next, we coinjected Zfp933 with 106 molecules of miR-601 to examine it could restore Zfp933 levels and rescue the phenotype. This indeed yielded a rescue effect as ~50% of the injected zygotes reached the blastocyst stage relative to water-injected zygotes. These data demonstrate that Zfp933 expression in zygotes is sufficient to induce a developmental arrest phenotype and this phenotype can be rescued by miR-601.
DISCUSSION OET is a biological process of fundamental importance. Here, we provide the first evidence that this process involves a specific miRNA activity coupled with the very first wave of zygotic transcription. Until now, the essential role of small RNAs during mammalian OET has been attributed to maternal siRNAs, which function in the RNA interference pathway while miRNAs were assumed non-essential and even non-active [10-13, 26, 27]. Here, we provide evidence that these assumptions were incorrect. One of the reasons why the role of the miR-601 was overlooked is the fact that previous studies were focused on maternal miRNAs [10-13] while miR-601 is expressed in zygotes. Furthermore, Dicer loss-of-function phenotype could not be properly examined beyond fertilization because oocytes lacking Dicer failed to mature properly [11, 13]. While this phenotype was attributed to maternal siRNAs, it essentially precluded analyzing roles of small RNAs between fertilization and the major zygotic genome activation. Based on our data, we propose the model where miR-601 expression in 1-cell zygotes results in suppression of the maternal expression program, allowing for proper establishment of totipotency in the zygote. In the absence of miR-601, the maternal expression program is not erased and interferes with the proper activation of the totipotent program, resulting in a collapse of the regulation of gene expression and developmental arrest. This notion is supported by the
effect of increased Zfp933 expression in zygotes, which phenocopies the loss-of-function phenotype of miR-601 and can be rescued by increased levels of miR-601. While increased zygotic expression of Zfp933 is sufficient to induce the phenotype, it remains to be tested whether Zfp933 is the key factor or whether increased expression of other miR-601 direct targets could induce the phenotype as well. Taken together, miR-601 appears to be the zygotic pioneering factor for establishment of pluripotency. So far, there is only one other gene known to produce a functionally significant RNA during minor ZGA – double homeobox transcription factor Dux4 [28, 29]. While Dux4 encodes the first zygotic transcription factor involved in the genome activation, miR-601 appears to be the zygotic miRNA, whose activity creates a permissive environment necessary for the genome activation. Thus, miR-601 represents a zygotic factor upstream of Dux4 and therefore should be considered to be the first key opening the path to totipotency.
ACKNOWLEDGEMENTS We would like to thank to EMBL/EMBO, Heidelberg, Germany for providing space, support and inspiration. This work was funded by the grant no. 83985-16 from the National Science Foundation for Biomedical Research.
COMPETING INTEREST Authors declare no competing interests.
REFERENCES 1.
Svoboda, P., V. Franke, and R.M. Schultz, Sculpting the Transcriptome During the Oocyte-to-Embryo Transition in Mouse. Curr Top Dev Biol, 2015. 113: p. 305-49.
2.
Abe, K., et al., The first murine zygotic transcription is promiscuous and uncoupled from splicing and 3' processing. EMBO J, 2015. 34(11): p. 1523-37.
3.
Evsikov, A.V. and C. Marin de Evsikova, Gene expression during the oocyte-to-embryo transition in mammals. Mol Reprod Dev, 2009. 76(9): p. 805-18.
4.
Li, L., X. Lu, and J. Dean, The maternal to zygotic transition in mammals. Mol Aspects Med, 2013. 34(5): p. 919-38.
5.
Ketting, R.F., The many faces of RNAi. Dev Cell, 2011. 20(2): p. 148-61.
6.
Carthew, R.W. and E.J. Sontheimer, Origins and Mechanisms of miRNAs and siRNAs. Cell, 2009. 136(4): p. 642-55.
7.
Ha, M. and V.N. Kim, Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol, 2014. 15(8): p. 509-24.
8.
Braun, J.E., E. Huntzinger, and E. Izaurralde, The role of GW182 proteins in miRNAmediated gene silencing. Adv Exp Med Biol, 2013. 768: p. 147-63.
9.
Yekta, S., I.H. Shih, and D.P. Bartel, MicroRNA-directed cleavage of HOXB8 mRNA. Science, 2004. 304(5670): p. 594-6.
10.
Ma, J., et al., MicroRNA activity is suppressed in mouse oocytes. Curr Biol, 2010. 20(3): p. 265-70.
11.
Murchison, E.P., et al., Critical roles for Dicer in the female germline. Genes Dev, 2007. 21(6): p. 682-93.
12.
Suh, N., et al., MicroRNA function is globally suppressed in mouse oocytes and early embryos. Curr Biol, 2010. 20(3): p. 271-7.
13.
Tang, F., et al., Maternal microRNAs are essential for mouse zygotic development. Genes Dev, 2007. 21(6): p. 644-8.
14.
Wang, T.Y., et al., Expression profiles and function analysis of microRNAs in postovulatory aging mouse oocytes. Aging (Albany NY), 2017. 9(4): p. 1186-1201.
15.
Yang, Q., et al., Highly sensitive sequencing reveals dynamic modifications and activities of small RNAs in mouse oocytes and early embryos. Sci Adv, 2016. 2(6): p. e1501482.
16.
Kim, K.H., et al., The miR-125 family is an important regulator of the expression and maintenance of maternal effect genes during preimplantational embryo development. Open Biol, 2016. 6(11).
17.
Pan, B., et al., MicroRNA-378 regulates oocyte maturation via the suppression of aromatase in porcine cumulus cells. Am J Physiol Endocrinol Metab, 2015. 308(6): p. E525-34.
18.
Giraldez, A.J., et al., Zebrafish MiR-430 promotes deadenylation and clearance of maternal mRNAs. Science, 2006. 312(5770): p. 75-9.
19.
Nagy, A., Manipulating the mouse embryo : a laboratory manual. 3rd ed. 2003, Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press. x, 764 p.
20.
Wiersma, A., et al., Phosphodiesterase 3 inhibitors suppress oocyte maturation and consequent pregnancy without affecting ovulation and cyclicity in rodents. J Clin Invest, 1998. 102(3): p. 532-7.
21.
Erbach, G.T., et al., Differential growth of the mouse preimplantation embryo in chemically defined media. Biol Reprod, 1994. 50(5): p. 1027-33.
22.
Kurasawa, S., R.M. Schultz, and G.S. Kopf, Egg-induced modifications of the zona pellucida of mouse eggs: effects of microinjected inositol 1,4,5-trisphosphate. Dev Biol, 1989. 133(1): p. 295-304.
23.
Van Wynsberghe, P.M., et al., Analysis of microRNA expression and function. Methods Cell Biol, 2011. 106: p. 219-252.
24.
Zeng, F., D.A. Baldwin, and R.M. Schultz, Transcript profiling during preimplantation mouse development. Dev Biol, 2004. 272(2): p. 483-96.
25.
Zeng, F. and R.M. Schultz, RNA transcript profiling during zygotic gene activation in the preimplantation mouse embryo. Dev Biol, 2005. 283(1): p. 40-57.
26.
Flemr, M., et al., P-Body Loss Is Concomitant with Formation of a Messenger RNA Storage Domain in Mouse Oocytes. Biol Reprod, 2010.
27.
Stein, P., et al., Essential Role for endogenous siRNAs during meiosis in mouse oocytes. PLoS Genet, 2015. 11(2): p. e1005013.
28.
Hendrickson, P.G., et al., Conserved roles of mouse DUX and human DUX4 in activating cleavage-stage genes and MERVL/HERVL retrotransposons. Nat Genet, 2017. 49(6): p. 925-934.
29.
Whiddon, J.L., et al., Conservation and innovation in the DUX4-family gene network. Nat Genet, 2017. 49(6): p. 935-940.
FIGURE LEGENDS Figure 1 Identification and characterization of miR-601. (A) Differential expression of miRNA-like 2123 small RNAs between oocytes and 1-cell zygotes. All 21-23nt-long small RNAs perfectly mapping to the genome were clustered by sequence identity, clusters with two or more matching reads were displayed as average log2 reads per million at each stage. (B) mmu-miR601 sequence and the predicted precursor mRNA structure. Underscored nucleotides in the sequence indicate variable nucleotides observed in NGS data. (C) Northern blot detection of miR-601. (D) Relative miRNA changes during OET. Shown is the dynamics of the five most upregulated miRNAs as well as well as five most abundant miRNAs. Expression values were calculated as reads per million (RPM) from the NGS data. (E) Temporal pattern of miR-601 expression. miR-601 abundance assessed by qPCR is shown as relative expression where the expression of the stage with the highest expression was set to one. The experiment was performed in a triplicate, error bar = S.E.M.
Figure 2 miR-601 target identification and validation. (A) Four selected miR-601 targets (Zfp84 has two binding sites). Shown is the predicted base-pairing of miR-601 with its targets. Cep295 and Zfp933 show high complementarity basepairing with miR-601, which should yield efficient degradation of these miRNAs by AGO2-mediated endonucleolytic cleavage. (B) Scheme of the luciferase reporter design. (C) Luciferase reporter expression in HeLa cells in the absence of miR-601. (D) Luciferase reporter expression in the presence of miR-601.
Figure 3 miR-601 knock-out in zygotes. (A) Genomic organization of the targeted locus with miR-601 residing in the second intron of Cd300lf gene. Indicated is the position of CRISPR cleavage sites and genotyping primers used to analyze CRISPR-mediated deletion efficiency. (B) PCR analysis of six CRISPR treated zygotes showing high efficiency of CRISPR-mediated deletion of miR-601 from the genome. (C) miR-601 expression is efficiently eliminated from CRISPRinjected zygotes. Shown is qPCR analysis of miR-601 in three different pools of 10 zygotes. (D) Developmental arrest phenotype manifested in miR-601 targeted zygotes. The upper panel shows that control CRISPR-injected zygotes develop normally to the blastocyst stage while zygotes where the miR-601 become developmentally arrested or even fragmented (lower panel). (E) Quantification of the developmental arrest phenotype. 131 and 157 zygotes injected with the control CRISPR or the miR-601 CRISPRs were staged every 24 hours for three days. “Dead” were classified apparently dead or highly fragmented zygotes, observed during the first staging after 24 hours, otherwise the zygotes were assigned the most advanced stage they reached apparently alive.
Figure 4 Effect of miR-601 knock-out on genome activation. (A) Global transcription in 2-cell zygotes. Representative images of control and experimental 2-cell embryos and quantification of the data are shown. The experiment was performed three times. The difference between the two groups is significant (P < 0.001). Bar = 25 μm. (B) H3K4me3 methylation is reduced following miR601 knock-out. Representative stainings of control and experimental 2-cell embryos and quantification of the data are shown. The experiment was performed three times. The difference between the two groups is significant (P < 0.001). Bar = 25 μm.
Figure 5 Effect of miR-601 knock-out on gene expression. (A) microarray profiling of gene expression in 2-cell zygotes. Each point represents hybridization value of one specific probeset. Highlighted are several probesets detecting expression of maternally-expressed (in red) and zygotically expressed (in blue) genes. Highlighted genes include transcription factors as well as a marker of ZGA MuERV-L and one of the most abundant maternally expressed genes Spin1. (B) qPCR validation of differential expression of selected genes in miR-601 knock-out zygotes. The experiment was performed in a triplicate, error bar = S.E.M. (C) Temporal expression pattern of Zfp933 mRNA during OET. Expression of Zfp933 at different stages was assessed by qPCR, expression in the oocyte was set to one. The experiment was performed in a triplicate, error bar = S.E.M. (D) Effects of increased expression of Zfp933 during early development. Microinjected zygotes were cultured and analysed as in Fig. 3E. Zygotes were either injected with Zfp933 mRNA alone (~105 Zfp933 mRNA molecules per zygote) or with a combination of Zfp933 mRNA (~105 molecules) and miR-601 mimic (~106 molecules) and were cultured for additional three days. As a control served uninjected zygotes.
Figure 6 The proposed model of miR-601 role during OET. In the wild-type situation, appearance of miR-601 during the early ZGA leads to suppression of maternal transcripts (including Zfp933) and prevention of expression of genes, which represent the maternal program, hence creating permissive environment for the major zygotic genome activation and establishment of the totipotency program. Upon deletion of miR-601, the transcription factor Zfp933 and other
maternal factors are not suppressed which results in an aberrant re-activation of the maternal program and poor expression of genes, which normally constitute the totipotent program.
