A Novel Missense Mutation in Codon 218 of the Albumin Gene in a ...

0021-972X/97/$03.00/0 Journal of Clinical Endocrinology and Metabolism Copyright © 1997 by The Endocrine Society

Vol. 82, No. 10 Printed in U.S.A.

A Novel Missense Mutation in Codon 218 of the Albumin Gene in a Distinct Phenotype of Familial Dysalbuminemic Hyperthyroxinemia in a Japanese Kindred NORIO WADA, HITOSHI CHIBA, CHIKARA SHIMIZU, HIROMICHI KIJIMA, MITSUMASA KUBO, AND TAKAO KOIKE Department of Medicine II and Department of Laboratory Medicine (H.C.), Hokkaido University School of Medicine, Health Administration Center, Hokkaido University of Education (M.K), Sapporo 060, Japan ABSTRACT Familial dysalbuminemic hyperthyroxinemia (FDH) is the most common cause of inherited euthyroid hyperthyroxinemia in Caucasians. To our knowledge, no such documentation on Asians exists. Six of 8 members of a 3-generation Japanese family were found by us to carry the FDH phenotype. Serum total T4 levels ranged from 1763.2–2741.3 nmol/L (normal range, 65.6–164.7), serum total T3 levels ranged from 2.73–5.62 nmol/L (normal range, 1.47–2.95), and rT3 levels ranged from 1.08 –2.52 nmol/L (normal range, 0.22– 0.60). In the proband, the majority of [125I]T4 in serum T4-binding proteins was distributed in albumin frac-

F

AMILIAL dysalbuminemic hyperthyroxinemia (FDH), an autosomal dominant disorder caused by abnormal albumin with an increased affinity for T4, was first reported by Hennemann et al. (1) and Lee et al. (2) in 1979. This condition is always associated with high serum total T4 (TT4) levels and rarely with an increase in total T3 (TT3) and/or total rT3 concentrations. The prevalence of FDH depends on the ethnic background of the population (3–5). FDH is the most common cause of inherited euthyroid hyperthyroxinemia in Caucasians (6). FDH in Asians has not been documented. Peterson et al. (7) and Sunthornthepvarakul et al. (8) reported independently that in the second nucleotide of codon 218 of the albumin gene, guanine was replaced by adenine in one of two alleles, the result being replacement of arginine (CGC) by histidine (CAC) in subjects with FDH. We report here a Japanese kindred with FDH, a unique phenotype characterized by extremely high serum T4 levels. In addition, we found a novel missense mutation in codon 218 of the albumin gene; arginine (CGC) was replaced by proline (CCC) in all subjects in this family examined for FDH. Subjects and Methods Subjects The proband, a 32-yr-old Japanese woman, was referred to Urakawa Red Cross Hospital in May 1991. She complained of feeling feverish. Received December 6, 1996. Revision received April 28, 1997. Accepted June 17, 1997. Address all correspondence and requests for reprints to; Dr. Norio Wada, Department of Medicine II, Hokkaido University School of Medicine, Kita-15, Nishi-7, Kita-ku, Sapporo 060, Japan.

tions, and the isolated albumin had an increased affinity for T4. A guanine to cytosine transition in the second nucleotide of codon 218, resulting in replacement of normal arginine with proline, was detected in 1 of 2 alleles in all 5 subjects of the family with FDH. In all FDH-affected Caucasian subjects from 10 unrelated families with a moderate increase in serum T4, the guanine to adenine transition was demonstrated at the same position of the albumin gene as noted in our patients, but histidine, the replacement amino acid, differed from proline noted in our FDH Japanese subjects. It would thus appear that FDH has ethnic variations. (J Clin Endocrinol Metab 82: 3246 –3250, 1997)

Although she had no goiter or signs of thyrotoxicosis, levels of serum TT4 and TT3 were high. She was followed up, but no specific treatment was given. In April 1994, our team was asked to investigate in detail her abnormal thyroid function tests.

Thyroid function tests Serum TT4 was measured using commercial RIA kits (Dinabot, Matsudo, Japan). Serum free T4 (fT4) was measured using following commercial kits: RIA using T4 analog (Corning, Medfield, MA), equilibrium dialysis/RIA (Nichols Institute, San Juan Capistrano, CA), and one-step, labeled antibody radioassay (Ortho-Clinical Diagnostics, Amersham, UK). Serum TT3, free T3 (fT3), and TSH were measured using commercial enzyme immunoassay kits (Boehringer Mannheim, Mannheim, Germany). Serum rT3 was measured using a commercial RIA kit (Dinabot, Matsudo, Japan). Serum T4-binding globulin (TBG) was measured using a commercial RIA kit (Hoechst, Frankfurt, Germany). Serum albumin was measured by absorbance at 630 nm using bromcresol green. Serum transthyretin was measured by nephelometry.

Analysis by agarose gel electrophoresis of [125I]T4 and [125I]T3 distribution in serum thyroid hormone-binding proteins One hundred microliters of serum samples were incubated overnight with a tracer amount of [125I]T4 or [125I]T3 (SA, 41.0 and 44.4 megabecquerels/mg, respectively; DuPont, Wilmington, DE) at 4 C. The incubated samples (0.5 mL) were applied to a layer of 1% agarose gel (Universal Gel, Ciba Corning Diagnostics Corp., Palo Alto, CA) and electrophoresed in glycine-acetate buffer (0.17 mol/L glycine, 0.13 mol/L acetic acid, 0.14 mol/L sodium hydroxide, and 3.1 mmol/L sodium azide, pH 8.6) at 100 V at 4 C for 75 min. The gel was dried and submitted to autoradiography.

Binding study of [125I]T4 for serum albumin Albumin was isolated from the serum of the proband and a normal subject by Cibacron blue F3GA (Bio-Rad Laboratories, Hercules, CA).

3246

ALBUMIN GENE IN A JAPANESE KINDRED WITH FDH The serum samples (0.25 mL) were applied on the column in phosphate buffer (0.012 mol/L Na2HPO4 and 0.008 mol/L NaH2PO4, pH 7.1); for elution, we used the same buffer containing 1.5 mol/L NaCl. Absorbance was monitored at 280 nm, and 6 mL of each fraction were collected. Ten micrograms of albumin sample, a tracer amount of [125I]T4, and various concentrations of nonradioactive T4 were incubated overnight in 200 mL phosphate-buffered saline at 4 C. The samples, mixed with 200 mL phosphate-buffered saline containing 0.1% charcoal and 0.4% dextran, were left to stand on ice for 10 min, then were centrifuged at 2000 rpm for 15 min. The supernatants were aspirated, and radioactivities were counted. The association constants (Ka) were calculated according to the method of Scatchard (9).

Sequencing of the albumin gene Genomic DNA was isolated from peripheral blood using Qiagen Blood and Cultured Cell DNA kits (Qiagen, Hilden, Germany). DNA fragments containing each exon of the albumin gene were amplified by PCR. All sets of primers for PCR, listed in Table 1, were synthesized according to the genomic sequences reported previously (10). One hundred microliters of the reaction solution contained 1 mg genomic DNA, 50 pmol of each primer, 10 U Taq DNA polymerase (Perkin-Elmer Co., Norwalk, CT), 20 mmol/L of each deoxy-NTP, and 0.15 mmol/L MgCl2 in 10 mmol/L Tris-HCl and 50 mmol/L KCl, pH 8.3, solution. PCR was performed as follows; initial denaturation at 94 C for 1 min, followed by 30 cycles of a denaturation step at 94 C for 15 s, an annealing step at 54 C (for exons 1, 9, 10, 13, and 14), 56 C (for exons 2, 3, 4, 5, 6, 8, 11, and 12), or 60 C (for exon 7) for 20 s, and an extension step at 72 C for 1 min, and finally an additive hold at 72 C for 10 min (Gene Amp PCR System 2400, Perkin-Elmer Co.). The PCR products were purified with Wizard PCR Preps (Promega, Madison, WI) and directly sequenced using the same primers used for amplification with Taq DyeDeoxy Terminator Cycle Sequencing Kits (Perkin Elmer Co.).

3247

AvaII digestion To examine the mutation of codon 218 in exon 7 of the albumin gene, the endonuclease digestion/allele-specific primer method (11) was used. A degenerate oligonucleotide primer and an antisense primer according to 59-sequences just upstream of and 39-sequences around 100 bp downstream of the mutant nucleotide, respectively, as shown in Table 1, were synthesized. When the template genomic DNA contained the mutation guanine to cytosine, the PCR product between the two primers creates a unique restriction site for AvaII (GGNCC). The PCR reaction mixture contained the same amount of each material as described above. PCR was performed as follows: initial denaturation at 94 C for 1 min, followed by 30 cycles of a denaturation step at 94 C for 15 s, an annealing step at 47 C for 30 s, and an extension step at 72 C for 1 min, and finally an additive hold at 72 C for 10 min. Ten microliters of the PCR products were digested with 10 U AvaII (New England Biolabs, Beverly, MA) at 37 C for 2 h and subjected to electrophoresis on a 5% polyacrylamide gel.

Results Thyroid function tests

The pedigree map is shown in Fig. 1, and the results of thyroid function tests for the family are summarized in Table 2. In FDH-affected subjects, serum TT4 levels ranged from 1763.2–2741.3 nmol/L, serum TT3 levels ranged from 2.73– 5.62 nmol/L, and serum rT3 levels ranged from 1.08 –2.52 nmol/L. Serum fT4 levels measured using T4 analog RIA kit ranged from 113.3-over 119.7 pmol/L, and serum fT3 levels ranged from 15.8 –30.1 pmol/L in FDH-affected subjects. In the proband, serum fT4 levels determined by the equilibrium

TABLE 1. Sequences of oligonucleotides Sequence (59-39)

Sequencing of the albumin gene TATATTAGTGCTAATTTCCCTCC (S)a AAGATAACCTTGTAAGACTTCAC (AS) GAAATAATTGAACATCATCCTGAG (S) CCTCAACGCAGAAAACTCTACG (AS) CTCTAGCGTAGCAACCTGTTAC (S) TCCTTTGAAATGCTTGGGATTAC (AS) GTACTGTCCAGCAACTGAAACC (S) GGCCTATGGAGTTACTCCATGC (AS) TTGTCTGCTATAGAAAAGTGACTG (S) TTGTATCAGACACTCAGGTTCC (AS) ACAGTCTCATCTGAGCTTATGG (S) TTACATCGTTATAAAGATGCCAAC (AS) CTGCCCTAAGGATAAGTGATTACC (S) ATTCTACCAACTTGAGCATGCAAG (AS) TGTAGCAATGTCAATTCGTGTTG (S) GGCTATCCTCCTAAGTTGTGAG (AS) GTTACTTTTGAGATTAGCTTTGTG (S) TGGAATCATCAGTCAAAGAACTAG (AS) AAAGGATATCATTCTGACCAGAG (S) AAAGTTCTATGCTAGGTGGCTC (AS) CTACTATGTTAGACAGTTTCTTGC (S) ATGCACACACACACATTACTTCC (AS) AAGTAGCTGGGACTACAGGTG (S) TAGCTTGAATTGACAGTTCTTGC (AS) GACTACCATCCTTACTCTCTCC (S) AGCCCTAGCCTAACCAAACATG (AS) TGATGCACGTGAAATCACTTTGC (S) GAATAGTGGTCGGTGCTGGTC (AS) Confirmation of the mutation TTGATTGGCATTTTCTTTTTAGGGCAGTAGGTCb (S) CCTGTCATCAGCACATTCAAGC (AS) a b

S, sense primer; AS, antisense primer. Degenerated nucleotide is underlined, and intronic sequences are in italics.

Amplified exon

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Position

59-Flanking Intron 1 Intron 1 Intron 2 Intron 2 Intron 3 Intron 3 Intron 4 Intron 4 Intron 5 Intron 5 Intron 6 Intron 6 Intron 7 Intron 7 Intron 8 Intron 8 Intron 9 Intron 9 Intron 10 Intron 10 Intron 11 Intron 11 Intron 12 Intron 12 Intron 13 Intron 13 Intron 14 Intron 7, exon 7 Exon 7

3248

JCE & M • 1997 Vol 82 • No 10

WADA ET AL.

dialysis/RIA kit and by the one-step, labeled antibody radioassay kit were 71.6 pmol/L (normal range, 9.9 –24.7) and 16.7 pmol/L (normal range, 11.5–23.0), respectively. In the proband, TSH receptor antibody and anti-T3 and anti-T4 antibodies were not detected.

vealed a guanine to cytosine transition in the second nucleotide of codon 218, resulting in substitution of proline for arginine (Fig. 4). As guanine was also present at the same position (Fig. 4), the proband was a heterozygote. There was no transition at that position in a FDH-unaffected subject (no.

Distribution of [125I]T4 and [125I]T3 in serum thyroid hormone-binding proteins

In a normal subject, the intensity of [125I]T4 in the albumin fraction was least among the three T4-binding proteins (Fig. 2A, lane 2). However, most of [125I]T4 was distributed in the albumin fraction in the proband (Fig. 2A, lane 1). There was more [125I]T3 in the TBG fraction than in the albumin fraction in a normal subject (Fig. 2B, lane 2). In the proband, there was more [125I]T3 in the albumin fraction than in the TBG fraction (Fig. 2B, lane 1). Scatchard analysis of the T4 binding to serum albumin

The Ka of serum albumin for T4 was 9.1 3 106 mol/L21 in the proband, approximately 80-fold that of albumin in a normal subject (1.1 3 105 mol/L21; Fig. 3).

FIG. 2. Electrophoretic analysis of [125I]T4 (A) and [125I]T3 (B) binding to TBG, albumin, and transthyretin (TTR). In both panels, lane 1 is the proband, and lane 2 is a normal subject.

Genomic sequence of albumin

Direct sequencing of the PCR-amplified DNA fragment containing exon 7 of the albumin gene in the proband re-

FIG. 1. Pedigree of the family. Closed and open squares indicate male subjects with and without FDH. Closed and open circles indicate female subjects with and without FDH. The arrow is directed to the proband.

FIG. 3. Scatchard analysis of T4 binding to isolated albumin from serum of the proband with FDH, subject 6 (closed circle), and of a normal subject (open circle). The affinity constants were calculated from regression lines obtained by the mean square method, and coefficients of correlation (r) are indicated.

TABLE 2. Parameters of thyroid function and concentrations of thyroid hormone-binding proteins in serum Subject no.

TT4 (nmol/L)

TT3 (nmol/L)

fT4 (pmol/L)a

fT3 (pmol/L)

rT3 (nmol/L)

TSH (mU/mL)

TBG (mg/mL)

Albumin (g/dL)

TTR (mg/dL)

1 2 3 4 5 6 7 8

1763.2b 114.5 2162.2b 2278.2b 2472.3b 2346.2b 108.1 2741.3b

2.73 1.61 3.39 3.13 5.62 3.46 1.84 5.02

.119.7 11.6 .119.7 .119.7 113.3 .119.7 12.9 .119.7

15.8 5.4 20.6 18.9 ND 26.9 6.8 30.1

1.08 0.25 ND 1.63 1.97 2.52 ND ND

1.70 3.13 1.84 2.37 2.64 1.71 2.95 3.43

16.3 27.7 ND 28.5 28.2 29.1 25.0 34.6

3.8 4.4 ND 3.5 3.8 3.8 4.7 4.2

32.4 26.2 ND 36.3 29.1 19.3 34.9 28.5

Normal ranges

65.6 –164.7

1.47–2.95

10.3–27.0

4.2–9.1

0.22– 0.60

0.5–3.5

14.5–28.0

3.5–5.1

21– 41

ND, Not determined. a Serum fT4 levels were measured by RIA using T4 analog. b Measured using diluted serum.

ALBUMIN GENE IN A JAPANESE KINDRED WITH FDH

7) in the family (Fig. 4). DNA fragments of 13 other exons from the proband were also amplified and sequenced; sequences were identical to those of the albumin gene reported by Minghetti et al. (10). AvaII digestion

PCR performed using the degenerate primer amplified 153 bp of the DNA fragment. PAGE demonstrated that AvaII digestion reduced the length of the DNA fragment from the proband with the mutant CCC, codon 218 (proline), from 153 bp to 122 and 31 bp, but not that in subject 7 with the normal CGC (arginine). All subjects with FDH (no. 1, 4, 5, 6, and 8) were heterozygous for arginine and proline in codon 218, and two subjects without FDH (subjects 2 and 7) were homozygous for arginine in codon 218 (Fig. 5). Discussion

This report is apparently the first of a Japanese family affected with FDH. The proband was clinically euthyroid

FIG. 4. Fragments of sequences of exon 7 of the albumin gene in the proband with FDH (subject 6) and a subject without FDH (subject 7). The left panel shows the guanine to cytosine transition in the second nucleotide of codon 218 in the albumin gene in the proband with FDH, resulting in the replacement of arginine (Arg) by proline (Pro) in codon 218 of the albumin gene.

FIG. 5. Electrophoresis of PCR products amplified using the degenerated primer and digested with AvaII. Five subjects with FDH (lanes 1, 3, 4, 5, and 7 indicate subjects 1, 4, 5, 6, and 8, respectively) had a normal band of 153 bp and two reduced bands of 122 and 31 bp. Two subjects without FDH (lanes 2 and 6 indicate subjects 2 and 7, respectively) showed a single normal band of 153 bp. The DNA size markers are pBR322 DNA digested with HinfI, shown in the right lane (M).

3249

and had normal TSH levels despite extremely high levels of TT4 in her serum. High TT4 concentrations were demonstrated in four males and two females over three generations of this kindred, findings consistent with an autosomal dominant transmission. The diagnosis of FDH was confirmed by the finding that the majority of [125I]T4 distributed in the albumin fraction of serum from the proband and in albumin isolated from serum of the proband had an increased affinity for T4, as determined by Scatchard analysis. In reports of FDH in Caucasians, serum TT4 concentrations were within about 2- to 3-fold of the normal upper limit (3). In contrast, serum TT4 concentrations were 11- to 17-fold of the normal upper limit in our subjects with FDH. This finding suggests that the affinity of albumin for T4 in FDH-affected members of the present family is much higher than that in cases of FDH in Caucasians. The Ka of the isolated albumin for T4 from serum of the proband is about 80-fold of that in a normal subject, greater than that in Caucasian FDH subjects, in whom the range was from 2.5- to 20-fold of that in normal subjects (8, 12–15). In subjects with FDH in the present family, serum TT3 levels ranged from 0.9- to 1.9-fold of the normal upper limit, and serum rT3 levels from 1.8- to 4.2-fold. The elevation of their TT3 levels is due to an increased affinity of T3 for the variant albumin, as shown by electrophoretic analysis of [125I]T3 distribution in serum thyroid hormone-binding proteins. High rT3 levels also seem to be due to an increased affinity, but such experiments were not performed. In FDHaffected members of this family, fT4 and fT3 levels measured by RIA using T4 analog and by enzyme immunoassay using T3 analog were elevated. Rajatanavin et al. noted high serum fT4 levels in subjects with FDH, determined by T4 analog RIAs (16). They assumed that [125I]T4 derivatives might bind to the abnormal serum albumin. In our cases, the labeled T4 and T3 derivatives may also bind to the variant albumin, leading to high serum fT4 and fT3 levels. Although the reason why the serum fT4 level in the proband measured by equilibrium dialysis/RIA was high is obscure, her serum fT4 level

3250

JCE & M • 1997 Vol 82 • No 10

WADA ET AL.

determined by the one-step, labeled antibody radioassay was within normal limits. Guanine was replaced by cytosine in the second nucleotide of codon 218 in the albumin gene, resulting in replacement of arginine by proline in one of the two alleles in the proband with FDH, yet all other sequences of the coding region were identical to those of the albumin gene reported by Minghetti et al. (10). Peterson et al. (7) reported that a guanine to adenine transition in the second nucleotide of codon 218 of the albumin gene led to substitution of histidine for arginine in one of the two alleles in two unrelated Caucasian subjects with FDH, and Sunthornthepvarakul et al. (8) independently described the same mutation, guanine to adenine at the same position, codon 218 of the albumin gene, in one of the two alleles in eight unrelated Caucasian subjects with FDH. The point mutation in Japanese subjects with FDH was found at the same position as that in FDH Caucasians, but the substituting amino acid differed. Caucasian subjects with FDH and a mutant albumin-His218 had a phenotype characterized by slightly elevated serum TT4 concentrations. In contrast, Japanese subjects with FDH with the mutant albuminPro218 showed a different phenotype, characterized by extremely increased serum levels of TT4. Codon 218 is located in subdomain 2A of human serum albumin, where high affinity T4-binding components are localized (17, 18). Peterson et al. (19) found that using a yeast expression system, the Ka of recombinant albuminHis218 for T4 was 65-fold greater than that of recombinant wild-type albumin. In addition, they investigated the binding of T4 and T4 analogs to recombinant wild-type albumin and mutant albumin-His218 as well as mutant albumin-Met218, -Leu214, and -Met222 by equilibrium dialysis and quenching of tryptophan 214 (20). The results suggested that the guanidino group of arginine codon 218 is involved in an unfavorable binding interaction with the amino group of T4. Because both histidine and proline lack the guanidino group molecule, the mutant albumin-His218 and albumin-Pro218 may form more favorable T4-binding pockets than wild-type albumin. Alternatively, proline can induce a structural kink and thereby alter a protein conformation, suggesting that albumin-Pro218 may create a more propitious T4-binding pocket than wild-type albumin and albumin-His218. The x-ray crystallographic analysis of albumin-Pro218 and another mutant albumin at codon 218 is required for clarifying this. In conclusion, there exists a distinct ethnic phenotype of FDH, characterized by extremely elevated serum TT4 levels and relatively elevated serum TT3 and rT3 levels in the Japanese. A missense mutation in codon 218 of the albumin gene and replacement of arginine by proline are thought to be responsible for this condition.

Acknowledgments We thank Dr. H. Kamada, Urakawa Red Cross Hospital, for assistance with the blood sample collections, I. Yamakawa for excellent technical assistance, and M. Ohara for helpful comments.

References 1. Hennemann G, Docter R, Krenning EP, Bos G, Otten M, Visser TJ. 1979 Raised total thyroxine and free thyroxine index but normal free thyroxine. A serum abnormality due to inherited increased affinty of iodothyronines for serum binding prtein. Lancet. 1:639 – 642. 2. Lee WNP, Golden MP, Van Herle AJ, Lippe BM, Kaplan SA. 1979 Inherited abnormal thyroid hormone-binding protein causing selective increase of total serum thyroxine. J Clin Endocrinol Metab. 49:292–299. 3. DeCosimo DR, Fang S-L, Braverman LE. 1987 Prevalence of familial dysalbuminemic hyperthyroxinemia in Hispanics. Ann Intern Med. 107:780 –781. 4. Arevalo G. 1991 Prevalence of familial dysalbuminemic hyperthroxinemia in serum samples received for thyroid testing. Clin Chem. 37:1430 –1431. 5. Jensen IW, Faber J. 1988 Familial dysalbuminemic hyperthyroxinemia: a review. J R Soc Med. 81:34 –37. 6. Weiss RE, Sunthornthepvarakul T, Angkeow P, et al. 1995 Linkage of familial dysalbuminemic hyperthyroxinemia to the albumin gene in a large Amish kindred. J Clin Endocrinol Metab. 80:116 –121. 7. Peterson CE, Scottolini AG, Cody LR, Mandel M, Reimer N, Bhagavan NV. 1994 A point mutation in the human serum albumin gene results in familial dysalbuminaemic hyperthyroxinaemia. J Med Genet. 31:355–359. 8. Sunthornthepvarakul T, Angkeow P, Weiss RE, Hayashi Y, Refetoff S. 1994 An identical missense mutation in the albumin gene results in familial dysalbuminemic hyperthyroxinemia in 8 unrelated families. Biochem Biophys Res Commun. 202:781–787. 9. Scatchard G,. 1949 The attraction of proteins for small molecules and ions. Ann NY Acad Sci. 51:660 – 672. 10. Minghetti PP, Ruffner DE, Kuang W-J, et al. 1986 Molecular structure of the human albumin gene is revealed by nucleotide sequence within q11–22 of chromosome 4. J Biol Chem. 216:6747– 6757. 11. Weiss RE, Weinberg M, Refetoff S. 1993 Identical mutations in unrelated families with generalized resistance to thyroid hormone occur in cytosineguanine-rich areas of the thyroid hormone receptor beta gene. J Clin Invest. 91:2408 –2415. 12. Lalloz MRA, Byfield PGH, Himsworth RL. 1985 A new and distinctive albumin variant with increased affinities for both triiodothyronines and causing hyperthyroxinemia. Clin Endocrinol (Oxf). 22:521–529. 13. Barlow JW, Csicsmann JM, White EL, Funder JW, Stockigt JR. 1982 Familial euthyroid thyroxine excess: characterization of intermediate affinity thyroxine binding to albumin. J Clin Endocrinol Metab. 55:244 –250. 14. Barlow JW, Csicsmann JM, Meinhold H, Lim C-F, Stockigt JR. 1986 Familial dysalbuminemic hyperthyroxinemia: studies of albumin binding and implications for hormone action. Clin Endocrinol (Oxf). 24:39 – 47. 15. Lalloz MRA, Byfield PGH, Goel KM, Loudon MM, Thomson JA, Himsworth RL. 1987 Hyperthyroxinemia due to the coexistence of two raised affinity thyroxine-binding proteins (albumin and prealbumin) in one family. J Clin Endocrinol Metab. 64:346 –352. 16. Rajatanavin R, Fournier L, DeCosimo D, Abreau C, Braverman LE. 1982 Elevated serum free thyroxine by thyroxine analog radioimmunoassys in euthyroid patients with familial dysalbuminemic hyperthyroxinemia. Ann Intern Med. 97:865– 866. 17. Kamikubo K, Sakata S, Nakamura S, Komaki T, Miura KJ. 1990 Thyroxine binding to human serum albumin immobilized on sepharose and effects of nonprotein albumin-binding plasma constituents. Protein Chem. 9:461– 465. 18. Xiao MH, Carter DC. 1992 Atomic structure and chemistry of human serum albumin. Nature. 358:209 –214. 19. Peterson CE, Ha C-E, Mandel M, Bhagavan NV. 1995 Expression of a human serum albumin variant with high affinity for thyroxine. Biochem Biophys Res Commun. 214:1121–1129. 20. Peterson CE, Ha C-E, Jameson DM, Bhagavan NV. 1996 Mutations in a specific human albumin thyroxine binding site define the structural basis of familial dysalbuminemic hyperthyroxinemia. J Biol Chem. 271:19110 –19117.