A Novel Mutation and Large Size Polymorphism Affecting the ... - Core

0 downloads 0 Views 210KB Size Report
Palmoplantar Keratoderma of the Ichthyosis Hystrix ... in the V2 domain of keratin 5), striate palmoplantar keratoderma (PPK), and ichthyosis hystrix Curth– ...

ORIGINAL ARTICLE

A Novel Mutation and Large Size Polymorphism Affecting the V2 Domain of Keratin 1 in an African-American Family with Severe, Diffuse Palmoplantar Keratoderma of the Ichthyosis Hystrix Curth–Macklin Type Elizabeth S. Richardson1, Jason B. Lee1, Patricia H. Hyde1 and Gabriele Richard1 Keratin gene mutations affecting nonhelical head and tail domains are not usually associated with prominent skin blistering and keratin filament clumping. Instead, they have been associated with several distinct clinical phenotypes, such as epidermolysis bullosa simplex with mottled pigmentation (mutation P25L in the V1 domain of keratin 5), epidermolysis bullosa simplex with migratory circinate erythema (frameshift mutation c1649delG in the V2 domain of keratin 5), striate palmoplantar keratoderma (PPK), and ichthyosis hystrix Curth–Macklin (different frameshift mutations in the V2 domain of keratin 1 (K1)). We have studied a family with severe, diffuse, nonepidermolytic PPK and verrucous hyperkeratotic plaques over the joints and in flexures and identified a new KRT1 gene mutation that is predicted to completely alter the K1 tail domain. In addition, a new K1 size polymorphism has been detected, which is especially prevalent among the African-American population. These results further emphasize the functional importance of the nonhelical tail domain in keratin molecules despite the obvious variability in the number of glycine loop motifs and underscore the broad phenotypic spectrum of disorders due to dominant keratin tail mutations. Journal of Investigative Dermatology (2006) 126, 79–84. doi:10.1038/sj.jid.5700025

INTRODUCTION Ichthyosis hystrix is a descriptive name for extensive and very severe, spiky or verrucous hyperkeratosis. It is often a clinical feature of epidermolytic hyperkeratosis or other disorders of cornification, such as erythrokeratodermia variabilis. Ichthyosis hystrix of Curth–Macklin (IHCM, OMIM (Online Mendelian Inheritance of Man) 146590) is a distinct autosomal dominant disorder characterized by severe, fissuring and mutilating palmoplantar keratoderma (PPK) and dark hyperkeratotic plaques over knuckles, knees, and elbows. In some patients, symmetrically distributed verrucous plaques may cover almost the entire body, as described and depicted by Ollendorff Curth and Macklin (1954) and Ollendorff-Curth et al. (1972). Structural and ultrastructural hallmarks of this genodermatosis are compact orthokeratotic hyperkeratosis, hypergranulosis with perinuclear edema, binucleated cells, 1

Department of Dermatology and Cutaneous Biology, The Jefferson Institute of Molecular Medicine, Jefferson Medical College, Philadelphia, Pennsylvania, USA Correspondence: Dr Gabriele Richard, GeneDx Inc., 207 Perry Parkway, Gaithersburg, Maryland 20877, USA. E-mail: [email protected]

Abbreviations: IHCM, ichthyosis hystrix Curth–Macklin; K1, keratin 1; KIF, keratin intermediate filament; KRT1, keratin 1 gene; PPK, palmoplantar keratoderma; V1,V2, variable domains Received 20 June 2005; revised 15 August 2005; accepted 7 September 2005

& 2006 The Society for Investigative Dermatology

and formation of perinuclear filamentous shells formed by feathery, entangled keratin intermediate filaments (KIF). Two large families with autosomal dominant inheritance and several sporadic cases of IHCM have been reported since its first description in 1954 (Ollendorff Curth and Macklin, 1954; Ollendorff-Curth et al., 1972; Kanerva et al., 1984; Niemi et al., 1990). Sprecher et al. (2001) studied a threegeneration African-American family with IHCM with massive, mutilating PPK and variable involvement of other body surfaces. All affected family members were found to harbor a heterozygous mutation in the KRT1 gene, substituting two guanine bases for an adenine base (c.1609GG-A). This frameshift mutation occurred in a sequence encoding the variable (V2) domain of keratin 1 (K1) and was shown to produce an aberrant and truncated protein tail of 77 residues, which lacked seven out of 10 glycine loops. The results of protein modeling of mutant K1, in vitro assembly of mutant K1/K10 intermediate filaments, and observed intracellular misdistribution of loricrin suggested novel functions for the V2 domain of K1 in KIF bundling and KIF interactions with nuclear envelope proteins and loricrin (Sprecher et al., 2001). Interestingly, a different single nucleotide deletion of KRT1 (c.1628delG) with almost similar consequences on the protein level has been reported in a four-generation British family with striate PPK (Whittock et al., 2002). In contrast to www.jidonline.org

79

ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

IHCM, the clinical phenotype was much less severe and ultrastructural studies did not demonstrate faulty KIF packaging or shell formation as seen in IHCM. Transfection of HaCaT cells with wild-type K10 and four different mutants of K1-GFP (green fluorescent protein) with variable truncation of the V2 tail demonstrated the aberrant nuclear localization of the KIF due to the loss of the wild-type V2 domain rather than the presence of a mutant peptide (Whittock et al., 2002). In a Chinese proband with an atypical variant of epidermolytic hyperkeratosis/ichthyosis bullosa of Siemens, Sprecher et al. (2003) identified a third de novo mutation (c.1752insG) in exon 9 of KRT1, also resulting in an aberrant 69 amino-acid long K1 tail and partially disrupting the recurrent terminal glycine loops. Collectively, these observations illustrate the puzzling phenotypic heterogeneity among K1 disorders due to an abnormal tail domain, suggesting the existence of distinct pathogenetic pathways. In this study, we report a KRT1 mutation that completely alters the K1 tail domain in a patient with clinical features of IHCM. In addition, we characterize a new size polymorphism of the KRT1 gene, which is especially prevalent among the African-American population. These results further emphasize the functional importance of the nonhelical tail domains of keratin molecules.

RESULTS The proband was a 44-year-old African-American male with a medical history of hypertension, hyperlipidemia, and progressively worsening PPK. He showed no evidence of hearing loss or involvement of other ectodermal tissues. The family history revealed an autosomal dominant segregation of diffuse PPK in his family, with his father, sister, and daughter being affected. The PPK was most severe in the proband’s daughter, who also had hyperkeratotic plaques over all large joints and in flexural areas. Dermatological examination revealed markedly hyperkeratotic, rough and thickened palms and soles with numerous deep, painful, and bleeding fissures and cracks (Figure 1a and c). The keratoderma was diffuse with well-defined borders without erythema, and extended to the dorsal surface of fingers and knuckles. In addition, there were sharply demarcated hyperkeratotic plaques over elbows and knees (Figure 1e and f) as well as disseminated small, flat hyperkeratotic papules on the midline area of the back. A punch biopsy from the left palm revealed papillomatosis, striking hypergranulosis, and massive, compact hyperkeratosis of the epidermis (Figure 1h). There were a few binucleated cells, and multiple granular cells showed a perinuclear halo as previously reported in IHCM. Based on

Figure 1. Clinical features. (a) Proband with massive, diffuse hyperkeratosis and deep fissures on the soles of both feet. (b) Soles almost completely cleared after treatment with 40% urea cream under occlusion and mechanical filing. Thickened and fissured palms (c) before and (d) after treatment with acitretin. (e) Keratotic plaques over the dorsae of both hands. Keratotic plaques over elbows before (f) and after (g) treatment with acitretin. (h) A punch biopsy from the left palm revealed a papillomatous epidermis with hypergranulosis and marked hyperkeratosis. The insets (bottom) show perinuclear halos (asterisks) and binucleated cells (arrow) in the granular layer.

80

Journal of Investigative Dermatology (2006), Volume 126

ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

clinical and histological findings, which closely resembled the IHCM phenotype reported by Sprecher et al. (2001), epidermolytic PPK was excluded and a clinical diagnosis of IHCM was made, although an additional skin biopsy for electron microscopic confirmation could not be obtained. The patient was treated with oral acitretin, initially with 25 mg per day and later with 50 mg per day. After 3 months, a significant reduction of hyperkeratosis was noted on the palms, elbows, and knees (Figure 1d and f), underscoring the good therapeutic effect of acitretin in this disorder. Nevertheless, there was little improvement of the plantar keratoderma. With the occurrence of significant body hair loss, retinoid therapy was discontinued after 1 year. Subsequent topical application of 40% urea cream under occlusion and mechanical debridement of the horn material yielded a dramatic improvement within 2 months (Figure 1b), and is continued as needed. To determine the molecular basis of the proband’s disorder, we analyzed the KRT1 gene. Sequence analysis of exons 1–8 of KRT1 revealed three known polymorphisms, which are of no known clinical significance. In exon 2, we detected a common homozygous third-base substitution in arginine codon 240 (R240R). In exon 7, the patient was heterozygous for two silent mutations, a C to T transition at position c.1436 (R463R) and a C to A transversion at position c.1460 (T471T). On gel electrophoresis of exon 9 amplicons, two distinct bands with a size difference of approximately 50 bp were noted (Figure 2a, Pt, lane I). Each band was purified and sequenced separately. The slower migrating band was found to have a wild-type sequence, with no evidence for a mutation or polymorphism. In the faster migrating band, we identified three distinct sequence aberrations: a deletion of a single guanine at position c.1556 (c.1556delG), an in-frame deletion of 27 bp at position c.1569 (c.1569del27) (Figure 3a and c), and another 21 bp in-frame deletion at position c.1656 (c.1656del21) (Figure 3b and c). Together, these three deletions produce a KRT1 gene 49 bp shorter than the wild-type KRT1 and lead to a frameshift and a premature termination codon 237 bp downstream of the mutation site. These deletions occur in the V2 domain of K1 and are predicted to result in a frameshift and translation of an aberrant and truncated protein tail of 79 residues, 48 residues shorter than the wild-type protein (Figure 3d and e). Deletion c.1556delG was not detected in 30 chromosomes of African-American control individuals, thus providing further support for the pathogenicity of this mutation. The detected 21 bp deletion is a known size polymorphism in KRT1, resulting in deletion of one of the 10 glycine loop motifs (Figure 2b). Its allele frequency in 40 individuals of different ethnic origin was reported as 0.39, but specific population groups were not investigated (Korge et al., 1992). To determine the allele frequencies of this deletion and of the newly identified 27 bp deletion, we used two sets of primers to amplify either across both deletions or only across the 27 bp deletion in exon 9 of KRT1, as exemplified in Figure 2a. Of 102 African-American alleles tested, 48 were wild type, 51 harbored c.1656del21, and three showed c.1569del27

a

C2

C1 I

II

I

C3 II

I

C4 II

I

Pt II

I

II

300 bp 279 bp 252 bp 170 bp 143 bp

b

R S G G G S I

G G G G G G G S G G Y Y G S S S GG

G GG C S S S G S H2 Y Y Y domain G S G S G S R G G S G G 27 bp deletion GG G G

S GG S R G G G S G G G G G G GG G S G G S S G H G G S G G G G S R S Y Y Y I V K S G S V F S TYS VTRCOOH S G S S KVT G S G G G G G G G S S G G S R S S S GSS

21 bp deletion (Modified from Korge et al., 1992)

c

GGG G G G G R S S S G S S G G S S G GG G S R G C S S S G G G G S G S G G G G S H2 I Y Y Y Y Y I V K SSGGSSSVKFVST TY SGVTRCOOH domain G S G S R G S G S G G S G S R G H G G G G G S G G G G GG G GG G S G G G G G S G G R S S GG

Figure 2. Analysis of two different size polymorphisms in KRT1. (a) Agarose gel electrophoresis. For each individual, PCR amplicons in lane (I) encompass a 300 bp segment of wild-type DNA spanning across the 21 and 27 bp deletions. The products in lane (II) represent a region of KRT1 that includes only the 27 bp deletion. Four combinations of the size polymorphisms were detected in controls: control sample 1 (C1) is homozygous wild-type (300 bp; 170 bp); control 2 (C2) is heterozygous for the 21 bp deletion (300 bp; 279 bp; 170 bp); control 3 (C3) is homozygous for the 21 bp deletion (279 bp; 170 bp); control 4 (C4) is heterozygous for the 21 bp deletion and the 21 bp deletion plus 27 bp deletion (300 bp; 252 bp; 170 bp; 143 bp). The patient (Pt) is heterozygous for deletions 1556delG, 1656del21, and 1569del27, all on the same mutant allele. (b, c) Schematic depiction of wild-type and mutant K1. (b) The two-dimensional model of the carboxy-terminal tail domain of wild-type K1 protein predicts 10 glycine loops. Black circles highlight those amino-acid residues that are lost owing to size polymorphisms c.1569del27 and c.1656del21. (c) Predicted glycine loop structure in the presence of both deletions.

and c.1656del21 on the same allele, as confirmed by sequence analysis. These data corresponded with an allele frequency of 0.53 for the 21 bp polymorphism and 0.029 for the 27 bp polymorphism. In contrast, none of 218 alleles of white control individuals of European ancestry was found to harbor the c.1569del27 deletion. Based on these results, it appears that the 27 bp polymorphism has arisen on the www.jidonline.org

81

ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

a

b

Mutation Polymorphism 1556delG + 1569del27

Polymorphism 1656del21

Patient

Control

c WT

1556 1569 1596 1656 1677 GAGGAGGTGGCGGCGGTGGCTACGGCTCTGGAGGTAGCAGCTATGGCTÉ50bpÉAGCTATGGCTCCGGAGGTAGCAGCTACGGC

Mut GAGAGGTGGCGGCGGTGGCTGGCTÉ50bpÉAGCTATGGC

d

514 GL1 GL2 GL3 GL4 GL5 GL6 GL7 WT GGGSRGGGGGGYGSGGSSYGSGGGSYGSGGGGGGGRGSYGSGGSSYGSGGGSYGSGGGGGGHGSYGS Mut GGGSREVAAVAPEVVAMVLEVAAAAAVAAMAPEVAAMALEVAAAAMAATAPEAAVGATEVALEAAAA 645 GL8 GL9 GL10 WT GSSSGGYRGGSGGGGGGSSGGRGSGGGSSGGSIGGRGSSSGGVKSSGGSSSVRFVSTTYSGVTRStop Mut AALAAGALAAGALEAPStop

e

1556delG H1 1A E1 V1

1B L1

2A L1,2

2B L2

H2 V2

E2

Figure 3. Mutation and sequence variants of the KRT1 gene in the proband. (a, b) Sequence analysis of exon 9 of KRT1 in the proband reveals the presence of three different nucleotide deletions – c.1556delG (a), c.1569del27 (a), and c.1656del21 (b) – all on one allele of KRT1 (upper panels). The wild-type allele is shown for comparison in the lower panels. (c) The graphical view illustrates the DNA sequence of both the proband’s alleles across the critical region in exon 9 of KRT1. (d) Comparison of the amino-acid sequence of wild-type (WT) and mutant (Mut, underlined) K1 across the V2 domain, indicating also the position of 10 glycine loops (GL1–GL10). (e) The position of the frameshift mutation within the variable (V2) domain of K1 is indicated by the arrow and the resultant aberrant V2 tail is shown in red.

c.1656del21 allele and is a population-specific polymorphism, preferentially found in African-Americans. DISCUSSION The clinical presentation of this African-American patient with severe, diffuse, fissuring, and transgradient PPK, fixed hyperkeratotic plaques over knees and elbows, and disseminated hyperkeratotic papules is remarkably similar to the disorder described in an African-American family with the pathognomonic electron microscopic features of IHCM (Sprecher et al., 2001). The clinical diagnosis of IHCM is further supported by molecular genetic data, which revealed in this patient a heterozygous frameshift mutation in the last exon of KRT1. Similar to the previously reported small deletions or rearrangements in KRT1 in a family with IHCM and another with striate PPK (Sprecher et al., 2001; Whittock et al., 2002), the single G deletion (c.1556delG) detected here encodes for an aberrant K1 tail shortened by 48 residues, in which the glycine residues are replaced with alanine residues (Figure 3d). Consequently, the biochemical properties of the variable (V2) domain are dramatically altered and the end domain (E2) has been eliminated. The two mutations 82

Journal of Investigative Dermatology (2006), Volume 126

described previously (1628delG and 1609GG-A) occurred in the third or fourth glycine loop of K1, respectively, resulting in a K1 protein with a minimum of two residual glycine loops in the V2 domain. In contrast, the frameshift mutation c.1556delG interrupts the first glycine loop at the start of the V2 domain, thus completely eliminating the characteristic glycine loop elements from the mutant K1 molecule (Figures 2b and 3d). The postulated role for glycine loops in K1 is to form weak hydrophobic and hydrogen bonding interactions with K10, loricrin, and perhaps other proteins of the cornified cell envelope (such as corneodesmosin), thus stabilizing and integrating the cell envelope with the KIF network (Steinert, 1993; Jonca et al., 2002). Therefore, the lack of all glycine loops in K1 can be expected to prevent certain interactions between the cell envelope and the KIF network. This notion is also supported by in vitro KIF assembly and transfection studies of K5/K14 with an aberrant and elongated K5 tail without glycine loops, which demonstrated shorter filaments with weaker visco-elastic properties under strain (Gu and Coulombe, 2005). A KIF assembly assay of K1/K10 polymers with a truncated, alanine-rich K10 tail (comparable to the alanine-rich K1 tail due to mutation

ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

c.1556delG reported here) yielded KIF of apparently normal length and diameter. Nevertheless, there were periodic lateral protrusions visible, which likely represent the end domains, thus indicating that an abnormal KIF organization might be responsible for the defective KIF bundling seen in IHCM (Sprecher et al., 2001). All three KRT1 mutations discussed here (c.1556delG, c.1628delG, and c.1609GG-A) result in a similar shift of the reading frame and are predicted to replace the glycine-rich V2 domain with a shortened alanine-rich carboxy-terminal peptide, which is highly similar in sequence and only differs in length for each mutation. Whittock et al. (2002) elegantly demonstrated that the expression of K1 with such a mutant tail domain yields similar results to the expression of a tailless K1 protein, namely a partial nuclear localization of K1. Hence, the pathogenic effect of these KRT1 frameshift mutations is not due to the presence of the mutant, alaninerich peptide but rather due to the loss of the wild-type V2 domain. The tail domains are highly variable in length and primary structure across the family of keratin proteins (Steinert, 1993). Although some members are naturally tailless, such as K19 and phakinin, they are competent to assemble into filaments (Bader et al., 1986; Merdes et al., 1993). There is also convincing experimental evidence from studies of truncated K8, K18, K5, K14, and the hair keratin hHa1 that the tail domain of type I as well as type II keratins is dispensable for filament formation in vitro (Hatzfeld and Weber, 1990; Wilson et al., 1992; Winter et al., 1997; Bousquet et al., 2001). However, other functions have been ascribed to the keratin tail, such as KIF stabilization owing to low-affinity KIF binding and involvement in salt- and alkaline pH-induced filament bundling (Bousquet et al., 2001). The latter data are in line with the observation of reduced supramolecular KIF bundling in IHCM due to an altered and shortened K1 tail (Sprecher et al., 2001), and are likely to apply to the case presented here. In this study, besides the finding of a new pathogenic KRT1 mutation associated with diffuse PPK and an IHCM-like phenotype, we also identified a novel size polymorphism in exon 9 of KRT1 (c.1569del27) in the African-American population. This sequence variant was detected in 2.9% of African-American alleles but not in white individuals, which were exclusively investigated in a previous study (Korge et al., 1992). As demonstrated here, the 27 bp deletion polymorphism was found on the same allele as the c.1656del21 polymorphism, thus producing a V2 domain with 16 fewer residues and seven glycine loops (Figure 2c) instead of the 10 glycine loops (Figure 2b) found in the wild-type protein. These findings suggest a remarkable variability in the number of glycine loops across different human races.

(Figure 1a and c). Reportedly, the proband’s father and sister were similarly affected but could not be contacted or declined participation, as is the case with his daughter. Only the proband gave informed consent to participate in this study, which adheres to the Helsinki Guidelines and was approved by the Institutional Review Board. Buccal swabs were collected and prepared for DNA analysis as previously described (Richards et al., 1993). Histological analysis of a skin biopsy from the left palm was performed following standard procedures.

Mutation analysis The coding sequence and flanking intronic boundaries of the keratin 1 gene (KRT1) were PCR-amplified from genomic DNA with Taq polymerase and 10% Q solution (Qiagen, Valencia, CA), using previously published primer pairs (Chipev et al., 1992; Korge et al., 1992) for exons 1–5, 8, and 9. For exons 6 and 7, new balanced primer pairs were selected with the Primer3 software: exon 6 (forward) 50 -AGC ATC ATT GCT GAG GTC AA-30 /(reverse) 50 -GGG TTA CCC CCA TTC CAT AC-30 and exon 7 (forward) 50 -CTC ATT ATT GGC CTC ACT GGA G-30 /(reverse) 50 -TCC TGC TCC GTG TAC TTT TCA T-30 . PCR cycling conditions were as follows: 951C for 5 minutes followed by 35 cycles at 951C for 30 seconds, 58–601C for 45 seconds, 721C for 90 seconds, and a final extension step at 721C for 7 minutes. After agarose gel electrophoresis (1  TBE, 1.5–3%) and gel purification with the QIAquick gel extraction kit (Qiagen), PCR fragments were directly sequenced using the BigDye terminator sequencing system on an ABI Prism 377 sequencer (PE Applied Biosystems, Foster City, CA) and the primers listed above, including an additional primer for exon 1 (50 -CTT GGT GGC AGT AAA AGC AT-30 ). DNA sequence aberrations were confirmed by bidirectional, allele-specific sequencing and/or agarose gel electrophoresis.

KRT1 size polymorphisms For analysis of the novel KRT1 in-frame size polymorphism, 1569del27 in exon 9, we developed three additional primer pairs: exon 9a (forward) 50 -TGG GCT GGA AAC GGA GTT GAG-30 , exon 9b (reverse) 50 -ACC TCC AGA ACC ATA GCT A-30 , and exon 9c (reverse) 5’-TAG CCC CCA CTG CTG CTT-30 . Primers 9a/9b were used to produce a 300 bp amplicon of exon 9 encompassing both the 21 and 27 bp deletions, while primers 9a/9c amplified a 170 bp segment spanning only across the 27 bp deletion (see Figure 2a). Analysis of fragment sizes after agarose gel electrophoresis (1  TBE, 2.5%) was used to determine the presence or absence of these size polymorphisms in KRT1 in the patient and in control individuals (51 of African-American and 109 of European origin). For the 9a/9b PCR reaction, the presence of a 300 bp band indicated the wild-type allele, a band of approximately 275 bp was found in the presence of the 21 or 27 bp deletion, and a band of 252 bp showed the presence of both deletions. PCR 9a/9c allowed distinguishing between presence (170 bp) and absence (143 bp) of the 27 bp deletion.

Electronic database information

MATERIALS AND METHODS Patients and biological material We examined a 44-year-old African-American man and his 14-yearold daughter who presented to our clinic for the treatment of painfully fissured and thickened palms and soles. The father’s keratoderma had progressively worsened over the past decades

Accession numbers and URLs for data in the article are as follows: OMIM: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=O MIM (#146590 for ichthyosis hystrix Curth–Macklin) Primer3: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi The Human Intermediate Filament Mutation Database: http:// www.interfil.org/ www.jidonline.org

83

ES Richardson et al. Keratin 1 Mutation in Ichthyosis Hystrix Curth–Macklin

NCBI Entrez Nucleotide database: http://www.ncbi.nlm.nih.gov/ entrez/query.fcgi?db=Nucleotide (NM_006121.2 for KRT1) CONFLICT OF INTEREST The author states no conflict of interest.

REFERENCES Bader BL, Magin TM, Hatzfeld M, Franke WW (1986) Amino acid sequence and gene organization of cytokeratin no. 19, an exceptional taitless intermediate filament protein. EMBO J 5:1865–75 Bousquet O, Ma L, Yamada S, Gu C, Iei T, Takahashi K et al. (2001) The nonhelical tail domain of keratin 14 promotes filament bundling and enhances the mechanical properties of KIFs in vitro. J Cell Biol 155:747–53 Chipev CC, Korge BP, Markova N, Bale SJ, DiGiovanna JJ, Compton JG et al. (1992) A leucine–proline mutation in the H1 subdomain of keratin 1 causes epidermolytic hyperkeratosis. Cell 70:821–8

Niemi KM, Virtanen I, Kanerva L, Muttilainen M (1990) Altered keratin expression in ichthyosis hystrix Curth–Macklin. A light and electron microscopic study. Arch Dermatol Res 282:227–33 Ollendorff-Curth H, Allen Jr FH, Schnyder UW, Anton-Lamprecht I (1972) Follow-up of a family group suffering from ichthyosis hystrix type Curth–Macklin. Humangenetik 17:37–48 Ollendorff Curth H, Macklin MT (1954) The genetic basis of various types of ichthyosis in a family group. Am J Hum Genet 6:371–82 Richards B, Skoletsky J, Shuber AP, Balfour R, Stern RC, Dorkin HL et al. (1993) Multiplex PCR amplification from the CFTR gene using DNA prepared from buccal brushes/swabs. Hum Mol Genet 2:159–63 Sprecher E, Ishida-Yamamoto A, Becker OM, Marekov L, Miller CJ, Steinert PM et al. (2001) Evidence for novel functions of the keratin tail emerging from a mutation causing ichthyosis hystrix. J Invest Dermatol 116:511–19

Gu L-H, Coulombe PA (2005) Defining the properties of the nonhelical tail domain in type II keratin 5: insight from a bullous disease-causing mutation. Mol Biol Cell 16:1427–38

Sprecher E, Yosipovitch G, Bergman R, Ciubutaro D, Indelman M, Pfendner E et al. (2003) Epidermolytic hyperkeratosis and epidermolysis bullosa simplex caused by frameshift mutations altering the V2 tail domains of keratin 1 and keratin 5. J Invest Dermatol 120:623–6

Hatzfeld M, Weber K (1990) Tailless keratins assemble into regular intermediate filaments in vitro. J Cell Sci 97:317–24

Steinert PM (1993) Structure, function, and dynamics of keratin intermediate filaments. J Invest Dermatol 100:729–34

Jonca N, Guerrin M, Hadjiolova K, Caubet C, Gallinaro H, Simon M et al. (2002) Corneodesmosin, a component of epidermal corneocyte desmosomes, displays homophilic adhesive properties. J Biol Chem 277:5024–9

Whittock NV, Smith FJ, Wan H, Mallipeddi R, Griffiths WA, DoppingHepenstal P et al. (2002) Frameshift mutation in the V2 domain of human keratin 1 results in striate palmoplantar keratoderma. J Invest Dermatol 118:838–44

Kanerva L, Karvonen J, Oikarinen A, Lauharanta J, Ruokonen A, Niemi KM (1984) Ichthyosis hystrix (Curth–Macklin). Light and electron microscopic studies performed before and after etretinate treatment. Arch Dermatol 120:1218–23

Wilson AK, Coulombe PA, Fuchs E (1992) The roles of K5 and K14 head, tail, and R/K L L E G E domains in keratin filament assembly in vitro. J Cell Biol 119:401–14

Korge BP, Compton JG, Steinert PM, Mischke D (1992) The two size alleles of human keratin 1 are due to a deletion in the glycine-rich carboxylterminal V2 subdomain. J Invest Dermatol 99:697–702

84

Merdes A, Gounari F, Georgatos SD (1993) The 47-kD lens-specific protein phakinin is a tailless intermediate filament protein and an assembly partner of filensin. J Cell Biol 123:1507–16

Journal of Investigative Dermatology (2006), Volume 126

Winter H, Hofmann I, Langbein L, Rogers MA, Schweizer J (1997) A splice site mutation in the gene of the human type I hair keratin hHa1 results in the expression of a tailless keratin isoform. J Biol Chem 272: 23345–52

Suggest Documents