4946–4953 Nucleic Acids Research, 1997, Vol. 25, No. 24
1997 Oxford University Press
A novel nucleic acid-binding protein that interacts with human Rad51 recombinase Oleg V. Kovalenko1, Efim I. Golub1, Patricia Bray-Ward1, David C. Ward1,2 and Charles M. Radding1,2,* 1Department
of Genetics and 2Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06510, USA
Received September 4, 1997; Revised and Accepted October 22, 1997
ABSTRACT Using the yeast two-hybrid system, we isolated a cDNA encoding a novel human protein, named Pir51, that strongly interacts with human Rad51 recombinase. Analysis in vitro confirmed the interaction between Rad51 and Pir51. Pir51 mRNA is expressed in a number of human organs, most notably in testis, thymus, colon and small intestine. The Pir51 gene locus was mapped to chromosome 12p13.1–13.2 by fluorescence in situ hybridization. The Pir51 protein was expressed in Escherichia coli and purified to near homogeneity. Biochemical analysis shows that the Pir51 protein binds both single- and double-stranded DNA, and is capable of aggregating DNA. The protein also binds RNA. The Pir51 protein may represent a new member of the multiprotein complexes postulated to carry out homologous recombination and DNA repair in mammalian cells. INTRODUCTION Eukaryotic Rad51 protein is a homolog of bacterial RecA recombinase, which plays a central role in homologous recombination by carrying out the pairing of homologous DNA molecules and initiating the strand exchange reaction (1,2). Both genetic and biochemical data suggest that Rad51 protein is intimately involved in a variety of recombination events in the eukaryotic cell. In Saccharomyces cerevisiae, the RAD51 gene belongs to the RAD52 epistasis group of genes, mutations in which show defects in genetic recombination and repair of double-strand breaks in mitosis and meiosis (3). Vertebrate Rad51 homologs are highly expressed in reproductive and lymphoid organs (4–6). Nuclear foci of Rad51 protein are detected on synaptonemal complexes of mouse spermatocytes (7,8), in cultured human cells after DNA damage (7), in stimulated lymphocytes (9) and in primary murine B cells that undergo class switch recombination (10). The formation of a RecA-like nucleoprotein filament on single- and double-stranded DNA, DNA-dependent ATPase activity, homologous pairing and strand exchange reactions further support the premise that the
DDBJ/EMBL/GenBank accession no. AF006259
Rad51 protein is a eukaryotic homolog of the RecA protein (11–15). Considering the biochemical complexity of recombination systems in eukaryotes, it is conceivable that the Rad51 protein would interact with other proteins. Most of the data on Rad51 interactions come from analysis in budding yeast. A number of genetic interactions among members of the RAD52 epistasis group have been established and some of these interactions were confirmed by use of the yeast two-hybrid system and biochemical analysis in vitro. In particular, yeast Rad51 protein was shown to interact with yeast Rad52, Rad54 and Rad55 proteins (16–19). Recently, the Rad51–Rad52 and Rad51–Rad54 interaction of mammalian proteins was also demonstrated (20,21). The fact that the mammalian Rad51 gene is essential for cell proliferation (22), whereas the RAD51 gene of baker’s yeast is not, suggests the former’s involvement in some very fundamental processes that might include replication and chromosome segregation, as well as DNA repair and recombination. Indeed, human Rad51 protein has been shown to interact in vitro and/or in vivo with the tumor suppressors p53 (23), BRCA1 (24) and BRCA2 (25) and a ubiquitin-conjugating enzyme Ubc9 (26). Clearly, further biochemical and genetic analysis of these and other Rad51 protein–protein interactions should greatly facilitate our understanding of the roles of Rad51 protein. In this study, we present data on identification of a new protein that interacts with human Rad51 protein. The biochemical characterization of this novel protein, which we named Pir51, shows that it is capable of binding and aggregating DNA and binding RNA. The Pir51 protein might represent a novel member of a putative multiprotein recombination complex of mammalian cells. MATERIALS AND METHODS Two-hybrid system and DNA cloning The two-hybrid system analysis of HsRad51 protein interactions was carried out as described previously (26), using a Matchmaker two-hybrid cDNA library from HeLa S3 cells (Clontech). Two isolated clones that contained parts of Pir51 coding sequence were designated p13-3 and p23-10 (Fig. 1). To obtain the complete 5′ sequence of Pir51 cDNA, PCR was carried out from the
*To whom correspondence should be addressed. Tel: +1 203 737 2942; Fax: +1 203 785 7023; Email:
[email protected]
4947 Nucleic Acids Acids Research, Research,1994, 1997,Vol. Vol.22, 25,No. No.124 Nucleic
4947
Matchmaker library, using primers EG280 (GAGATCCTAGAACTAGTGGATCC) and EG281 (CTTCACCAGGTGCAAAGTCTGG). Primer EG280 is complementary to the vector sequence just upstream of the cDNA insert, and EG281 is complementary to a region of coding strand of Pir51 cDNA located between nt 533 and 551 from the 5′-end of clone p23-10. PCR amplification yielded an ∼700 bp fragment which was cloned in pCRII vector (Invitrogen) and then sequenced. An ATG codon was identified in this fragment that was located just 6 nt upstream of the 5′-end of the p23-10 clone. Additional two-hybrid fusions of Pir51 protein with Gal4 DNA-binding and activation domains were made using vectors pGBT9 and pGAD GH, respectively, obtained from Clontech, as follows: to make plasmids pOK18 and pOK23 (Fig. 1 and Table 1), a fragment of Pir51 coding sequence was amplified by PCR from clone p23-10 using primers EG256 (CGAGGATCC GATGGCTTTAGATGACAAGCTC) and EG263 (CAGGAGATCTCCCAACCAAACATTCC). In both oligomers, homology with Pir51 nucleotide sequence is underlined. The PCR products were inserted into pGAD GH and pGBT9, respectively. To make plasmids pOK24 and pOK31, PCR was done from the Matchmaker library using primer EG287 (GTGGATCCACATATGGTGCGGCCTGTGAGACATAAG) and EG263 (see above), and the resulting fragment inserted into pGAD GH and pGBT9, respectively. Two-hybrid interactions were quantitated in yeast reporter strain SFY526 (27), using o-nitrophenyl-β-D-galactopyranoside as a substrate. The data presented in Table 1 are the average from experiments with at least three independent liquid cultures. Isolation of a genomic clone of Pir51 and gene mapping A human genomic DNA library in λ phage DASH II (Stratagene) was used for isolation of a genomic clone of Pir51. The phages (∼6 × 105 pfu) were plated on E.coli XL1-Blu MPA/2 (Stratagene) and plaques were transferred onto Hybond-N membrane (Amersham). The Pir51 cDNA insert from two-hybrid clone p23-10 was labeled with 32P by random priming and used as a probe. Four positive genomic clones (numbered 5.1, 6.3, 8.1 and 8.2) were isolated, and PCR analysis confirmed that the clones contain Pir51 sequences. Clone 8.1 was labeled with digoxigenin-dUTP by nick translation and hybridized to normal human metaphase chromosomes together with an Alu repeat-specific oligonucleotide GM009 labeled with biotin (28). Hybridization, post-hybridization washes and detection were done as previously described (29). Digitized images were captured using a cooled CCD camera (Photometrics) attached to a Zeiss Axioskop fluorescence microscope. After pseudocoloring and merging, the position of the clone on chromosome 12 was determined initially from a few metaphase spreads that had both Alu banding and clone 8.1 signal. The band assignment was confirmed by FLpter (fractional length from pter) measurements (30). A pool of clones 5.1, 6.3, 8.1 and 8.2 were also mapped in a separate experiment, with the same result. Protein purification The DNA fragment encoding the 23.3 kDa segment of the 36.7 kDa Pir51 protein (Fig. 1) was amplified from the two-hybrid clone p23-10, using PCR with primers EG256 and EG263 (see above), that carry BamHI and BglII restriction sites, respectively. The
Figure 1. Maps of the plasmid constructs encoding a Rad51-interacting protein, Pir51, described in this study. Only Pir51-coding parts of the constructs are shown. The names of constructs used for protein expression are underlined; others are two-hybrid constructs. p13-3 and p23-10 are the two clones isolated in a two-hybrid screen. The sequence of an insert of 150 nucleotides present in p13-3, pOK24 and pOK32 (crosshatched) is shown underlined in Figure 2. An internal ATG codon used for making some of the constructs is shown.
fragment was inserted into pQE-31 expression vector (Qiagen), that had been digested with BamHI, producing plasmid pEG13. The plasmid was transformed into E.coli strain M15 carrying pREP4 plasmid (Qiagen). The bacteria were grown in LB medium containing 100 µg ampicillin/ml and 30 µg kanamycin/ml until OD600 = 0.6. The protein was induced by the addition of 1 mM IPTG for 3 h. Cell lysis and protein purification in denaturing conditions on Ni-NTA resin (Qiagen) were carried out following instructions from the manufacturer. The 6× His-tagged Pir51 protein was eluted from a Ni-NTA column in 0.1 M Na-phosphate buffer, 8 M urea, 250 mM imidazole, pH 6.0. Refolding of the protein was achieved by step-wise dialysis at 4C against buffer of 50 mM Na-phosphate, pH 6.2, 400 mM NaCl, 5 mM β-mercaptoethanol (β-ME) containing 4 M and then 2 M urea, for 2 h with each buffer, and then overnight against the same buffer without urea and containing 250 mM NaCl and 5% glycerol. The dialyzed protein was diluted three times with 50 mM Na-phosphate, pH 6.2, and loaded onto a Mono-S 5/5 column (Pharmacia), pre-equilibrated with 50 mM Na-phosphate, pH 6.2, 50 mM NaCl, 1 mM β-ME. The column was developed with a linear 0–1 M NaCl gradient. Pure Pir51 fractions from Mono-S were dialyzed against 20 mM Na-phosphate, pH 6.5, 150 mM NaCl, 2 mM β-ME, 0.1 mM EDTA and 5% glycerol, and stored at 4C.
4948 Nucleic Acids Research, 1997, Vol. 25, No. 24 Table 1. Two-hybrid interactions of Rad51 and Pir51 proteins Gal4 DBD
Gal4 AD
Gal4 DBD
Gal4 AD
Units of
plasmid
plasmid
protein fusion
protein fusion
β-galactosidase
pEG918
p13-3
HsRad51
Pir51
1.4 x 101
pEG918
p23-10
HsRad51
Pir51
2.6 x 101
pEG918
pOK18
HsRad51
Pir51
1.0 x 102
pEG918
pOK24
HsRad51
Pir51
2.3 x 101
pOK23
pEG960
Pir51
HsRad51
3.2 x 102
pOK31
pEG960
Pir51
HsRad51
2.0 x 102
pEG918
pEG960
HsRad51
HsRad51
2.0 x 101
pOK34
pEG960
Pir51*
HsRad51
