A novel strategy to over-express and purify ...

Journal of Biotechnology 157 (2012) 279–286

Contents lists available at SciVerse ScienceDirect

Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec

A novel strategy to over-express and purify homologous proteins from Streptococcus pneumoniae Morena Lo Sapio a , Markus Hilleringmann b , Michèle A. Barocchi a , Monica Moschioni a,∗ a b

Novartis Vaccines and Diagnostics Research Center, 53100 Siena, Italy University of Applied Sciences, 80335 Munich, Germany

a r t i c l e

i n f o

Article history: Received 23 August 2011 Received in revised form 11 November 2011 Accepted 16 November 2011 Available online 14 December 2011 Keywords: Streptococcus pneumoniae pMU1328 Homologous over-expression RrgB pilus protein purification

a b s t r a c t Functional studies of Streptococcus pneumoniae virulence factors are facilitated by the development of complementation/mutagenesis systems. These methods usually result in poor expression yields; therefore, biochemical and structural/functional characterizations are mostly performed with proteins expressed and purified from heterologous systems (e.g. Escherichia coli). However, heterologous expression does not guarantee correct protein structure and function. In this work, we developed a method to over-express and purify homologous proteins from S. pneumoniae. The system relies on the combined use of the shuttle plasmid pMU1328 and a natural constitutive pneumococcal promoter, P96 . Efficient over-expression of secreted, membrane or surface anchored proteins, either wild type or mutant, was achieved. As proof of principle the S. pneumoniae pilus-1 backbone RrgB was successfully purified as a His-tag secreted protein (RrgB-His SP) from pneumococcal culture supernatants. N-terminal sequencing and mass spectrometry analysis of RrgB-His SP allowed the determination of the leader sequence cleavage site in pneumococcus, while proteolysis studies confirmed the stability of RrgB-His SP to trypsin digestion. The data presented here support the use of this novel homologous expression method for all S. pneumoniae proteins for which extensive characterization studies are planned. Moreover, given the promiscuity of the pMU1328 replicon, this system could be used in diverse bacterial species. © 2011 Elsevier B.V. All rights reserved.

1. Introduction The Gram-positive human pathogen Streptococcus pneumoniae (S. pneumoniae) represents one of the four major infectious diseases together with HIV, malaria, and tuberculosis. The pneumococcus is one of the most important etiologic agents of respiratory tract infections and invasive diseases (i.e. sinusitis, otitis media, community acquired pneumonia, septicemia and meningitis), as well as a member of the human commensal flora, asymptomatically colonizing the nasopharynx of children and healthy adults (Selman et al., 2000; Johnson et al., 2010; Henriques-Normark and Normark, 2010; O’Brien et al., 2009). The study of the function of pneumococcal proteins not only allows better understanding of the biology and related virulence mechanisms of S. pneumoniae, but also provides new strategies, like innovative protein-based vaccines, to combat pneumococcal related diseases (Denoel et al., 2011; Loisel et al., 2011; Holmlund et al., 2009; Giefing et al., 2008; Gentile et al., 2011).

∗ Corresponding author at: Novartis Vaccines and Diagnostics, Via Fiorentina 1, Siena, Italy. Tel.: +39 0577 245342; fax: +39 0577 249314. E-mail address: [email protected] (M. Moschioni). 0168-1656/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jbiotec.2011.11.011

Thus far, the host of choice for pneumococcal protein expression and purification has been Escherichia coli (E. coli), for which many strains and expression systems are available. However, heterologous protein expression in E. coli is not always 100% suitable; appropriate post-translational modifications such as glycosylations are not introduced, and protein expression in E. coli can result in improper protein folding/functionality and sub-optimal expression yields (Samuelson, 2011; Angov et al., 2011; Francis and Page, 2010; Saida, 2007). On the other hand, the choice among systems available for protein production in Gram-positive bacteria is limited, and these methods are not applicable in all bacterial strains and for all proteins (Noreen et al., 2011; Linares et al., 2010; Conrad et al., 1996; Warren et al., 2005; Fukatsu et al., 2005; Biswas et al., 2008; Fujimoto and Ike, 2001). For these reasons, the strengths and limitations of different prokaryotic expression systems have to be evaluated. If applicable, homologous protein production in the natural host is often preferable. Autologous host background offers substantial advantages where protein function is associated with other indigenous accessory factors, or when biochemical assays to evaluate protein functionality are not available. Among the existing Gram-positive expression systems, to our knowledge no specific methods have been designed for homologous protein over-expression/purification in S. pneumoniae.

280

M. Lo Sapio et al. / Journal of Biotechnology 157 (2012) 279–286

Effective expression systems are needed to assess protein functionality concurrently facilitating recombinant homologous production of wild type (wt) or mutant pneumococcal proteins for further applications (i.e. through mutagenesis/complementation/purification assays). The shuttle plasmid pMU1328, originally designed to detect DNA fragments exhibiting promoter activity in different Streptococcal species (Achen et al., 1986; Lakshmidevi et al., 1990), is one of the systems used to complement protein expression in S. pneumoniae deletion mutants (Sung et al., 2001; Gentile et al., 2011; Espinosa and Nieto, 2003; Bartilson et al., 2001; Pericone et al., 2003; Yother et al., 1992). pMU1328 efficiently replicates in both E. coli and S. pneumoniae, contains an erythromycin resistance marker, and is easy to manipulate due to the presence of the M13mp 18 polylinker. In this work, we evaluated the use of the plasmid pMU1328 and the natural constitutive pneumococcal promoter P96 to overexpress and purify homologous proteins in S. pneumoniae. Genes coding for pneumococcal proteins with different sub-cellular localizations (secreted, membrane and cell wall anchored) were introduced in the pMU1328 shuttle vector under the transcriptional control of either P96 or the constitutive erythromycin promoter. The obtained plasmids were then transformed in site-specific S. pneumoniae knock-out deletion mutants of the corresponding genes and the relative promoter strength in pneumococcus was investigated and compared with single-copy expression from the integrated chromosomal location. His-tagged pneumococcal RrgB lacking the cell wall anchor motif served as a model protein to validate the design of efficient pMU1328-P96 mediated expression and secretion, followed by one step purification of the protein.

and lysed at 37 ◦ C for 20 min in a buffer containing 0.3 M sodium deoxycholate, 0.02% sodium dodecyl sulphate and 0.2% sodium citrate. Growth supernatants, when needed, were recovered and filtered (0.2 ␮m). Lysates and supernatants were stored at −20 ◦ C until further analysis. 2.2. Sera Rabbit sera against recombinant His-tagged proteins expressed/purified from E. coli (RrgB-His, Spr0096-His and SrtC-2-His) were obtained by immunizing New Zealand rabbits of 2.5 kg body weight (Charles River Laboratory) with 100 ␮g of the purified proteins (Gianfaldoni et al. (2007) and unpublished data) (three doses subcutaneous immunization two weeks apart). Animal treatments were done in compliance with the current law, and authorized by the Italian Ministry of Health. Anti His-Tag antibodies (rabbit) were purchased from Sigma. 2.3. Generation of S. pneumoniae deletion mutants TIGR4 and D39 isogenic mutants were generated by allelic exchange. Briefly, fragments of approximately 500 bp upstream and downstream the target genes were amplified by PCR and spliced into a kanamycin resistance cassette (oligonucleotides are listed in Table 2) by using overlap extension PCR (complementary nucleotide fragments are indicated in Table 2). The PCR fragments were then cloned into pGEMt (Promega) and transformed in S. pneumoniae with conventional methods (Alloing et al., 1998). Selection of Kanamycin resistant transformants was performed on plates supplemented with kanamycin (500 ␮g/ml) and insertion was confirmed by PCR and Western blot (WB) analysis.

2. Material and methods 2.4. pMU1328 cloning and S. pneumoniae transformation 2.1. Pneumococcal cultures and sample preparation S. pneumoniae strains (wild type, deletion mutants and complemented deletion mutants) used in this study are listed in Table 1. Bacteria were routinely grown at 37 ◦ C in 5% CO2 . Following over night (o.n.) growth on Tryptic Soy Agar plates (TSA, Becton Dickinson) supplemented with colistine 10 mg/l, oxolinic acid 5 mg/l and 5% defibrinated sheep blood (vol/vol) bacteria were inoculated in Todd Hewitt Broth (Becton Dickinson) supplemented with 0.5% (w/w) yeast extract (THYE) and grown until A600 = 0.5. Kanamycin 500 ␮g/ml and/or erythromycin 1 ␮g/ml were added to the solid and liquid media when needed. To prepare bacterial lysates, the bacteria were harvested from liquid cultures by centrifugation

The pMU1328 recombinant plasmids used in this work (Achen et al., 1986) were obtained as described below. Briefly, the pneumococcal genes (spr0096, srtC-2 and rrgB) and the spr0096 promoter region (P96 ), corresponding to the intergenic region between the spr0095 and spr0096 genes, were amplified on the S. pneumoniae TIGR4 genomic DNA, while the erythromycin resistance (ermB) constitutive promoter (Pc), deriving from the pVA838 shuttle vector (NCBI accession number: AB057644 and (Achen et al., 1986)), was amplified on the pMU1328 plasmid (primers used are listed in Table 3). Each gene amplification product was fused by overlap extension PCR to either the Pc or the P96 promoter regions. The obtained PCR products were then digested with the

Table 1 List of the S. pneumoniae strains used in this study. S. pneumoniae strain

Relevant characteristicsa

Source

TIGR4 D39 TIGR4/pMU1328 D39/pMU1329 D3996 D3996/Pc-96 D3996/P96 -96 TIGR4rrgB TIGR4rrgB/Pc-rrgB TIGR4rrgB/P96 -rrgB TIGR4srtC1-3 TIGR4srtC1-3/Pc-srtC-2 TIGR4srtC1-3/P96 -srtC-2 TIGR4PI-1 TIGR4PI-1/P96 -rrgBHis

Serotype 4 strain TIGR4 Serotype 2 strain D39 TIGR4/empty pMU1328 (ErmR) D39/empty pMU1328 (ErmR) D39 96::kan (KanR) D3996/pMU1328 Pc-spr0096 (KanR, ErmR) D3996/pMU1328 P96 -spr0096 (KanR, ErmR) TIGR4 rrgB::kan(KanR) TIGR4rrgB/pMU1328 Pc-rrgB(KanR, ErmR) TIGR4rrgB/pMU1328 P96 -rrgB(KanR, ErmR) TIGR4srtC1-2-3:kan(KanR) TIGR4srtC1-3/pMU1328 Pc-srtC-2(KanR, ErmR) TIGR4srtC1-3/pMU1328 P96 -srtC-2(KanR, ErmR) TIGR4 rlrA-rrgABC-srtC1-2-3::kan(KanR) TIGR4PI-1/pMU1328 P96 -rrgBHis(KanR, ErmR)

Laboratory strain Laboratory strain This study This study This study This study This study Gentile et al. (2011) Gentile et al. (2011) This study De Angelis et al. (2011) De Angelis et al. (2011) This study This study This study

a

ErmR: erythromycin resistant; KanR: kanamycin resistant;/: transformed with the pMU1328 plasmid.


281

Table 2 Oligonucleotides used to create deletion mutants in TIGR4 and D39 wt strains. Amplification products

Primer for (5 –3 )a

Primer rev (5 –3 ) a

Kan cassette 96 upstream 96 downstream rrgB upstream rrgB downstream srtC1-3 upstream srtC1-3 downstream PI-1 upstream PI-1 downstream

GTCATGATGGCCTAAGTGGCCAACCTGCAGGAACAGTGAATTGGAGTT AATTGTCGACTGGAATTCAACTTCTGTTGGAGTA CTAGCCGGCATTTAAATTTGCATCGGTTGTTTCAACTGTAAGCGGATCT AATTGTCGACATTATTATTGTCATGTGTAATTCA CTAGCCGGCATTAAAATTTGCATCGAAGCTGCTTATAATGCTGCTGTGA AATTGTCGACTCTGTTAGGAAAAGCGATAAAATG CTAGCCGGCATTTAAATTTGCATCGAACCTCTCAATGGTTGTACCGTGG AATTGTCGACTATAATCTCCACAGTGGGATTTAC CTAGCCGGCATTTAAATTTGCATCGCAGGGATTCGCTCAGTGATTGCTG

CGATGCAAATTTTAATGCCGGCTAGATCTAGGTACTAAAACAATTCATC GTTGGCCACTTAGGCCATCATGACGTTATCAATGTGGTTGTTTTCTGC TTTAGCGGCCGCTCAACGTTTATATGACTTGCGAAT GTTGGCCACTTTGGCCATCATGACTCCATCTTCACCGACATAAGTTGA TTTAGCGGCCGCGCAAGTTGATCCTCATCTTTGTTG GTTGGCCACTTAGGCCATCATGACCAGTACCAGCATAAACCGGCAA TTTAGCGGCCGCACCAATAAAGAGATTTTAGACAAG GTTGGCCACTTAGGCCATCATGACCAGATGTAAACTTAATAAAGTCCA TTTAGCGGCCGCACAAAGAGCCGGAAAAAGGAACAG

a

Italic letters represent complementary sequences added to perform the overlap extention PCR.

Table 3 Oligonucleotides used to clone the genes of interest under the control of either Pc or P96 in the pMU1328 vector. Plasmid

Amplification primers (5 –3 )a,b,c Promoter region

Gene

pMU1328 Pc-spr0096

For Rev For For Rev For Rev For Rev For Rev For Rev

For Rev Rev For Rev For Rev For Rev For Rev For Rev

pMU1328 P96 -spr0096 pMU1328 Pc-rrgB pMU1328 P96 -rrgB pMU1328 P96 -rrgBHis pMU1328 Pc-srtC-2 pMU1328 P96 -srtC-2 a b c

GTGCGTGAATTCGAAACAGCAAAGAATGGCGGAAAC GTAATCACTCCTTCTTAATTACAA GTGCGTGGATCCGATGATATCAAAGACAGATTGAAA GTGCGTGAATTCGAAACAGCAAAGAATGGCGGAAAC GTAATCACTCCTTCTTAATTACAA GTGCGTGGATCCGATGATATCAAAGACAGATTGAAA ATTCGAAAATTCTCCTTCTTTCTA GTGCGTGGATCCGATGATATCAAAGACAGATTGAAA ATTCGAAAATTCTCCTTCTTTCTA GTGCGTGAATTCGAAACAGCAAAGAATGGCGGAAAC GTAATCACTCCTTCTTAATTACAA GTGCGTGGATCCGATGATATCAAAGACAGATTGAAA ATTCGAAAATTCTCCTTCTTTCTA

TTGTAATTAAGAAGGAGTGATTACATGAAATCAATAACTAAAAAGATT CAGCGTGTCGACGTTCGTTAGTTCTTAATACCAGCC CAGCGTGTCGACGTTCGTTAGTTCTTAATACCAGCC TTGTAATTAAGAAGGAGTGATTACATGAAATCAATCAACAAATTTTTA CAGCGTGTCGACTGGCTCCTTTCTCTCTTACTTAAG TAGAAAGAAGGAGAATTTTCGAATATGAAATCAATCAACAAATTTTTA CAGCGTGTCGACTGGCTCCTTTCTCTCTTACTTAAG TAGAAAGAAGGAGAATTTTCGAATATGAAATCAATCAACAAATTTTTA CAGCGTGTCGACTTAatggtgatggtgatggtgAGTGATTTTTTTGTTGACTACTTT TTGTAATTAAGAAGGAGTGATTACATGGACAACAGTAGACGTTCACGA CAGCGTGTCGACCGTAGTTTAGTCCTTGACATGACG TAGAAAGAAGGAGAATTTTCGAATATGGACAACAGTAGACGTTCACGA CAGCGTGTCGACCGTAGTTTAGTCCTTGACATGACG

Underlined sequences correspond to the restriction recognition sites. The sequence coding for the 6xHis Tag protein fragment is represented with bold letters. Italic letters represent complementary sequences added to perform the overlap extension PCR.

appropriated restriction enzymes (Table 3), and cloned into the complementation plasmid pMU1328, containing an erythromycin resistance marker (Achen et al., 1986). The ligation mixtures were transformed into competent cells of Escherichia coli DH10B. Selection of erythromycin resistant transformants was performed on plates supplemented with erythromycin (100 ␮g/ml) and insertion was confirmed by sequencing. D39 or TIGR4 wt or deletion mutants strains were then transformed with conventional methods (Alloing et al., 1998) by using the obtained plasmids or the empty pMU1328 plasmid at a final concentration of 50 ng/ml. S. pneumoniae transformants (25–100 single colonies), selected on TSA plates supplemented with 5% defibrinated sheep blood (vol/vol) and antibiotics (erythromycin 1 ␮g/ml with or without kanamycin 500 ␮g/ml), were analyzed by PCR to confirm the presence of the plasmid and further investigated for the expression of the proteins of interest. The transformation frequency (TF), measured as the ratio of the number of colonies obtained in the presence of the selective antibiotic to the number of colonies without antibiotic selection was 2.5 × 10−5 (±1.5 × 10−5 ) for D39 and 1. 5 × 10−5 (±2 × 10−5 ) for TIGR4 (comparable to the TFs obtained with the suicide vectors used to create site-specific knock-out deletion mutants).

2.5. Relative quantitative real-time PCR quantification of pMU1328 copy number in S. pneumoniae and E. coli The quantification of the pMU1328 copy number relative to the chromosomal DNA was evaluated in E. coli and S. pneumoniae by quantitative real-time PCR (qRT-PCR) analysis. The primers used for qRT-PCR analysis are reported in Table 4. The oligonucleotides

were designed to specifically amplify about 300 bp fragments on a single copy gene in the chromosomal DNA (reference) of E. coli or S. pneumoniae (GAPDH, glyceraldehyde 3-phosphate dehydrogenase) and onto a unique sequence in the pMU1328 plasmid (target). The qRT-PCR reaction was performed in a Light Cycler 480 II (Roche), by using the Light Cycler SYBR green I Master (Roche) according to the manufacturer’s instructions. Comparable results were obtained for total DNA samples prepared with conventional methods and heat-lyzed bacteria (100 ◦ C for 15 min). For each gene, duplicate reactions were performed on 10 fold serially diluted bacterial samples isolated from separate assays. The PCR conditions included a single denaturation cycle of 95 ◦ C for 10 min, followed by 45 cycles of 95 ◦ C for 10 s (denaturation), 60 ◦ C for 30 s (annealing) and 72 ◦ C for 30 s (elongation). Melting curves and agarose gels were used to determine the specificity of the amplification. Relative quantification analyses (ratio target/reference) were performed with Light Cycler® 480 SW 1.5 (Roche).

2.6. RrgB-His SP protein purification from S. pneumoniae culture supernatants S. pneumoniae TIGR4PI-1/P96 -rrgB-His strain was grown in THYE supplemented with erythromycin (1 ␮g/ml) and kanamycin (500 ␮g/ml). Following bacteria harvesting by centrifugation, the supernatants were filtered (0.2 ␮m), dialyzed o.n. against 100 mM sodium phosphate buffer pH 6.3 and then supplemented with 100 mM sodium chloride and 20 mM imidazole final concentrations. The RrgB-His SP protein was then purified by metal chelate affinity chromatography on columns packed with Chelating Sepharose HP (GE Healthcare) eluting with a 100 mM sodium

282


phosphate buffer pH 6.3 supplemented with 100 mM sodium chloride and 500 mM imidazole. Protein purity was determined by SDS-PAGE. The fractions containing the purified protein were stored at −80 ◦ C until further use. Protein concentration was estimated by both SDS-PAGE and NanoDrop (Thermo Scientific) measurement.

2.7. SDS-PAGE and Western blot analysis SDS-PAGE analysis was performed using Nu-PAGETM 4–12% Bis–Tris gradient gels (Invitrogen) according to manufacturer instructions. See blue plus 2TM pre-stained MW (Invitrogen) served as protein standard. Gels were stained with Colloidal Coomassie Blue G-250 (Invitrogen) or processed for WB analysis by using standard protocols. Rabbit antibodies raised against recombinant His-Tag-proteins and rabbit anti His-Tag antibodies were used at 1:10,000 and 1:2000 dilution, respectively. Secondary goat anti-rabbit IgG alkaline phosphatase conjugated antibodies (Promega) were used at 1:5000 and the signal developed by using Western Blue Stabilized Substrate for Alkaline Phosphatase (Promega).

2.8. N-terminal sequencing of RrgB-His SP by Edman degradation Automatic N-terminal sequencing of the first six amino acid residues of RrgB-His SP was carried out on an Applied Biosystems instrument Model H49 Procise protein/peptide sequencer following manufacturer’s instructions. Before sequencing, about 5 ␮g of the purified protein solution were passed through a ProSorb PVDF cartridge (Applied Biosystems); the cartridge was washed several times with 0.1% trifluoroacetic acid to remove salts present in the protein preparation and then the sample loaded for sequencing.

2.9. Enzymatic digestion of the proteins RrgB-His SP and two pneumococcal recombinant proteins purified from E. coli, RrgB-His and the beta galactosidase BgaA (Spr0565, R6 strain annotation) (Gianfaldoni et al. (2007) and unpublished data), were digested with sequencing grade modified Trypsin (Promega), using a ratio enzyme/substrate of 1/100 (wt/wt), in 50 mM HEPES pH 7.5 and 200 mM NaCl. o.n. at room temperature (procedure 1) (El Mortaji et al., 2010), or in 50 mM ammonium bicarbonate pH 8, containing 0.1% (w/v) Rapigest® (Waters) o.n. at 37 ◦ C (procedure 2) (Moschioni et al., 2010).

3. Results and discussion 3.1. The promoter region P96 activates the transcription of spr0096 more efficiently than the erythromycin constitutive promoter The pneumococcal Spr0096 (R6 protein annotation, Hoskins et al. (2001)) is a protein containing LysM peptidoglycan-binding domains, which is conserved in many S. pneumoniae strains. This protein is constitutively expressed under standard growth conditions, and actively secreted into the culture media (Ng et al. (2005) and unpublished data). In the context of mutagenesis/complementation studies in the serotype 2 D39 strain, to restore the expression of Spr0096 in D3996 (spr0096 deletion mutant in D39 background), the spr0096 gene was inserted in the pMU1328 shuttle vector under the control of either the erythromycin constitutive promoter (Pc) (pMU1328 Pc-spr0096), or the intergenic region upstream spr0096 (comprised between the spr0095 and spr0096 genes), here named P96 (pMU1328 P96 -spr0096). Pc is a promoter region already used for complementation experiments (De Angelis et al., 2011), while the ability of P96 to promote gene transcription was not investigated thus far. Spr0096 expression was analyzed by western blot on growth supernatants of D39 and D39 complemented mutants (D3996/Pc-96 and D3996/P96 -96), by using D3996 as negative control. Interestingly, the expression of Spr0096 in D3996/Pc-96 was barely detectable, while in D3996/P96 -96 supernatants was significantly higher than in wt D39. This provides evidence that P96 contains the spr0096 natural promoter region, which actively induces the transcription of spr0096 within the pMU1328 plasmid at higher efficiency than Pc (Fig. 1). Indeed, two additional observations support the presence of a promoter region within P96 : (i) sequence analysis performed with BPROM (http://linux1.softberry.com/berry.phtml?topic = bprom&group = programs&subgroup = gfindb) revealed the presence of putative -10/-35 promoter sequences within the P96 intergenic region (-10 TAATAT and -35 TTTCTA); and (ii) a literature report indicating that this region is directly bound by the Vic regulator protein (VicR), which is implicated in pneumococcal virulence (Ng et al., 2005). Interestingly, according with the data obtained with the wild type D39 strain (unpublished data), we did not observe any modulation in the P96 promoter activity when inserted into the pMU1328 plasmid; in fact, the expression level of Spr0096 remained unchanged growing D3996/Pc-96 and D3996/P96 -96 in the presence or absence of erythromycin antibiotic selection (even following several passages) and under various growth conditions (different media and growth phases, data not shown). In order to characterize the pMU1328 expression system and further compare the activity of the two promoter regions, we calculated (for pMU1328 Pc-spr0096 and pMU1328 P96 -spr0096) the average plasmid copy number/cell in S. pneumoniae D39 by using a real-time PCR based method (see Section 2). We determined an average of 5.2 ± 0.8 pMU1328 copies/cell, regardless of the pMU1328 construct tested. This result explains the lower Spr0096 expression observed in D39 wt with respect to D3996/P96 -96 (one copy vs approximately 5 copies of spr0096 under the control of the same promoter), and suggests that the P96 promoter region could

Table 4 Primers used in QRT-PCR for the relative quantification of pMU1328 copy number. Amplified genes

Primer for (5 –3 )

Primer rev (5 –3 )

GAPDH–S. pneumoniae GAPDH–E. coli pMU1328

AGAAGGTGTTGAAGTTACACGC CCACGGCGGTAATTTCCGTTTGCG GTCTATCAATGTGCCGAAGTGTTG

CATGAAGCACCTGAGATAACTG AGTCGGCACGATGACGACCATTCA GGCTATTTGCGAGCCACTGAGGTA


be more efficient than Pc in inducing protein expression in pneumococci. In addition, comparable copy number/cell values were obtained transforming D39 with the pMU1328 empty vector, as well as the serotype 4 TIGR4 strain with all the generated plasmids, indicating that pMU1328 can be reproducibly used to restore protein expression in S. pneumoniae. Since pMU1328 efficiently replicates in E. coli bacterial cells, we evaluated the pMU1328 copies/cells in E. coli (DH10B strain), and found it to be 105.7 ± 15.5, regardless of the pMU1328 construct tested. 3.2. The promoter region P96 efficiently induces the expression of S. pneumoniae proteins with different sub-cellular localizations Given the good expression levels obtained with the P96 promoter with respect to Pc (with comparable plasmid copy numbers/cell), we sought to determine if this promoter region could efficiently induce the expression of proteins other than Spr0096 and with different sub-cellular localizations. Genes coding for a membrane associated enzyme, SrtC-2, and for a cell-wall LPXTG surface anchored protein, RrgB, were inserted in the pMU1328 plasmid under the transcriptional control of either P96 or Pc (Table 3). The srtc-2 and rrgB genes are both contained in the pilus islet-1 (PI-1) genomic region, which specifically codes for the proteins necessary to assemble the pilus-1 structure on the pneumococcal surface. In detail, rrgB encodes the RrgB pilus-1 backbone, while srtC-2 codes for SrtC-2, one of the three sortases (namely SrtC-1, SrtC-2 and SrtC-3) which covalently assemble the pilus subunits on the bacterial surface (Barocchi et al., 2006; Manzano et al., 2008). Since the three sortases are redundant in pneumococcus (Manzano et al., 2008), to simultaneously assess expression and

283

functionality of SrtC-2, the plasmids containing srtC-2 (pMU1328 Pc-srtC-2 and pMU1328 P96 -srtC-2) were transformed in a TIGR4 mutant containing the deletion of all the three sortases SrtC-1, 2 and 3 (TIGR4srtC1-3), which was unable to assemble a functional pilus. As shown in Fig. 2A the over-expression of SrtC-2 is more efficient under the control of the P96 promoter as compared with the Pc promoter and the wt TIGR4 strain. The presence of enzymatic activity in the homologous over-expressed SrtC-2 was concurrently monitored by evaluating the SrtC-2 dependent assembly of the RrgB pilus backbone subunits, which appears in the WB as a typical high molecular weight ladder (Barocchi et al., 2006). As shown in Fig. 2B, the presence of a high molecular weight RrgB ladder correlates with SrtC-2 expression. Noteworthy, a similar difference in expression induced by the two promoter regions was obtained over-expressing RrgB in a TIGR4rrgB background (Fig. 2C). These data indicate that the promoter region P96 can be used to efficiently over-express wt or mutant proteins with membrane, cell wall associated or secreted sub-cellular localizations in different background pneumococcal strains. 3.3. The pMU1328-P96 over-expression system can be used to design homologous pneumococcal protein secretion allowing simple protein recovery from the bacterial supernatant Biochemical and structural characterization of proteins purified from heterologous systems are not always predictive of the native state of a protein. In fact, protein misfolding due to different expression environments can significantly change the properties of the proteins under analysis. For this reason, a method that allows the over-expression and purification of wt or mutant proteins from a homologous system is highly desirable.

Fig. 2. The membrane enzyme SrtC-2 and the LPXTG surface anchored pilus protein RrgB are efficiently expressed under the control of the promoter region P96 . WB analysis on whole bacterial lysates of the indicated strains was performed with rabbit SrtC-2His antiserum to confirm protein expression (A), and with rabbit RrgBHis antibodies to evaluate pilus assembly (HMW-ladder) indicating the presence of a functional homologous SrtC-2 (B). (C) RrgB protein expression was analyzed by WB on whole bacterial lysates of the indicated strains with rabbit RrgBHis antiserum.

284


We thought to evaluate if the combined use of the pMU1328 plasmid and the promoter region P96 could be used as a homologous over-expression system in S. pneumoniae. Since the recombinant protein TIGR4 RrgB expressed in E. coli has been well characterized, a His tagged pneumococcal RrgB (RrgBHis SP) served as model protein to prove the efficiency of this method. To over-express a protein that following a purification step could have been comparable to that purified from E. coli (El Mortaji et al., 2011; Paterson and Baker, 2011; Spraggon et al., 2010) in characterization studies, RrgBHis SP was expressed without its C-terminal LPXTG cell-wall anchoring domain, thus preventing its polymerization in S. pneumoniae (see above). In detail, an rrgB gene fragment, coding for a full length protein containing the N-terminal leader sequence and a C-terminal His-tag in place of the LPXTG cell wall anchor, was inserted in pMU1328 under the transcriptional control of P96 (pMU1328 P96 -rrgBHis). This recombinant plasmid was then transformed in TIGR4PI-1, and RrgBHis SP expression was confirmed by WB. As shown in Fig. 3A1 and A2, RrgBHis-SP was secreted and present as a monomer in both bacterial lysates and culture supernatants of TIGR4PI-1/P96 -rrgBHis. Since the recovery of secreted proteins from bacterial supernatants generally results in simpler purification procedures, avoiding expensive extractions and resulting in less host-derived contaminations, a direct purification of RrgBHis-SP from culture supernatant was attempted. RrgBHis-SP was successfully purified from 250 ml of culture supernatant (see Section 2) obtaining 150 ␮g of protein of ∼95% purity (∼0.6 ␮g RrgBHis SP/ml starting culture at A600 = 0.5) (Fig. 3B). Sequencing of the N-terminus of the protein revealed that the N-terminal leader sequence was efficiently cleaved, despite the high yields of RrgBHis SP secreted protein, and confirmed that the mature RrgB form in S. pneumoniae starts with Ala 30 (leader

Fig. 3. RrgBHis SP purification from 250 ml of TIGR4PI-1/P96 -rrgBHis culture supernatant. (A1 and A2) WB analysis was performed with rabbit polyclonal sera against RrgBHis (panel A1) and rabbit anti His-tag antibodies (panel A2) on culture supernatants (20 ␮l in each lane) of the indicated strains and on 0.1 ␮g purified RrgBHis SP. TIGR4PI-1/P96 -rrgBHis supernatant was analyzed before (b.d.) and after dialysis (a.d.). RrgB expression was also analyzed on whole bacterial lysates (P) of TIGR4 wt and TIGR4PI-1/P96 -rrgBHis and compared to respective supernatants (S). Samples in panels A1 and A2 are loaded in the same order. (B) Coomassie stained gel showing the RrgBHis SP affinity chromatography eluted fractions (1–7). 10 ␮l of each 750 ␮l fraction were loaded. 1 ␮g of BSA (bovine serum albumin) was loaded as a standard.

Fig. 1. The genomic region upstream spr0096 (P96 ) contains a promoter that in S. pneumoniae is more efficient than the erythromycin constitutive promoter. WB analysis was performed with rabbit Spr0096His antiserum on S. pneumoniae culture supernatants of the indicated strains (15 ␮l were loaded in each lane). Arrows indicate Spr0096 specific signals. The signal at about 50 kDa is non-specific and was used as loading control.

sequence cleavage site between Ala 29 and Ala 30). ESI–MS analysis (electrospray ionization mass spectrometry) of the RrgBHis SP showed that the molecular mass was 65,216.82 Da (calculated mass 65,266.76 Da). This mass is compatible with the presence of three intra-molecular isopeptide bonds (Paterson and Baker, 2011). Finally, since RrgB expressed in E. coli is resistant to trypsin proteolytic cleavage (El Mortaji et al., 2010), digestion profiles of heterologous RrgBHis (purified from E. coli) and RrgBHis SP were compared under two different conditions, named procedure 1 and procedure 2 (see Section 2). Beta-galactosidase served as positive control for digestion. As shown in Fig. 4A, when procedure 1 (El Mortaji et al., 2010) was applied, the two RrgB proteins revealed


285

Fig. 4. RrgBHis SP purified from pneumococcal culture supernatants and heterologous RrgB-His purified from E. coli lysates show similar trypsin digestion patterns. The digestion of RrgB-His SP, RrgB-His E. coli and of an unrelated protein (beta-galactosidase), used as digestion positive control (ctrl), were performed under two different conditions as detailed in Section 2 (procedure 1, panel A and procedure 2, panel B). The corresponding amount of 10 ␮g of undigested purified protein was loaded in each lane. The presence or absence of trypsin (TRY) during the incubation is indicated by + or −.

similar resistance to proteolysis, but the beta-galactosidase control resulted only partially digested. In contrast, when using procedure 2 (Fig. 4B) (Moschioni et al., 2010), beta-galactosidase was completely digested, while the two RrgB proteins showed similar digestion patterns, ultimately indicating that the resistance to proteolysis, identified as a specific feature in the recombinant RrgB protein expressed in E. coli, is present also in RrgB expressed in S. pneumoniae. These data provide a proof of concept that purifications of manageable amounts of homologous pneumococcal protein material can be obtained by using this method. In particular, this new system could be useful for proteins which are not efficiently expressed in heterologous systems and for which the native structure can be obtained or controlled only within the autologous host.

4. Conclusion In conclusion, this novel homologous over-expression system for S. pneumoniae will help to overcome reliability and feasibility problems related to heterologous expression; and has the potential to be used for the homologous expression of all pneumococcal proteins (preferably using site-specific deletion mutants of the protein of interest). Protein production in the natural host rather than E. coli allows proper biochemical, functional and structural studies with further implications for therapeutic or vaccine applications. In addition, the promiscuity of the pMU1328 replicon (Achen et al., 1986; Brooker et al., 1995; Lakshmidevi et al., 1990; Powell et al., 1988) indicates its possible use in diverse bacterial species, including other streptococcal human pathogens like Streptococcus pyogenes and Streptococccus agalactiae.

Acknowledgments The pMU1328 shuttle plasmid was kindly provided by Intercell AG (Austria). We thank Massimiliano Biagini (Novartis Vaccines), Anne Marie di Guilmi (Institut de Biologie Structurale Jean-Pierre Ebel, Grenoble), Izabel Bérard and Luca Signor (LSMP, IBS) for mass spectroscopy measurements.

References Achen, M.G., Davidson, B.E., Hillier, A.J., 1986. Construction of plasmid vectors for the detection of streptococcal promoters. Gene 45, 45–49. Alloing, G., Martin, B., Granadel, C., Claverys, J.P., 1998. Development of competence in Streptococcus pneumonaie: pheromone autoinduction and control of quorum sensing by the oligopeptide permease. Mol. Microbiol. 29, 75–83. Angov, E., Legler, P.M., Mease, R.M., 2011. Adjustment of codon usage frequencies by codon harmonization improves protein expression and folding. Methods Mol. Biol. 705, 1–13. Barocchi, M.A., Ries, J., Zogaj, X., Hemsley, C., Albiger, B., Kanth, A., Dahlberg, S., Fernebro, J., Moschioni, M., Masignani, V., Hultenby, K., Taddei, A.R., Beiter, K., Wartha, F., von, E.A., Covacci, A., Holden, D.W., Normark, S., Rappuoli, R., Henriques-Normark, B., 2006. A pneumococcal pilus influences virulence and host inflammatory responses. Proc. Natl. Acad. Sci. U.S.A. 103, 2857–2862. Bartilson, M., Marra, A., Christine, J., Asundi, J.S., Schneider, W.P., Hromockyj, A.E., 2001. Differential fluorescence induction reveals Streptococcus pneumoniae loci regulated by competence stimulatory peptide. Mol. Microbiol. 39, 126–135. Biswas, I., Jha, J.K., Fromm, N., 2008. Shuttle expression plasmids for genetic studies in Streptococcus mutans. Microbiology 154, 2275–2282. Brooker, J.D., Lum, D.K., Thomson, A.M., Ward, H.M., 1995. A gene-targeting suicide vector for Streptococcus bovis. Lett. Appl. Microbiol. 21, 292–297. Conrad, B., Savchenko, R.S., Breves, R., Hofemeister, J., 1996. A T7 promoter-specific, inducible protein expression system for Bacillus subtilis. Mol. Gen. Genet. 250, 230–236. De Angelis, G., Moschioni, M., Muzzi, A., Pezzicoli, A., Censini, S., Delany, I., Lo Sapio, M., Sinisi, A., Donati, C., Masignani, V., Barocchi, M.A., 2011. The Streptococcus pneumoniae pilus-1 displays a biphasic expression pattern. PLoS One 6, e21269. Denoel, P., Philipp, M.T., Doyle, L., Martin, D., Carletti, G., Poolman, J.T., 2011. A protein-based pneumococcal vaccine protects rhesus macaques from pneumonia after experimental infection with Streptococcus pneumoniae. Vaccine 29, 5495–5501. El Mortaji, L., Terrasse, R., Dessen, A., Vernet, T., Di Guilmi, A.M., 2010. Stability and assembly of pilus subunits of Streptococcus pneumoniae. J. Biol. Chem. 285, 12405–12415. El Mortaji, L., Contreras-Martel, C., Moschioni, M., Ferlenghi, I., Manzano, C., Vernet, T., Dessen, A., Di Guilmi, A.M., 2011. The full-length Streptococcus pneumoniae major pilin RrgB crystallizes in a fiber-like structure, which presents the D1 isopeptide bond and provides details on the mechanism of pilus polymerization. Biochem. J., doi:10.1042/BJ20111397. Espinosa, C., Nieto, M., 2003. Construction of the mobilizable plasmid pMV158GFP, a derivative of pMV158 that carries the gene encoding the green fluorescent protein. Plasmid 49, 281–285. Francis, D.M., Page, R., 2010. Strategies to optimize protein expression in E. coli. Curr. Protoc. Protein Sci. Chapter 5, Unit-5.24.1-29. Fujimoto, S., Ike, Y., 2001. pAM401-based shuttle vectors that enable overexpression of promoterless genes and one-step purification of tag fusion proteins directly from Enterococcus faecalis. Appl. Environ. Microbiol. 67, 1262–1267. Fukatsu, H., Herai, S., Hashimoto, Y., Maseda, H., Higashibata, H., Kobayashi, M., 2005. High-level expression of a novel amine-synthesizing enzyme, N-substituted formamide deformylase, in Streptomyces with a strong protein expression system. Protein Expr. Purif. 40, 212–219.

286


Gentile, M.A., Melchiorre, S., Emolo, C., Moschioni, M., Gianfaldoni, C., Pancotto, L., Ferlenghi, I., Scarselli, M., Pansegrau, W., Veggi, D., Merola, M., Cantini, F., Ruggiero, P., Banci, L., Masignani, V., 2011. Structural and functional characterization of the Streptococcus pneumoniae RrgB pilus backbone D1 domain. J. Biol. Chem. 286, 14588–14597. Gianfaldoni, C., Censini, S., Hilleringmann, M., Moschioni, M., Facciotti, C., Pansegrau, W., Masignani, V., Covacci, A., Rappuoli, R., Barocchi, M.A., Ruggiero, P., 2007. Streptococcus pneumoniae pilus subunits protect mice against lethal challenge. Infect. Immun. 75, 1059–1062. Giefing, C., Meinke, A.L., Hanner, M., Henics, T., Bui, M.D., Gelbmann, D., Lundberg, U., Senn, B.M., Schunn, M., Habel, A., Henriques-Normark, B., Ortqvist, A., Kalin, M., von Gabain, A., Nagy, E., 2008. Discovery of a novel class of highly conserved vaccine antigens using genomic scale antigenic fingerprinting of pneumococcus with human antibodies. J. Exp. Med. 205, 117–131. Henriques-Normark, B., Normark, S., 2010. Commensal pathogens, with a focus on Streptococcus pneumoniae, and interactions with the human host. Exp. Cell Res. 316, 1408–1414. Holmlund, E., Quiambao, B., Ollgren, J., Jaakkola, T., Neyt, C., Poolman, J., Nohynek, H., Kayhty, H., 2009. Antibodies to pneumococcal proteins PhtD, CbpA, and LytC in Filipino pregnant women and their infants in relation to pneumococcal carriage. Clin. Vaccine Immunol. 16, 916–923. Hoskins, J., Alborn Jr., W.E., Arnold, J., Blaszczak, L.C., Burgett, S., DeHoff, B.S., Estrem, S.T., Fritz, L., Fu, D.J., Fuller, W., Geringer, C., Gilmour, R., Glass, J.S., Khoja, H., Kraft, A.R., Lagace, R.E., LeBlanc, D.J., Lee, L.N., Lefkowitz, E.J., Lu, J., Matsushima, P., McAhren, S.M., McHenney, M., McLeaster, K., Mundy, C.W., Nicas, T.I., Norris, F.H., O’Gara, M., Peery, R.B., Robertson, G.T., Rockey, P., Sun, P.M., Winkler, M.E., Yang, Y., Young-Bellido, M., Zhao, G., Zook, C.A., Baltz, R.H., Jaskunas, S.R., Rosteck Jr., P.R., Skatrud, P.L., Glass, J.I., 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J. Bacteriol. 183, 5709–5717. Johnson, H.L., Deloria-Knoll, M., Levine, O.S., Stoszek, S.K., Freimanis, H.L., Reithinger, R., Muenz, L.R., O’Brien, K.L., 2010. Systematic evaluation of serotypes causing invasive pneumococcal disease among children under five: the pneumococcal global serotype project. PLoS Med., 7. Lakshmidevi, G., Davidson, B.E., Hillier, A.J., 1990. Molecular characterization of promoters of the Lactococcus lactis subsp. cremoris temperate bacteriophage BK5-T and identification of a phage gene implicated in the regulation of promoter activity. Appl. Environ. Microbiol. 56, 934–942. Linares, D.M., Geertsma, E.R., Poolman, B., 2010. Evolved Lactococcus lactis strains for enhanced expression of recombinant membrane proteins. J. Mol. Biol. 401, 45–55. Loisel, E., Chimalapati, S., Bougault, C., Imberty, A., Gallet, B., Di Guilmi, A.M., Brown, J., Vernet, T., Durmort, C., 2011. Biochemical characterization of the histidine triad protein PhtD as a cell surface zinc-binding protein of pneumococcus. Biochemistry 50, 3551–3558. Manzano, C., Contreras-Martel, C., El, M.L., Izore, T., Fenel, D., Vernet, T., Schoehn, G., Di Guilmi, A.M., Dessen, A., 2008. Sortase-mediated pilus fiber biogenesis in Streptococcus pneumoniae. Structure 16, 1838–1848.

Moschioni, M., Emolo, C., Biagini, M., Maccari, S., Pansegrau, W., Donati, C., Hilleringmann, M., Ferlenghi, I., Ruggiero, P., Sinisi, A., Pizza, M., Norais, N., Barocchi, M.A., Masignani, V., 2010. The two variants of Streptococcus pneumoniae pilus-1 RrgA adhesin retain the same function and elicit cross-protection in vivo. Infect. Immun. 78, 5033–5042. Ng, W.L., Tsui, H.C., Winkler, M.E., 2005. Regulation of the pspA virulence factor and essential pcsB murein biosynthetic genes by the phosphorylated VicR (YycF) response regulator in Streptococcus pneumoniae. J. Bacteriol. 187, 7444–7459. Noreen, N., Hooi, W.Y., Baradaran, A., Rosfarizan, M., Sieo, C.C., Rosli, M.I., Yusoff, K., Raha, A.R., 2011. Lactococcus lactis M4, a potential host for the expression of heterologous proteins. Microb. Cell Fact. 10, 28. O’Brien, K.L., Wolfson, L.J., Watt, J.P., Henkle, E., Deloria-Knoll, M., McCall, N., Lee, E., Mulholland, K., Levine, O.S., Cherian, T., 2009. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet 374, 893–902. Paterson, N.G., Baker, E.N., 2011. Structure of the full-length major pilin from Streptococcus pneumoniae: implications for isopeptide bond formation in Grampositive bacterial pili. PLoS One 6, e22095. Pericone, C.D., Park, S., Imlay, J.A., Weiser, J.N., 2003. Factors contributing to hydrogen peroxide resistance in Streptococcus pneumoniae include pyruvate oxidase (SpxB) and avoidance of the toxic effects of the fenton reaction. J. Bacteriol. 185, 6815–6825. Powell, I.B., Achen, M.G., Hillier, A.J., Davidson, B.E., 1988. A simple and rapid method for genetic transformation of lactic streptococci by electroporation. Appl. Environ. Microbiol. 54, 655–660. Saida, F., 2007. Overview on the expression of toxic gene products in Escherichia coli. Curr. Protoc. Protein Sci. Chapter 5, Unit -5.19. Samuelson, J.C., 2011. Recent developments in difficult protein expression: a guide to E. coli strains, promoters, and relevant host mutations. Methods Mol. Biol. 705, 195–209. Selman, S., Hayes, D., Perin, L.A., Hayes, W.S., 2000. Pneumococcal conjugate vaccine for young children. Manag. Care 9, 49–57. Spraggon, G., Koesema, E., Scarselli, M., Malito, E., Biagini, M., Norais, N., Emolo, C., Barocchi, M.A., Giusti, F., Hilleringmann, M., Rappuoli, R., Lesley, S., Covacci, A., Masignani, V., Ferlenghi, I., 2010. Supramolecular organization of the repetitive backbone unit of the Streptococcus pneumoniae pilus. PLoS One 5, e10919. Sung, C.K., Li, H., Claverys, J.P., Morrison, D.A., 2001. An rpsL cassette, janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl. Environ. Microbiol. 67, 5190–5196. Warren, T.K., Lund, S.A., Jones, K.F., Hruby, D.E., 2005. Development of PLEX, a plasmid-based expression system for production of heterologous gene products by the gram-positive bacteria Streptococcus gordonii. Protein Expr. Purif. 40, 319–326. Yother, J., Handsome, G.L., Briles, D.E., 1992. Truncated forms of PspA that are secreted from Streptococcus pneumoniae and their use in functional studies and cloning of the pspA gene. J. Bacteriol. 174, 610–618.