Int J Hematol (2010) 92:271–275 DOI 10.1007/s12185-010-0644-3
ORIGINAL ARTICLE
A novel WASP gene mutation in a Chinese boy with Wiskott–Aldrich syndrome Hongtao Yu • Ting Liu • Wentong Meng Li Hou
•
Received: 16 May 2009 / Revised: 2 July 2010 / Accepted: 12 July 2010 / Published online: 4 August 2010 Ó The Japanese Society of Hematology 2010
Abstract Wiskott–Aldrich syndrome (WAS) is an X-linked recessive disorder characterized by thrombocytopenia, small platelets, eczema, increased susceptibility to infection, and immunodeficiency. Mutations of the Wiskott– Aldrich syndrome protein (WASP) gene are responsible for this severe congenital disease. In this study, we report on a 2-year-old Chinese boy who presented with classic clinical WAS manifestations. By direct sequencing of cDNA and genomic DNA of the patient, we identified a novel mutation: the first nucleotide in exon 8 (G) had been deleted (769delG). This mutation results in two kinds of aberrant mRNA with abnormal splicing and causes frameshift and a stop codon at amino acid 260. Western blotting demonstrated a 28-kDa truncated WAS protein. A maternal study revealed that his mother had a heterozygous genotype, but showed normal WASP expression. Keywords Wiskott–Aldrich syndrome WAS gene Mutation Chinese
is located in chromosome X-p11.22–p11.23, which consists of 12 exons containing 1,823 base pairs, and encodes a 502-amino acid protein [2, 3]. The WAS protein (WASP) gene is expressed selectively in hematopoietic stem cellderived lineages and is involved in cell signaling and cytoskeleton reorganization [4]. Approximately 300 unique mutations have been reported in the WASP gene, spanning all 12 exons. In general, missense mutations are located mostly in exons 1–4; deletions and insertions are distributed throughout the WASP gene, and splice site mutations are found predominantly in introns 6, 8, 9, and 10 [5, 6]. In this study, we genetically diagnosed a Chinese boy with classical phenotypes by the direct sequence analysis of cDNA and genomic DNA, and identified a novel WASP gene mutation: 769delG (updated by searching http://homepage.mac. com/kohsukeimai/wasp/WASPbase.html). This base deletion results in both an early stop codon and intricate splicing abnormalities and, through Western blotting, we confirmed the truncated protein from these mutated gene transcripts.
1 Introduction Wiskott–Aldrich syndrome (WAS) is a rare X-linked recessive immunodeficiency disorder characterized by thrombocytopenia and small platelets, eczema, recurrent infections, and an increased risk of autoimmunity and malignancy [1]. The gene responsible for WAS and also its milder manifestation, X-linked thrombocytopenia (XLT),
H. Yu T. Liu (&) W. Meng L. Hou Department of Hematology, Hematology Research Laboratory, West China Hospital, Sichuan University, Chengdu 610041, Sichuan, People’s Republic of China e-mail:
[email protected]
2 Materials and methods 2.1 Case report A 2-year-old Chinese boy was admitted because of recurrent infection, bloody diarrhea, hemolytic anemia, and persistent thrombocytopenia since 1 month after birth. Physical examination revealed whole-body petechiae, eczema, and gum bleeding. On laboratory examination, the Hb level was 48 g/L, and the white blood cell count was 3.9 9 109/L, with neutrophils at 20% and lymphocytes at 59%. The platelet count was decreased at 22 9 109/L, and
123
272
H. Yu et al.
the mean platelet volume was 7.8 fL. A peripheral blood smear revealed normocytic normochromic anemia and thrombocytopenia with small platelets. The severity of WAS-associated symptoms was scored as 5 based on the criteria of Ochs [7]. The patient was treated with red blood cell and platelet transfusions and the intravenous administration of immunoglobulin, but he was refractory to treatment. The patient died at the age of 2 years and 7 months, 1 month after admission, from severe encephalic hemorrhage.
30 s, annealing at 60°C (reaction 3) or 61.5°C (reaction 4) for 45 s, extension at 72°C for 1 min, and a final extension cycle at 72°C for 7 min. The PCR products were purified with 2% agarose gel electrophoresis and sent to Invitrogen Biotechnology Co. Ltd. for direct sequencing. The sequence variation was described according to the recommendations of the Human Genome Variation Society (http:// www.hgvs.org/mutnomen/recs.html, updated in October 2007). 2.4 Genomic DNA analysis
2.2 RNA, DNA, and protein extraction After we obtained informed consent from his parents, a blood sample was collected from the patient and his mother. The total RNA, genomic DNA, and protein were isolated from their peripheral blood leukocytes using the Trizol kit according to the manufacturer’s instructions (GIBCO BRL, Gaithersburg, MD, USA).
Based on the cDNA sequence results, we designed a pair of primers (Table 1, reaction 5) to amplify the suspected mutation sites in genomic DNA for the patient and his mother. The PCR conditions were the same as in reaction 1. The amplified DNA fragments were separated by agarose gel electrophoresis, and direct sequencing was also performed by Invitrogen Biotechnology Co. Ltd.
2.3 cDNA analysis
2.5 Western blotting analysis
RNA isolation and RT-PCR were performed referring to the methods described by Zhu and Raskind [7, 8]. Briefly, total RNA was isolated from peripheral blood leukocytes using a single-step method and Trizol. First-strand cDNA was synthesized by incubating 2.5 pg of total RNA using random primers and a reverse transcription kit (TaKaRa, Dalian, China), as recommended by the manufacturer. The WASP cDNA was amplified by PCR in four overlapping fragments (Table 1). For reactions 1 and 2, the amplification mix contained 1.5 mmol/L Mg2?, and PCR involved initial denaturation at 95°C for 5 min followed by 35 cycles in 4 steps: denaturation at 95°C for 30 s, annealing at 57°C for 45 s, extension at 72°C for 90 s, and a final extension cycle at 72°C for 7 min. For reactions 3 and 4, the amplification mix contained 1.0 mmol/L Mg2?, and PCR involved initial denaturation at 95°C for 5 min followed by 32 cycles in 4 steps: denaturation at 95°C for
The protein from the cells of the patient, his mother, a Raji cell line, and normal control cells were suspended in 1% sodium dodecyl sulfate. After being heated for 5 min at 100°C, for each sample, 20 ll of cell lysate was electrophoresed through a sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) gel and transferred to a PVDF membrane in transfer buffer at a constant 200 mA for 2 h. After being blocked for 2 h with 5% nonfat dry milk in 0.1% Tris-buffered saline–Tween 20, the membrane was incubated with anti-WASP antibody sc-5300 (1:200) overnight at 4°C. After washing three times with 0.05% TBS Tween/PBS, the membrane was incubated with horseradish peroxidase-conjugated goat antimouse immunoglobulin (Santa Cruz, CA, USA) at a concentration of 1:2,000. The membrane was then washed three times, and the results were visualized employing an enhanced chemiluminescence method.
Table 1 Primer pairs for sequencing WASP gene
Reactiona
Primer sequence (50 –30 )
1
W-2 GCCTCGCCAGAGAAGACAAG
2
W-452 CTCGTGCAGGAGAAGATACA
Exons covered
Fragment size (bp)
1–4
495
4–9
475
9–11
594
11–12
303
W496c TCCACTTTGCCTCTGATTCC W-926 CCTGGTCCTCAATGAAGTCG a
Primers listed for reactions 1, 2, 3, and 4 were used to amplify WAS protein cDNA in four overlapping fragments, and the primers for reactions 5 were employed to amplify genomic DNA of the fragment sizes listed
123
3
W-809 GACGTGAACAACCTCGACCC W-1402 CTGCAGCGCTGAGCTCTCTG
4
W-1406 CCACCACCTCAGAGCTCAGA W-1708 TGAGTGTGAGGACCAGGCAG
5a
W-5.28 CAAGAGGTTTCACTATGAAG W-5.14 CCTGGTCCTCAATGAAGTCGTAG
430
WASP gene mutation in a boy with Wiskott–Aldrich syndrome
3 Results 3.1 cDNA analysis WASP cDNA containing all 12 exons was amplified by PCR in four overlapping fragments, and agarose gel electrophoresis showed the PCR-amplified cDNA in reaction 2 as two bands (Fig. 1): one was of normal size (475 bp), and the other was about 200 base pairs longer than normal. We excised these two bands, extracted them, and amplified them employing the same PCR reaction conditions again. By direct sequencing, we confirmed that the first nucleotide in exon 8 (G) was deleted (769delG) in the normal-size band, and besides 769delG, a full intron 8 was retained in the longer-size band caused by splicing error. Both of the mutations result in a frameshift and, furthermore, an early stop codon at amino acid 260 (Fig. 2). No other mutation was detected in the other 3 cDNA fragments. 3.2 Genomic DNA analysis
273
fragment covering the full exon 8 and intron 8 (including partial intron 7 and exon 9) for the patient and his mother. We obtained a 430-bp product and, by sequencing analysis, confirmed that the first nucleotide (G) in exon 8 had been deleted in the patient. His mother’s sequence indicated a heterozygous frameshift deletion (Fig. 3). 3.3 Western blotting analysis Western blot analysis of lysates from peripheral white cells of the normal control, patient’s mother, and Raji cells showed that WAS protein was normally expressed (66 kDa), but a truncated WASP (about 28 kDa) was expressed in peripheral white cells of the patient (Fig. 4).
4 Discussion Wiskott–Aldrich syndrome is caused by mutation of the WASP gene. Since the causative gene was first isolated and
Based on cDNA sequencing results, we designed a pair of primers (W5.28/W5.14) to amplify the genomic DNA
Fig. 1 WASP cDNA was amplified by PCR in four overlapping fragments, and agarose gel electrophoresis shows the PCR-amplified cDNA in reaction 2 as two bands; one was of normal size (475 bp) and the other was about 200 base pairs longer than normal
Fig. 2 W-452/W-926 cDNA sequencing results show 769delG in exon 8 in the normal-size band and, besides 769delG, a full intron 8 was retained in the longer-size band caused by splicing error. Both of the mutations result in frameshift and an early stop codon at amino acid position 260. The exon and intron sequences are denoted by upper and lower case letters, respectively, and italics show stop codons
Fig. 3 A chromatogram shows forward sequences of the region including the exon 8 borders from the patient and his mother. The patient’s sequence shows the deletion of the first nucleotide (G) in exon 8, and the mother’s sequence reveals a heterozygous frameshift deletion indicated by the arrow
Fig. 4 Western blot analysis of WASP using sc-5300 antibody and GAPDH as housekeeping proteins (36 kDa). The lysates from the normal control and maternal peripheral white cells, and the Raji cell line expressed WASP at a normal size (66 kDa), and a truncated WASP (about 28 kDa) was expressed in the patient’s peripheral white cells
123
274
cloned in 1994 [4], various unique mutations including missense, nonsense, and splice site mutations and insertions, deletions, and rearrangements have been detected. Up to now, about 300 unique mutations have been reported in the WASP gene, spanning all 12 exons. The diagnosis of WAS is based on detecting the mutation by the direct sequence analysis of WASP cDNA and genomic DNA. Following searching the literature and the human gene mutation database, we report a novel WASP gene mutation identified in a Chinese boy, i.e., deletion of the first nucleotide (G) in exon 8 (769delG), which led to a splicing mutation and frameshift, resulting in a stop codon at amino acid 260. In the genomic DNA sequence, the last nucleotide in intron 7 and the first nucleotide in exon 8 are two identical G. If there is one G deletion, it is difficult to decide which nucleotide is lost only employing genomic DNA sequencing. By comparison with cDNA sequencing results, we confirmed that the G deletion was just at the ?1 position in exon 8. Furthermore, different G deletions will cause different transcripts. Itoh et al. [9] reported that a nucleotide G deletion at the -1 position of intron 7 results in exon 8 (769–811) skipping, frameshift, and translation stop at the amino acid 246. Western blotting revealed no WASP expression. The reason of exon 8 skipping is probably related to disruption of the interaction with spliceosome [10]. In the present patient, there were two kinds of cDNA transcript, 769delG and 769delG with intron 8 retention, which were totally different from the mutations described by Itoh, and also different from the splice donorsite mutation (811?5G[C) in intron 8 reported by AbuAmero [11], since the genomic DNA sequencing result did not show any mutation in intron 8 in our patient. The WAS gene encodes a 502-amino acid protein (WASP), from 50 to 30 , which has an N-terminal WASPhomology domain 1 (WH1), a Cdc42/Rac GTPase-binding domain (GBD), a proline-rich region (PRR), a verprolin homology domain (V), and a cofilin-homology sequence (C). WASP is an important regulator of the actin cytoskeleton, and the C-terminal portion of WASP contains a WH2 domain and an acidic region that mediate interactions with Gactin and the Arp2/3 complex [12]. The expression of WASP is dependent on WASP-interacting protein (WIP), and the interaction between WASP and WIP is required for mediating TCR signals [13] and plays a pathogenetic role in WAS [14]. Most missense mutations are localized to the WH1 domain, and a mutated WASP often cannot bind to WIP, leading to defective WASP expression [15]. However, since 769delG mutation causes the partial deletion of WASP after the GBD domain, but still maintains an intact WH1 domain for WIP binding, we can assume that the mutant WASP can bind to WIP and is relatively stable, which protects the truncated WASP from being degraded. But, due to the lack of the VCA area, the truncated WASP
123
H. Yu et al.
cannot combine with the Arp2/3 complex, which plays a key role in cytoskeletal remodeling. Previous reports have suggested that mutations resulting in the absence of protein or truncated protein are usually associated with a severe clinical phenotype [16]. The mutation identified in our patient was in exon 8, which is a part of the GBD, in which mutation is rare. The mutation results in frameshift and translation stop at amino acid 260, and Western blotting demonstrated a truncated protein with a molecular weight of about 28 kDa. However, his mother showed a normal WASP expression owing to her heterozygous genotype. This phenomenon clearly demonstrates an advantage of stem cells expressing a normal WASP gene over WASPdeficient cells in their capacity to migrate and home to the bone marrow, which could explain the nonrandom inactivation of the X-chromosome in the hematopoietic progenitors and also in a lineage-dependent manner in obligate female carriers [17]. Alternative splicing, a common phenomenon in human gene transcription, enables a single gene to increase its encoding capacity, facilitating the synthesis of several structurally and functionally distinct protein isoforms [18]. Some gene mutations resulting in abnormal splicing are often associated with human hereditary diseases and tumors. Four main types of alternative splicing have been identified: exon skipping, alternative 30 splice site, alternative 50 splice site, and intron retention. Intron retention is the least common abnormality reported previously among all types of alternative splicing, and the mechanism is not completely understood. The retained intron usually has a high percentage of GC and a length shorter than 500 nt [19], the same as that found in our patient. In summary, we report a Chinese boy with classic WAS due to a novel mutation (769delG) of the WAS gene. The phenotypic manifestations and clinical course were in line with the mutation resulting in a truncated WASP. Direct sequence analysis of cDNA and genomic DNA coding regions of the WAS gene is necessary to establish a definitive diagnosis of WAS to facilitate a timely treatment to improve patient prognosis. Acknowledgments The authors would like to thank Dr. Qiang Li and Dr. Xiaoxi Lu from the Department of Pediatrics of the West China Second Hospital, Sichuan University, who provided clinical data on the patient.
References 1. Sullivan KE, Mullen CA, Blaese RM, Winkelstein JA. A multiinstitutional survey of the Wiskott–Aldrich syndrome. J Pediatr. 1994;125:876–85. 2. Donner M, Schwartz M, Carlsson KU, Holmberg L. Hereditary X-linked thrombocytopenia maps to the same chromosomal region as the Wiskott–Aldrich syndrome. Blood. 1988;72:1849–53.
WASP gene mutation in a boy with Wiskott–Aldrich syndrome 3. Villa A, Notarangelo L, Macchi P, Mantuano E, Cavagni G, Brugnoni D, et al. X-linked thrombocytopenia and Wiskott– Aldrich syndrome are allelic diseases with mutations in the WASP gene. Nat Genet. 1995;9:414–7. 4. Derry JM, Ochs HD, Francke U. Isolation of a novel gene mutated in Wiskott–Aldrich syndrome. Cell. 1994;78:635–44. 5. Imai K, Morio T, Zhu Y, Jin Y, Itoh S, Kajiwara M, et al. Clinical course of patients with WASP gene mutations. Blood. 2004; 103:456–64. 6. Jin Y, Mazza C, Christie JR, Giliani S, Fiorini M, Mella P, et al. Mutations of the Wiskott–Aldrich syndrome protein (WASP): hotspots, effect on transcription, and translation and phenotype/ genotype correlation. Blood. 2004;104:4010–9. 7. Zhu QL, Zhang M, Blaese RM, Derry JMJ, Junker A, Francke U, et al. The Wiskott–Aldrich syndrome and X-Linked congenital thrombocytopenia are caused by mutations of the same gene. Blood. 1995;86:3797–804. 8. Raskind WH, Niakan KK, Wolff J, Matsushita M, Vaughan T, Stamatoyannopoulos G, et al. Mapping of a syndrome of X-linked thrombocytopenia with thalassemia to band Xp11–12; further evidence of genetic heterogeneity of X-linked thrombocytopenia. Blood. 2000;95:2262–8. 9. Itoh S, Nonoyama S, Morio T, Imai K, Okawa H, Ochs HD, et al. Mutations of the WASP Gene in 10 Japanese patients with Wiskott–Aldrich syndrome and X-linked thrombocytopenia. Int J Hematol. 2000;71:79–83. 10. Black DL. Mechanism of alternative pre-messenger RNA splicing. Annu Rev Biochem. 2003;72:291–336. 11. Abu-Ameroa KK, Owaidahb TM, Jefric AA, Al-Ghonaiumd A, Fawazc IM, Al-Hameda MH. A novel splice site mutation in the
275
12.
13.
14.
15.
16.
17.
18. 19.
WAS gene causes Wiskott–Aldrich syndrome in two siblings of a Saudi family. Blood Coagul Fibrinolysis. 2004;15:599–603. Burns S, Cory GO, Vainchenker W, Thrasher AJ. Mechanisms of WASP-mediated hematologic and immunologic disease. Blood. 2004;104:3454–62. Sasahara Y, Rachid R, Byrne MJ, de la Fuente MA, Abraham RT, Ramesh N, et al. Mechanism of recruitment of WASP to the immunological synapse and of its activation following TCR ligation. Mol Cell. 2002;10:1269–81. Luthi JN, Gandhi MJ, Drachman JG. X-linked thrombocytopenia caused by a mutation in the Wiskott–Aldrich syndrome (WAS) gene that disrupts interaction with the WAS protein (WASP)interacting protein (WIP). Exp Hematol. 2003;31:150–8. Konno A, Kirby M, Anderson SA, Schwartzberg PL, Candotti F. The expression of Wiskott–Aldrich syndrome protein (WASP) is dependent on WASP-interacting protein (WIP). Int Immunol. 2007; 19:185–92. Peacocke M, Siminovitch KA. Linkage of the Wiskott–Aldrich syndrome with polymorphic DNA sequences from the Human X chromosome. PNAS. 1987;84:3430–3. Lacout C, Haddad E, Sabri S, Svinarchouk F, Garcon L, Capron C, et al. A defect in hematopoietic stem cell migration explains the nonrandom X-chromosome inactivation in carriers of Wiskott–Aldrich syndrome. Blood. 2003;102:1282–9. Graveley BR. Alternative splicing: increasing diversity in the proteomic world. Trends Genet. 2001;17(2):100–7. Galante PAF, Sakabe NJ, Kirschbaum-Slager N, Souza SJD. Detection and evaluation of intron in the human transcriptome. RNA. 2004;10:757–65.
123
