Russian Journal of Bioorganic Chemistry, Vol. 31, No. 1, 2005, pp. 66–69. Translated from Bioorganicheskaya Khimiya, Vol. 31, No. 1, 2005, pp. 73–76. Original Russian Text Copyright © 2005 by Aleksandrov, Yu. Skoblov, M. Skoblov, Shibanova, Bairamashvili, Miroshnikov.
A PCR-Based Semiquantitative Assay of DNA Impurities in Recombinant Protein Preparations A. N. Aleksandrov*,1 Yu. S. Skoblov*, M. Yu. Skoblov**, E. D. Shibanova*, D. I. Bairamashvili*, and A. I. Miroshnikov* *Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, ul. Miklukho-Maklaya 16/10, Moscow, 117997 Russia **Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, ul. Vavilova 32, Moscow, 119991 Russia Received December 22, 2003; in final form, February 3, 2004
Abstract—A semiquantitative assay of DNA impurities in preparations of human recombinant insulin is described. The assay is based on the detection of a fragment of the ampicillin-resistant gene within the producer strain DNA by PCR. The analysis of PCR products of the studied preparations and PCR products containing known amounts of E. coli total DNA enabled a quantitative determination of the producer strain DNA content in the preparations under study. The sensitivity of the method is 7 pg of E. coli DNA per 10 µg of human recombinant insulin. The high sensitivity of the method allows us to recommend it for the quantitative determination of DNA content in recombinant preparations that do not inhibit PCR. Key words: DNA determination, human recombinant insulin, PCR 1
INTRODUCTION
The biotechnological production of recombinant protein preparations for pharmacological purposes based on the industrial use of bacterial overproducing strains is being intensively developed in recent years. The use of these preparations in medicine imposes heavy demands on the quality of target proteins, a low content of the producer strain DNA being among them. The DNA content of the producing strain for human recombinant insulin preparations used daily by patients must not exceed 7 ng per mg of the protein [1]. Hybridization methods [1] and the direct fluorescence-based determination of nucleic acids in the samples are used for the qualitative and quantitative determination of DNA content in biotechnological products [2]. A high sensitivity of these analytical methods must be mentioned while specifying their advantages. For example, the use of the DNA-specific dye PicoGreen (Molecular Probes, United States) enables the detection of 25 pg DNA per ml in the presence of a considerable amount of proteins [2]. A high cost of the equipment and chemicals for the analysis and the use of unstable radioactively labeled compounds (hybridization DNA probes) must be noticed as the essential drawbacks of these methods. We describe in this work a semiquantitative assay of DNA in human recombinant insulin preparations obtained using the E. coli JM109 producing strain [1]. The essence of the method is the determination of the 1 Corresponding
[email protected]
author; phone: +7 (095) 335-7193; e-mail:
DNA of producing strain by the presence of a fragment of the bla gene of resistance to ampicillin by the PCR technique. An electrophoretic analysis of the amplification products of the studied samples and the samples containing a known amount of the E. coli total DNA allows a quantitative determination of the producing strain DNA in the insulin preparations under study. The sensitivity of the method was 7 pg of E. coli DNA in 10 µg of human recombinant insulin. RESULTS AND DISCUSSION The residual DNA of producing strain was determined in samples of human recombinant insulin. The gene of resistance to ampicillin (the β-lactamase gene, or the bla gene) was chosen as a marker gene for PCR, 1
bla Blaf-224
861 61
Blaf-534
Blarev-831 Blarev-756
1 2
252 bp
627 bp
Fig. 1. The map of primers of the bla gene (open arrows) and the length of possible amplificates (double-headed arrows).
1068-1620/05/3101-0066 © 2005 Pleiades Publishing, Inc.
A PCR-BASED SEMIQUANTITATIVE ASSAY OF DNA IMPURITIES
since it serves as a selective marker in most of the overproducing genetic constructs. A high sensitivity of the PCR procedure implies the use of such a marker sequence whose specific amplification leads to a reaction product at the concentration of 5–10 ng/µl using a minimal amount of DNA template. This concentration is determined by the minimal amount of the amplificate that can be visually detected in the agarose gel. A map of the chosen primers for the amplification of the bla gene fragments and the diagram demonstrating relative lengths of possible amplificates are shown in Fig. 1. The primer sequences were chosen on the basis of known primary structure of E. coli chromosome, so that their annealing with E coli DNA was minimal. As a PCR template, a vector containing the ampicillin-resistance gene at various concentrations was used. The PCR products were analyzed by electrophoresis. The results of this analysis for the 252- and 627-bp amplificates are given in Figs. 2a and 2b, respectively. One can see from the data that the PCR procedure enables to reveal 0.3–1 pg of the bla gene-bearing plasmid construct (or its fragment) in a sample of 20-µl volume. These results agree well with the quantitative regularities of PCR procedures, for example, with the Matz– Luk’yanov equation [3].
67
(‡) bp 1000 750 500 250
103 70 30 10
3
1
0.3 0.1
0
M
(b)
bp 1000 750 500 250
103 70 30 10
3
1
0.3 0.1 0 M
Fig. 2. The electrophoregram of the bla gene fragment amplificates (a) 252-bp and (b) 627-bp long obtained by PCR using various amounts of plasmid DNA (pUC18). The amounts of the template used in the reaction (pg) are shown under arrows. M, molecular mass markers.
Determination of the Assay Sensitivity; the PCR Inhibition with High Insulin Concentrations Various amounts of total DNA of E. coli recombinants containing the bla gene were used in the PCR procedure for the determination of sensitivity of the assay. It is known that foreign DNA is somewhat degraded in the analyzed preparations during the process of isolation and purification of the target protein. A pair of primers corresponding to the 252-bp PCR product was chosen in order to avoid the reduction in sensitivity of PCR due to the degradation of foreign DNA. The electrophoresis demonstrated (Fig. 3) that the bla gene fragment of 252-bp long from a heterogeneous DNA sample (a sample of the total producer DNA) was amplified less effectively, and the specific fragment is only synthesized when no less than 10–30 pg of the total producer DNA are used as a PCR template in the volume of 20 µl. The monitoring of foreign DNA in the process of purification of the recombinant protein and in the end product implies the DNA detection on the high protein background. Therefore, the amplification was carried out in the presence of recombinant human insulin in order to reveal its possible inhibitory effect. Various amounts of total DNA of the insulin producing strain were taken as templates. The electrophoretic analysis of the amplification products in the presence of insulin showed that this protein did not exert any noticeable inhibition of PCR up to the concentration of 0.5 mg/ml in the reaction mixture and did not reduce the assay sensitivity (Fig. 4). RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
bp 1000 750 500 250
M
103
70
30
10
0.3
0.1
0
Fig. 3. The electrophoregram of amplificates of the bla gene 252-bp fragment obtained by PCR using various amounts of total DNA of the insulin producer taken as a template. The amounts of the template used in the reaction (pg) are shown under arrows. M, molecular mass markers.
Determination of DNA of Producer Strain in Samples of Human Recombinant Insulin Total producer DNA (70 pg) used as reference compounds for the determination of the amount of residual DNA in insulin preparations was introduced into PCR. The buffer for insulin dissolution was used as a negative control. The insulin samples were dissolved up to a final concentration of 10 mg/ml and used in PCR in the amount of 10 µg/reaction. A comparison of intensities of bands resulting from the specific amplification of reference samples and the studied samples allowed the
Vol. 31
No. 1
2005
68
ALEKSANDROV et al.
bp 1000 750 500 250
DNA (pg): 70 Insulin, 0.5 mg/ml: +
30 +
10 +
3 +
1 +
0 –
M
Fig. 4. PCR inhibition by insulin. The electrophoregram of amplificates of the bla gene 252-bp fragment obtained by PCR in the presence of human recombinant insulin (0.5 mg/ml). The amounts of the template used in the reaction (pg) are shown under arrows. M, molecular mass markers.
bp 750 500 250
M
1
2
3
4
5
6
7
K
O
Fig. 5. Monitoring of insulin samples obtained at different purification stages. The electrophoregram of the bla gene 252-bp fragment obtained by PCR in the presence of human recombinant insulin (10 µg) from (1 and 2) separate fractions of the elution profile on a hydrophobic sorbent; 3 and 6, on an anion-exchange sorbent; and 7, separate fractions of gel-filtration elution profile. M, molecular mass markers (bp). K, amplification products in the presence of total DNA of the insulin producer (70 pg, a reference sample). O, a negative amplification control (PCR in the absence of DNA template).
bp 500 250
K 1 K 2 K 3 K 4 K 5 K 6 M K O Fig. 6. DNA determination in the samples of purified insulin preparation (lanes 1–6). M, molecular mass markers (bp). K, amplification products in the presence of total DNA of the insulin producer (70 pg, a reference sample). O, a negative amplification control (PCR in the absence of DNA template).
quantitative determination of total producer DNA in the preparations. The presence of the 252-bp polynucleotide in an amplificate of the preparation under study pointed out to the presence of DNA of the producing strain in the preparation. If the amount of this polynucleotide was comparable with that in the reference sample according to the electrophoretic analysis, one can infer that the DNA amount in the protein preparation was 7 × 10–6 relative to the protein (or 7 pg of total DNA of the producing strain per µg of the protein). Figure 5 shows the results of DNA assay in the insulin preparations at separate purification stages. It is obvious that hydrophobic chromatography does not separate insulin from DNA admixtures (lanes 1 and 2). Some of the protein fractions from its elution profile on an anion-exchange sorbent still contain more than 7 pg of DNA per µg of protein (lanes 3–6). At the final purification stages (Fig. 5, lane 7) and in the purified insulin preparations (Fig. 6), E. coli foreign DNA is determined at levels that were considerably lower than 7 pg/µg of protein. It is easy to obtain the results corresponding to other levels of DNA content relative to the protein in the preparations by varying the number of PCR cycles and the amount of total producer DNA in the positive control. To summarize, we developed a simple and effective PCR-based procedure for a semiquantitative assay of DNA in the recombinant protein preparations that enables the identification of 7 pg of E. coli DNA in 1 µg of insulin. The described method is applicable for the DNA determination in other protein preparations that do not inhibit PCR. EXPERIMENTAL Isolation of E. coli total DNA and the sample preparation was described in [4]. A solution of total DNA of the producing strain at a concentration of 100 ng/ml was used for calibration. The insulin preparations were dissolved at a concentration of 10 mg of protein per ml of 1 mM Tris–HCl buffer, pH 8.0.
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
Vol. 31
No. 1
2005
A PCR-BASED SEMIQUANTITATIVE ASSAY OF DNA IMPURITIES
The PCR [4] was carried out on a DNA Thermal Cycler 480 (Perkin–Elmer–Cetus). The reaction mixture (20 µl) contained 20 mM Tris–HCl, pH 8.4, 50 mM KCl, 0.2 mM each of deoxynucleoside triphosphates, 1.5 mM MgCl2, primers (10–15 pmol of each), activated Taq DNA polymerase (2 U), and a solution (1 µl) of the studied sample, E. coli total DNA of known concentration, or plasmid DNA. The reaction mixture was heated at 94°ë for 3 min and 25–29 amplification cycles were carried out (94°C for 30 s; 58°C for 30 s, and 72°C for 1 min). The reaction was stopped by heating the mixture at 72°C for 3 min. The PCR products were analyzed visually in 1.2% agarose gel stained with a solution of ethidium bromide (1 µg/ml). The SigmaGel program (Jandel Scientific) was used for the determination of relative intensities of electrophoretic bands and statistical treatment of results (for three independent reactions). The following (5' 3') primers were used in the work: Blaf-224 (CTTTATCCGCCTCCATCCAGTC),
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
69
Blaf-534 (GATGCTTTTCTGTGACTGGTG), Blarev765 (ACGCTGGTGAAAGTAAAAGAT), and Blarev831 (CAACATTTCCGTGTCGCCCTTA). REFERENCES 1. Farmakopeinaya stat’ya predpriyatiya Institut bioorganicheskoi khimii im. M. M. Shemyakina i Yu. A. Ovchinnikova RAN (Pharmacopoeia Monograph of the Enterprise Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry RAS) FSP42-0452361302. Human insulin, 2002, Moscow. 2. Haugland, R.P and Kang, H.C, Chemically Reactive Dipyrrometheneboron Difluoride Dyes, US Patent 4774339. 3. Matz, M.V., in Methods Mol. Biol., Hicks, B.W, Ed., Totowa: Humana, 2003, vol. 221, pp. 103–116. 4. Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor, NY: Cold Spring Harbor Lab., 1989.
Vol. 31
No. 1
2005
