A Putative Glutathione Peroxidase of Drosophila ...

Biol. Chem., Vol. 384, pp. 463 – 472, March 2003 · Copyright © by Walter de Gruyter · Berlin · New York

A Putative Glutathione Peroxidase of Drosophila Encodes a Thioredoxin Peroxidase That Provides Resistance against Oxidative Stress But Fails to Complement a Lack of Catalase Activity

Fanis Missirlis1,a, Stefan Rahlfs2, Nikolaos Dimopoulos1, Holger Bauer3, Katja Becker2, Arthur Hilliker4, John P. Phillips4 and Herbert Jäckle1,* Abteilung Molekulare Entwicklungsbiologie, Max-Planck-Institut für biophysikalische Chemie, Am Fassberg, D-37077 Göttingen, Germany 2Interdisziplinäres Forschungszentrum, Heinrich-Buff-Ring 26 – 32, D-35392 Giessen, Germany 3Biochemiezentrum, Ruprecht-Karls Universität, Im Neuenheimer Feld 328, D-69120 Heidelberg, Germany 4Department of Biology, York University, Toronto ON M3J 1P3, Canada 1

*Corresponding author

Cellular defense systems against reactive oxygen species (ROS) include thioredoxin reductase (TrxR) and glutathione reductase (GR). They generate sulfhydryl-reducing systems which are coupled to antioxidant enzymes, the thioredoxin and glutathione peroxidases (TPx and GPx). The fruit fly Drosophila lacks a functional GR, suggesting that the thioredoxin system is the major source for recycling glutathione. Whole genome in silico analysis identified two non-selenium containing putative GPx genes. We examined the biochemical characteristics of one of these gene products and found that it lacks GPx activity and functions as a TPx. Transgene-dependent overexpression of the newly identified Glutathione peroxidase homolog with thioredoxin peroxidase activity (Gtpx-1) gene increases resistance to experimentally induced oxidative stress, but does not compensate for the loss of catalase, an enzyme which, like GTPx-1, functions to eliminate hydrogen peroxide. The results suggest that GTPx-1 is part of the Drosophila Trx antioxidant defense system but acts in a genetically distinct pathway or in a different cellular compartment than catalase. Key words: Aging / Antioxidant / Hydrogen peroxide / Oenocytes / ROS.

a

Present address: Cell Biology and Metabolism Branch, National Institute of Child Health and Human Development, Bethesda, MD 20892, USA

Introduction Oxidative stress of cells derives from reactive oxygen species (ROS) that are generated as byproducts of oxygen metabolism (Halliwell and Gutteridge, 1999). ROS include superoxide radicals, hydrogen peroxide (H2O2) and hydroxyl radicals that cause a number of detrimental derivatives by reacting with cellular targets (Girotti, 1998). Intracellular defense systems involve metabolic enzymes such as glutathione reductase (GR), thioredoxin reductase (TrxR), superoxide dismutase (Sod) and catalase (Cat) (Michiels et al., 1994; Halliwell and Gutteridge, 1999; Carmel-Harel and Storz, 2000). Sod and Cat constitute an evolutionary conserved defense system against superoxide in which Cat prevents free hydroxyl radical formation by breaking down H2O2 into oxygen and water (Chance et al., 1979). ROS defense by TrxR and GR is more indirect. They transfer reducing equivalents from NADPH to thioredoxin (Trx) and glutathione disulfide (GSSG), respectively (Carmel-Harel and Storz, 2000; Mustacich and Powis, 2000; Williams et al., 2000). In this way, TrxRs and GRs generate a sulfhydryl reducing system that provides the reducing equivalents for thioredoxin peroxidases (TPxs) (Becker et al., 2000; MirandaVizuete et al., 2000) and glutathione peroxidases (GPxs) (Fahey and Sundquist, 1991; Ursini et al., 1995; BrigeliusFlohé, 1999), respectively. Like Cat, both TPx and GPx are involved in H2O2 elimination. In addition, they reduce organic hydroperoxides (Mills, 1969; Chae et al., 1994). Recently, the annotated Drosophila GR homolog was biochemically and genetically characterized (Kanzok et al., 2001; Missirlis et al., 2001, 2002), showing that this only putative GR of the fly genome (Adams et al., 2000) specifies TrxR activity. Based on the absence of GR and the observation that thioredoxin can reduce glutathione disulfide, it was hypothesized that the TrxR/Trx system compensates for the absence of a GR system that recycles GSH in the fly (Kanzok et al., 2001). This proposal might support earlier findings that insects lack GPx activity (Smith and Shrift, 1979; Allen et al., 1983; Ahmad et al., 1988). In this case, reduction of intracellular H2O2 in Drosophila would be the domain of catalase and TPx (Parkes et al., 1993; Orr and Sohal, 1994; Bauer et al., 2002). Here we report the cloning and functional characterization of one of the two annotated GPx genes of Drosophila (Adams et al., 2000). An analysis of the protein product shows that it exerts TPx rather than GPx activity.

464

F. Missirlis et al.

Thus, the protein represents an example of a GPx-type enzyme with a substrate specificity that would have been expected for a structurally unrelated peroxiredoxin-type enzyme. Transgene-dependent overexpression of the gene, termed Glutathione peroxidase homolog with thioredoxin peroxidase activity (Gtpx-1), protects flies against oxidative stress. However, it fails to compensate the lack of Cat activity. We conclude that GTPx-1 is part of the Drosophila Trx antioxidant defense system but acts in a Cat-independent fashion.

Results A Putative GPx Gene of Drosophila Codes for a TPx Analysis of the Drosophila genome sequence revealed two members of the GPx gene family. The two annotated transcripts CG12013 and CG15116 (Adams et al., 2000) encode proteins with 51% amino acid sequence identity, and 44% and 38% sequence identity with human GPx4, respectively (Figure 1). The two and only putative GPxs of

Fig. 1 Protein Sequence Alignment. Comparison of deduced amino acids of CG12013 (GTPx-1) and CG15116 (GPx-like) with GPx-like proteins of man (Ursini et al., 1995), yeast (Inoue et al., 1999; Avery and Avery, 2001) and Plasmodium falciparum (Gamain et al., 1996; Sztajer et al., 2001). Alignment was performed with the ClustalW computer program (Thompson et al., 1994). Conserved residues are indicated in white, top line indicates amino acid residues found in most proteins. Amino acids of the catalytic site (Ursini et al., 1995) are circled; X is selenocysteine.

GPx Homolog with Thioredoxin Peroxidase Activity

the Drosophila genome (Adams et al., 2000) contain a cysteine residue in place of the catalytic selenocysteine of the human homologs (Ursini et al., 1995). In this respect the two putative GPxs of Drosophila are more similar to the yeast and Plasmodium homologs (Figure 1) recently shown to act as phospholipid hydroperoxide GPxs and as a TPx, respectively (Avery and Avery, 2001; Sztajer et al., 2001). The question was, therefore, which activity is encoded by the putative GPx genes of Drosophila. For examining the biochemical and kinetic properties of the two gene products we generated recombinant Histagged CG12013 and CG15116 protein. CG12013 was expressed as soluble protein of 23.2 kDa which was purified to > 99% by affinity chromatography (see Materials and Methods). No significant GPx activity was observed with the CG12013 protein in a GSH-coupled assay using H2O2, tert-butyl hydroperoxide (tBOOH) or cumene hydroperoxide as substrates. However, in the presence of NADPH and P. falciparum thioredoxin reductase (as a thioredoxin regenerating system) as well as D. melanogaster thioredoxin-1 (DmTrx-1) or thioredoxin-2 (DmTrx2), the protein efficiently catalyzes the reduction of H2O2, tBOOH, and cumene hydroperoxide. At 25 °C and in the presence of 10 µM DmTrx-2 and 200 µM peroxide substrate the determined specific activities were 5.3, 2.9, and 11.1 U/mg, respectively. In the presence of 10 µM DmTrx-2 and 200 µM H2O2 a pH-profile of the enzyme’s activity was carried out in 50 mM Hepes and showed an optimum at pH 7.2. In the presence of 200 µM H2O2, apparent Km values of 10 µM and 3 µM were determined for DmTrx-1 and DmTrx-2, respectively. Thioredoxin concentrations > 25 µM resulted in substrate inhibition. In contrast to other thioredoxin peroxidases, where Km and Vmax values are functions of the cosubstrate concentrations (Sztajer et al., 2001), apparent Km values were obtained also for the second substrates. In the presence of 10 µM DmTrx-2 these values were 180 µM for H2O2, 3.2 mM for tBOOH, and 150 µM for cumene hydroperoxide, respectively. Substrate inhibition was reached at approximately 1 mM H2O2, 10 mM tBOOH, and 400 µM cumene hydroperoxide, respectively.

Table 1

Biochemical Properties of Gtpx1.

Length of polypeptide (amino acids) Deduced molecular mass (kDa) Isoelectric point (pH) Mol. ext. coeff. (ε280; mM– 1 cm– 1) pH optimum (pH)

169 18.7 7.91 16.0 7.2

Substrate Km for DmTrx-1 Km for DmTrx-2

10 µM 3 µM

H2O2 t-Butylhydroperoxide Cumene hydroperoxide

Km 180 µM 3.2 mM 150 µM

kcat* 300 min– 1 440 min– 1 290 min– 1

*Assuming substrate saturation with Trx-2 and peroxide.

465

Based on these data and assuming substrate saturation with DmTrx-2, Vmax values were calculated to be 13.1 U/mg, 18.9 U/mg, and 12.7 U/mg for H2O2, tBOOH, and cumene hydroperoxide, respectively. This corresponds to kcat values of 300 min– 1, 440 min– 1, and 290 min– 1. Table 1 summarizes the biochemical and kinetic features of the enzyme, which indicate that the CG12013 protein is a Trx-dependent peroxidase. Based on this enzymatic activity and the structural similarity with GPx, we refer to the CG12013 gene product as Drosophila glutathione peroxidase homolog with thioredoxin peroxidase activity (GTPx1). This finding is consistent with earlier proposals suggesting that many insects lack GPx activity (Smith and Shrift, 1979; Allen et al., 1983; Ahmad et al., 1988). The gene of a second putative GPx of Drosophila (CG15116) was cloned and overexpressed in parallel with GTPx-1 using the same experimental setup. Based on the high hydrophobicity of the protein it was located in the E. coli membrane pellet. Efforts to solubilize the protein with Triton X-100 or Tween were not successful. Therefore the gene sequence coding for the 33 most hydrophobic N-terminal amino acids was removed. Preliminary experiments indicate that in spite of a 40% probability for a mitochondrial target sequence of this extension the localization of the protein is mainly cytoplasmic and similar to GTPx-1. The new gene product was still located in the cell pellet, but it could be partially solubilized with 2% Tween. With this enzyme sample, however, no activity could be measured in the presence of either GSH or DmTrx-2 as reductants and H2O2, tBOOH, cumene hydroperoxide, or phosphatidylcholine hydroperoxide as substrates. The in vivo function of the protein will be subject of further studies. Structure, Chromosomal Location and Expression of Gtpx-1 In situ hybridization of the Gtpx-1 DNA to polytene chromosomes and sequence comparison of genomic DNA, expressed sequence tag clones (Rubin et al., 2000) and three full-size cDNA isolates (see Materials and Methods) showed that the gene is localized on the left arm of the third chromosome at position 63C and revealed the structure of the Gtpx-1 gene (Figure 2a,b). In order to visualize the spatial and temporal patterns of Gtpx-1 expression, we performed in situ hybridization of antisense RNA probes to whole mount preparations of staged embryos (Rivera-Pomar et al., 1995). The results showed that Gtpx-1 is maternally expressed and that these transcripts become evenly distributed in the egg and early embryo (Figure 2c). Zygotic Gtpx-1 expression is initiated in germline progenitor cells at the blastoderm stage and during gastrulation (Figure 2d). Expression continues in the amnioserosa and macrophages during germ band extension (Figure 2e) and finally in the fat bodies and oenocytes (Figure 2f). Thus, the spatiotemporal patterns of Gtpx-1 expression are very similar to the patterns of Cat gene expression (Missirlis et al., 2001).

466

F. Missirlis et al.

Fig. 2 Genomic Structure, Chromosomal Location and Expression of Gtpx-1. (a) Physical map of the Gtpx-1 transcript and its location within the AE003477 DNA segment (Adams et al., 2000). Boxes represent exons, black regions correspond to the open reading frame of GTPx-1. (b) In situ hybridization of a Gtpx-1 probe to polytene chromosomes showing that the gene resides at position 63C (arrow) on the left arm of the third chromosome. (c–f) In situ hybridization of a Gtpx1 antisense RNA probe to whole mount preparations of staged embryos showing that Gtpx-1 transcripts are provided maternally and are found in the preblastoderm stage embryos (c), zygotic expression occurs in germ line progenitors (d; arrow), in the macrophages and amnioserosa during germ-band extension (e) and in the oenocytes and fat bodies during the later stages of embryogenesis (f; asterisks and arrow, respectively). Stages are according to (Campos-Ortega and Hartenstein, 1985). (g–h) Intracellular localization of Gtpx-1 as revealed by a GTPx-1•GFP reporter protein in tissue culture cells. Schneider cells were transfected with a GTPx-1•GFP-expression plasmids and viewed by fluorescence microscopy (left; green). DNA was marked by DAPI staining (center, blue). Note that GTPx-1•GFP resides outside the nucleus and is concentrated in subcellular compartments as seen in the merged images (right). (h) Schneider cells were transfected with GTPx-1•GFP-expression plasmids and viewed by confocal microscopy (left, green). Mitochondria were stained with Mito Tracker Orange (center, red). Note that GTPx-1•GFP fluorescence does not co-localize with mitochondria (merged immage, right). (i–j) Intracellular localization of Gtpx-1 as revealed by transgene-derived Gtpx-1•GFP reporter gene expression in adult midgut (i) and fat body cells (j) showing that the protein is concentrated in cellular substructures likely to represent the Golgi apparatus. For details see the text and Materials and Methods.

In order to examine the subcellular location of GTPx-1, we expressed a GTPx-1•GFP fusion gene in transfected tissue culture cells (see Materials and Methods) and, by virtue of the transgene-dependent Gal4/UAS expression system (Brand and Perrimon, 1993), in midgut (Figure 2i) and fat body cells of adult flies (Figure 2j). In tissue cultured cells, cytoplasmic GTPx-1•GFP protein (Figure 2g) is enriched in substructures different from mitochondria (Figure 2h). In both adult midgut and fat body cells, the

fusion protein was observed in the cytoplasm, accumulating in what by morphological means appears to be the Golgi apparatus (Figure 2i,j). Extra Copies of Gtpx-1 Protect against Paraquat and Hyperoxia Treatment Recent results have shown that the Trx and Sod1/Cat systems cooperate in the antioxidant defense of Drosophila


(Missirlis et al., 2001). Since GTPx-1 is a component of the Drosophila Trx system, we reasoned that enhanced Gtpx1 activity should protect cells more efficiently against oxidative stress. To test this inference, we generated animals

467

that contain one or two extra copies of Gtpx-1 by the P{Gtpx-1+} transgene (see Materials and Methods). Figure 3 shows that transgenic males containing extra copies of the Gtpx-1 gene are more resistant to experimentally induced oxidative stress than control animals. After paraquat treatment, up to 20% and 40% of the individuals containing one and two extra copies of the Gtpx-1 transgene survive a paraquat concentration (40 mM) that is lethal to wild-type flies, and they were also more resitant to hyperoxia treatment (Figure 3a,b). In addition, flies expressing ubiquitous GTPx-1 from an actin-Gal4-driven UAS-Gtpx-1cDNA transgene (see Materials and Methods) were also more resistant to paraquat treatment and hyperoxia treatment (data not shown). These results indicate that GTPx-1 is an essential component of the antioxidant defense system of Drosophila. Interestingly, contrary results have been obtained earlier for increased Cat activity using the same genetic approach (Orr and Sohal, 1992). Increased Levels of GTPx-1 Cannot Substitute for Loss of Cat Activity

Fig. 3 Transgene-Derived Overexpression of GTPx-1 Confers Resistance to Paraquat and Hyperoxia Treatment. Eclosed males were fed for two days on standard food and then kept on a 40 mM/paraquat 1% sucrose solution (a) or in 100% O2 (b). Survival of white mutant flies (wild-type control) was compared with white mutant flies containing one or two copies of the P{Gtpx-1+} transgene. Note that the survival time is significantly increased in response to the P{Gtpx-1+} transgene activity. Experiments involved a minimum of 200 individuals per genotype (see Materials and Methods).

Previous results suggested that insects lack GPx activity (Smith and Shrift, 1979; Allen et al., 1983; Ahmad et al., 1988) and that in Drosophila, the thioredoxin system compensates for the absence of GR-dependent recycling of GSH (Kanzok et al., 2001). Therefore, the reduction of intracellular H2O2 might be dependent on Cat and/or thioredoxin peroxidase activity (Orr and Sohal, 1992; Griswold et al., 1993; Bauer et al., 2002). GTPx-1 characterization showed in vitro activity with H2O2 as a substrate (Table 1). As a consequence, GTPx-1 is also expected to remove H2O2, in vivo. In order to assess this metabolic connection by genetic means, we asked whether the lack of Cat activity in Catn1 mutants can be compensated for by adding extra copies of the Gtpx1 gene, as has recently been shown with Schizosaccharomyces pombe mutants (Yamada et al., 1999).

Fig. 4 Effect of Gtpx-1 Expression from Gtpx-1 Transgenes on the Life Span of Drosophila Catn1 Mutants. The reduced lifespan of Catn1 mutant flies cannot be extended in response to increased doses of Gtpx-1 activity that derived from one and two extra copies of the Gtpx-1 gene provided by P{Gtpx-1+} transgenes.

468

F. Missirlis et al.

Catn1 is a semi-lethal mutation, i.e. only about 10% of the homozygous flies eclose from the pupal cases and show a reduced lifespan which is about half of that of wild-type flies (Griswold et al., 1993) (see also Figure 4). If the addition of P{Gtpx-1+} transgenes to the genome compensated for the lack of Cat activity, the lifespan of homozygous Catn1 mutant flies should be extended. We found that the addition of one and two copies of the P{Gtpx-1+} did not affect the lifespan of the Cat mutant individuals (Figure 4). These results indicate that increased Gtpx-1 activity cannot functionally substitute for the loss of Cat activity in Drosophila.

Discussion Initially, the finding of a putative GPx in the Drosophila genome had been in conflict with the proposal that insects lack GPx activity (Smith and Shrift, 1979; Allen et al., 1983; Ahmad et al., 1988) and the hypothesis that, in contrast to the evolutionarily conserved Sod/Cat-based defense system (Chance et al., 1979; Michiels et al., 1994; Halliwell and Gutteridge, 1999; Carmel-Harel and Storz, 2000), only the Trx-dependent part of the two sulfhydryl reducing systems that provide reducing equivalents for peroxidases (Becker et al., 2000; Miranda-Vizuete et al., 2000) has been evolutionarily conserved. This hypothesis is based on the finding that the only putative GR of the fly genome (Adams et al., 2000) specifies TrxR activity, implying that the Trx system compensates for the absence of a GR system that recycles GSH in the fly (Kanzok et al., 2001). Our finding that one of the two putative GPxs is, in fact, a TPx is consistent with the proposal that Drosophila lacks GPx activity. Due to the insolubility of the second GPx-like gene product a kinetic characterization has not yet been possible. Therefore we cannot exclude that this second putative GPx indeed exerts GPx activity. The scenario, where in contrast to bacteria, worms and mammals (Williams et al., 2000), the thiol-based intracellular antioxidants of Drosophila would be generated by a single enzyme system, implies that GTPx-1 plays a key role in maintaining intracellular redox homeostasis in Drosophila. This notion is supported by the protective effects of GTPx-1 overexpression during oxidative stress. In contrast to both Drosophila Trx-1 (Salz et al., 1994; Kanzok et al., 2001) and Trx-2 (Bauer et al., 2002) GSH does not serve as electron donor for GTPx-1. As reflected by the lower Km value (see Table 1) for DmTrx-2, GTPx-1 uses Trx-2 more efficiently than Trx-1. The results also show that GTPx-1 functions to reduce H2O2, t-BOOH and cumene hydroperoxide. Our results with Drosophila GTPx-1 therefore support the results recently described for Plasmodium falciparum TPx (Sztajer et al., 2001), which had also been considered to be a GPx before (Gamain et al., 1996), for the human plasma GPx enzyme (Bjornstedt et al., 1994), which concomitantly exerts TPx activity, for a chinese cabbage phospholipid hydroperoxide GPx homolog with TPx activity (Jung et al.,

2002) and for Trypanosoma cruzi GPxI which has recently been shown to be reduced by the thioredoxin-like protein tryparedoxin (Wilkinson et al., 2002). These findings show that family members of GPxs, which were assigned on the basis of sequence analysis only, include enzymes that function as TPxs. They demonstrate that it is difficult to infer the specific electron donor of these enzymes on the basis of an in silico assessment only. In addition to GTPx-1 Drosophila contains a peroxiredoxin gene family (Radyuk et al., 2001; Bauer et al., 2002). Based on overexpression of the different gene products in a cell culture system a protective role against oxidative stress has also been suggested for this family (Radyuk et al., 2001). Biochemical characterization showed that Drosophila peroxiredoxins can turn over H2O2 using thioredoxin as a reducing agent (Radyuk et al., 2001; Bauer et al., 2002). The enzymes are located in different cellular compartments (Radyuk et al., 2001) and in one case tested TPx-1 can efficiently use Trx-2 but not Trx-1 as a reducing substrate (Bauer et al., 2002). The preference for Trx-2 is therefore shared by TPx-1 and GTPx-1. However, it should be noted that the apparent Km values of TPx-1 are with 9 µM (Trx-2) and 52 µM (Trx-1) (Bauer et al., 2002) higher than the values determined for GTPx-1 (3 µM for Trx-2 and 10 µM for Trx-1). On the other hand, the apparent Km values for the peroxide substrates are by 1 – 2 orders of magnitude higher on GTPx-1 than on TPx-1, pointing to differential metabolic functions of the two proteins. However, when comparing the available data it should be taken into account that both enzymes, and particularly TPx-1, are inactivated/inhibited by increasing peroxide concentrations which does not allow detailed kinetic analyses. Both, mammalian GPxs and TrxRs contain a selenocysteine residue in their active site (Ursini et al., 1995; Tamura and Stadtman, 1996) which is important for their catalytic function (Rocher et al., 1992; Zhong and Holmgren, 2000). For example, the catalytic activity of a human TrxR Sec→✍ Cys mutant is reduced by 95% (Bar-Noy et al., 2001). Thus, the serious health problems of mammals, including man, that are caused by selenium deficiency are in part due to an impairment of their cellular antioxidant capacity (Rayman, 2000). A similar proposal has been made for a Drosophila mutant that affects the selenoprotein biosynthesis pathway (Alsina et al., 1999; Morey et al., 2001). However, the finding that Drosophila TrxR (Kanzok et al., 2001) and the two identified putative GPxs of Drosophila, irrespective of whether these two peroxidases act as TPx or GPx, contain a cysteine instead of a selenocysteine suggest that the key enzymes of redox homeostasis of the fly are not dependent on selenocysteine. The biochemical properties of GTPx-1 (see Table 1) and the finding that Drosophila individuals expressing extra copies of Gtpx-1 are able to survive paraquat and hyperoxia treatment better than wild-type flies establish that Drosophila GTPx-1 functions as an antioxidant. However, the mechanism by which GTPx-1 exerts its protective function has not yet been elucidated. One intruiging possibility is that it contributes to the reduction of


apoptosis-inducing H2O2 as has been established for human TPx II (Zhang et al., 1997), superoxide dismutase and catalase (Sandstrom and Buttke, 1993; Rabizadeh et al., 1995). The mechanism by which cells are protected from ROS-induced apoptosis are not completely understood. However, it has recently been shown that a mammalian TPx inhibits cell death probably by acting upstream of Bcl-2 and the mitochondrial cytochrome C release (Zhang et al., 1997). Since a Gtpx-1 mutant of Drosophila is not viable, we could not assess such features in our present study and thus, the physiological role of GTPx-1 and the mechanism of the mode of TPx action remain to be established. In addition to maternal expression of the gene during oogenesis, which results in an accummulation of transcripts in oocytes, eggs and early embryos, predominant sites of Gtpx-1 transcription include germ line progenitors, fat body cells and the oenocytes, a segmentally repeated organ structure which is involved in cuticle secretion (Schal et al., 1998), detoxification (Ruiz de Mena et al., 1999) and pheromone production (Ferveur et al., 1997). Similar expression patterns during Drosophila embryogenesis have recently been reported for TrxR, Sod and Cat (Missirlis et al., 2001). Sites of high and coextensive expression of both defense systems are the germ line cells, which are targets for a special protection against destructive oxidants to prevent an accumulation of mutations. The coextensive expression patterns are consistent with the finding that these enzymes are able to functionally cooperate and partially substitute for each other, at least in organismic terms (Missirlis et al., 2001). Furthermore, loss of Cat mutants of Schizosaccharomyces pombe can be complemented by adding extra copies of a TPx gene (Yamada et al., 1999). Therefore, it was interesting to see that increased GTPx-1 expression in Drosophila Cat mutant individuals did not extend the capacity to adequately protect cells from cytotoxic damage. Catalase has been demonstrated in the cytosolic fraction of Drosophila cells, however, it remains to be established if the enzyme is located in peroxisomes or in the cytosol (Kwong et al., 2000, Radyuk et al., 2001). It is therefore possible that catalase and GTPx-1 act in different cellular compartments. A second explanation for the lack of compensation is the fact that GTPx-1 has a substrate spectrum differing from catalases. In addition to H2O2, GTPx-1 reduces alkyl hydroperoxides and aromatic peroxides, however, the apparent Km for H2O2 is 180 µM and as such rather high. Thus, although GTPx-1 does contribute to the antioxidant capacity of the cell, the detoxification of hydrogen peroxide is unlikely to be the major task of this protein.

Materials and Methods Cloning and Gene Expression A PCR-amplified genomic DNA fragment (Sambrook and Russel, 2001) of wild-type Drosophila melanogaster (Oregon-R) (degen-

469

erated primers: GPx375-5’ GCNTTYCCNTGYAAYCARTTYGG and GPx564-3’ TCVATVARRAAYTTNGTRAARTTCCACTT which correspond to the conserved sequence FPCNQFG and WNFEKFL of GPx proteins; Figure 1) was cloned (pGEMT vector; Promega, Mannheim, Germany) and used to isolate genomic DNA and cDNAs from corresponding libraries (Stratagene, Amsterdam, Netherlands). We isolated a 7 kb EcoRI genomic fragment including the transcribed region of Gtpx-1 as well as 5.5 kb upstream and 1 kb downstream sequences, and three full-size cDNA clones (pBstKSGtpx1gen and pBstKSGtpx1cDNA), respectively. In order to produce recombinant GTPx-1, the region containing the Gtpx-1 open reading frame was PCR amplified (primers: GTPx1GFP5’ CCGCTCGAGATGTCTGCTAACGG and GTPx1SET3’ CCGCTCGAGTCTAGACATCTACAGCAGC) and cloned into the expression vector pRSETA (Invitrogen, Carlsbad, USA) which added an amino-terminal hexahistidyl tag (GTPx1•His) to the protein. Competent E. coli BL21 cells were transformed with the pRSETA/Gtpx plasmid. Cells were grown at 37 °C in LB medium containing ampicillin (100 µg/ml) to an OD600 of 0.5; subsequently, expression was induced by adding 1 mM IPTG. Cells were grown for additional four hours, harvested, and directly used for protein purification or frozen at – 20 °C. Protein Purification and Enzyme Kinetics For purification, the cells were treated with lysozyme (0.2 mg/ml) and DNase (0.02 mg/ml) for 20 min at room temperature and were then disintegrated by sonication. As protease inhibitors, 100 µM phenylmethylsulfonyl fluoride, 3 µM pepstatin, and 80 nM cystatin were added to the cell extract. After centrifugation, the supernatant was loaded onto a Ni-NTA column equilibrated with 50 mM sodium phosphate, 300 mM NaCl, pH 8.0. After washing the column with increasing imidazol concentrations, the protein was eluted with 50 – 75 mM imidazol. Collected fractions were tested for enzymatic activity and for purity by 12% SDS gel electrophoresis. Active fractions showing a single band at the expected size of 23 kDa were pooled, concentrated by ultrafiltration, and equilibrated with 50 mM sodium phosphate, 300 mM NaCl, pH 8.0, prior to use. Protein concentrations were determined spectrophotometrically on the basis of the calculated extinction coefficient of the respective protein. The overall yield of this procedure was 6 mg protein per liter of cell culture. The concentrated peroxidase was stable at 4 °C over weeks. PfTrxR, DmTrx-1, and DmTrx-2 were recombinantly produced as described previously (Kanzok et al., 2000, 2001; Bauer et al., 2002). TPx-assays were carried out at 25 °C in an assay mixture of 1 ml consisting of 50 mM Hepes, pH 7.2 (which was shown to be the pH optimum of GTPx-1), with 100 µM NADPH, 100 mU Plasmodium falciparum thioredoxin reductase (as determined in the presence of 100 µM NADPH and 3 mM DTNB as substrate), 10 µM DmTrx1 or DmTrx2 (Bauer et al., 2002), and 200 µM of the second substrate such as H2O2, t-butyl hydroperoxide (tBOOH) or cumene hydroperoxide. For further kinetic characterization concentrations of DmTrx1 or DmTrx2 (1 µM to 50 µM) and of the second substrate (20 µM to 10 mM depending on the substrate) were systematically varied. The assay was started with TPx and NADPH consumption (ε340 nm = 6.22 mM– 1 cm– 1) was monitored spectrophotometrically at 340 nm. In this coupled assay system constantly high concentrations of reduced Trx were maintained by the NADPH/TrxR-system. The peroxidase activity effected by the TrxR/Trx system was monitored in each assay before the addition of GTPx-1 and subtracted from the activity of the complete system. For optimisation of the assay conditions, the addition of KCl to final concentrations of 50, 100, and 200 mM, respectively, was tested. However, the presence of salt markedly decreased the enzymatic activity.

470

F. Missirlis et al.

Production of Fusion Proteins To visualize the subcellular localization of GTPx-1, we generated a reporter gene by fusing the PCR amplified open reading frame of Gtpx-1 (primers: GTPx1GFP5’, see above and GTPx1GFP3’ CCGCTCGAGGCACATCAACAGCAGC) to green fluorescent protein (GFP) using the pEGFP N1 vector (Clontech, Heidelberg, Germany). Drosophila Schneider cells were transfected as described in (Hirosawa-Takamori et al., 2000). Staining of cells with DAPI Mitotracker® Orange CM-H2TMRos (Molecular Probes, Leiden, The Netherlands) visualized nuclei and mitochondria by fluorescent and confocal microscopy (Missirlis et al., 2002). Drosophila Stocks and Transgene Construction Experimental flies were kept at 25 °C (Forjanic et al., 1997). We used Catn1 (Griswold et al., 1993), balancer chromosomes (Lindsley and Zimm, 1992), actin-Gal4 (Gonzalez-Gaitan and Jackle, 2000), 1407-Gal4 in (Ferveur et al., 1997), and FB-Gal4 (gift of R. Kühnlein). For P{Gtpx-1+} transgene construction, pBstKSGtpx1 was digested with EcoRI and the 7 kb Gtpx-1 genomic fragment (see above) was inserted in the EcoRI site of PCaspeRAUGß-Gal 5’ (Thummel and Pirrotta, 1992) in front of LacZ. For UAS-Gtpx1 and UAS-Gtpx-1•GFP construction, the full-length cDNA of Gtpx-1 (pBstKSGtpx1 EcoRI/XhoI fragment) or the PGTPx1•GFP fragment were directionally cloned into the PUAST. Transgenic stocks (P{Gtpx-1+}, UAS-Gtpx-1 and UAS-Gtpx1•GFP) were generated as described (Rubin and Spradling, 1982), and single transgene insertions were mapped to chromosomes (Greenspan, 1997). Heterozygotes and homozygotes P{Gtpx-1+} transgene-bearing white mutant flies could be distinguished by the intensity of their eye color (Hazelrigg et al., 1984). Transgene expression was monitored by in situ hybridization on whole mounted preparations of embryos (Missirlis et al., 2001). Paraquat, Hyperoxia Assays, and Lifespan Measurements Batches of 20 adult males (24 to 48 hours after eclosion) were kept for 48 h (25 °C) in vials containing Whatman 3M (32 mm) filter disks saturated with 400 µl sucrose solution (1%; 40 mM paraquat; Sigma, Munich, Germany). Standard deviations are derived from three independent experiments each performed with 200 individuals per genotype. Control experiments were performed on 1% sucrose. Hyperoxia treatment was performed with batches of 10 males per vial, covered with nylon mesh. They were exposed in a leucite chamber to 100% O2 (21 – 23 °C) and 101.3 kPa as monitored by a portable oxygen analyzer (Servomex, model 570). Survival of flies was scored daily. Chamber recharge time was less than 10 min. Lifespan measurements were described earlier (Missirlis et al., 2001).

Acknowledgments The authors wish to thank Gordon Dowe, Heike Taubert and Marina Fischer for their excellent technical assistance. This work was supported by a grant of the Deutsche Forschungsgemeinschaft (Priority Programme ‘Selenoproteins’, SPP 1087, to H.J. and K.B.). After acceptance of the manuscript, Delaunay et al. [Cell 111 (2002), pp. 471 – 478] reported that yeast Gpx3 acts also as a thioredoxin peroxidase. Its main function is to activate the transcription factor Yap1 in response to elevated levels of hydroperoxide and, thus, functions as a hydroperoxide receptor and redox-transducer. This finding offers an explanation for as to why overexpression of GTPx-1 does not rescue the catalase mutant.

References Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A., Gocayne, J. D., Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F. et al. (2000). The genome sequence of Drosophila melanogaster. Science 287, 2185 – 2195. Ahmad, S., Pritsos, C. A., Bowen, S. M., Heisler, C. R., Blomquist, G. J., and Pardini, R. S. (1988). Antioxidant enzymes of larvae of the cabbage looper moth, Trichoplusia ni: subcellular distribution and activities of superoxide dismutase, catalase and glutathione reductase. Free Radic. Res. Commun. 4, 403 – 408. Allen, R. G., Farmer, K. J., and Sohal, R. S. (1983). Effect of catalase inactivation on levels of inorganic peroxides, superoxide dismutase, glutathione, oxygen consumption and life span in adult houseflies (Musca domestica). Biochem. J. 216, 503 – 506. Alsina, B., Corominas, M., Berry, M. J., Baguna, J., and Serras, F. (1999). Disruption of selenoprotein biosynthesis affects cell proliferation in the imaginal discs and brain of Drosophila melanogaster. J. Cell Sci. 112, 2875 – 2884. Avery, A. M. and Avery, S. V. (2001). Saccharomyces cerevisiae expresses three phospholipid hydroperoxide glutathione peroxidases. J. Biol. Chem. 276, 33730 – 33735. Bar-Noy, S., Gorlatov, S. N., and Stadtman, T. C. (2001) Overexpression of wild type and Secys/Cys mutant of human thioredoxin reductase in E. coli: the role of selenocysteine in the catalytic activity. Free Radic. Biol. Med. 30, 51 – 61. Bauer, H., S. M. Kanzok, and Schirmer, R. H. (2002). Thioredoxin– 2 but not thioredoxin-1 is a substrate of thioredoxin peroxidase-1 from Drosophila melanogaster: isolation and characterization of a second thioredoxin in D. Melanogaster and evidence for distinct biological functions of Trx-1 and Trx-2. J. Biol. Chem. 277, 17457 – 17463. Becker, K., Gromer, S., Schirmer, R. H., and Muller, S. (2000). Thioredoxin reductase as a pathophysiological factor and drug target. Eur. J. Biochem. 267, 6118 – 6125. Bjornstedt, M., Xue, J., Huang, W., Akesson, B., and Holmgren, A. (1994). The thioredoxin and glutaredoxin systems are efficient electron donors to human plasma glutathione peroxidase. J. Biol. Chem. 269, 29382 – 29384. Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401 – 415. Brigelius-Flohé, R. (1999). Tissue-specific functions of individual glutathione peroxidases. Free Radic. Biol. Med. 27, 951 – 965. Campos-Ortega, J. A. and Hartenstein, V. (1985). The Embryonic Development of Drosophila melanogaster (Heidelberg, Germany: Springer Verlag). Carmel-Harel, O. and Storz, G. (2000). Roles of the glutathioneand thioredoxin-dependent reduction systems in the Escherichia coli and Saccharomyces cerevisiae responses to oxidative stress. Annu. Rev. Microbiol. 54, 439 – 461. Chae, H. Z., Chung, S. J., and Rhee, S. G. (1994). Thioredoxindependent peroxide reductase from yeast. J. Biol. Chem. 269, 27670 – 27678. Chance, B., Sies, H., and Boveris, A. (1979). Hydroperoxide metabolism in mammalian organs. Physiol. Rev. 59, 527 – 605. Fahey, R. C. and Sundquist, A. R. (1991). Evolution of glutathione metabolism. Adv. Enzymol. Relat. Areas Mol. Biol. 64, 1 – 53. Ferveur, J. F., Savarit, F., O’Kane, C. J., Sureau, G., Greenspan, R. J., and Jallon, J. M. (1997). Genetic feminization of pheromones and its behavioral consequences in Drosophila males. Science 276, 1555 – 1558.


Forjanic, J. P., Chen, C. K., Jäckle, H., and Gonzalez Gaitan, M. (1997). Genetic analysis of stomatogastric nervous system development in Drosophila using enhancer trap lines. Dev. Biol. 186, 139 – 154. Gamain, B., Langsley, G., Fourmaux, M. N., Touzel, J. P., Camus, D., Dive, D., and Slomianny, C. (1996). Molecular characterization of the glutathione peroxidase gene of the human malaria parasite Plasmodium falciparum. Mol. Biochem. Parasitol. 78, 237 – 248. Girotti, A. W. (1998). Lipid hydroperoxide generation, turnover, and effector action in biological systems. J. Lipid. Res. 39, 1529 – 1542. Gonzalez-Gaitan, M. and Jäckle, H. (2000). Tip cell-derived RTK signaling initiates cell movements in the Drosophila stomatogastric nervous system anlage. EMBO Rep. 1, 366 – 371. Greenspan, R. J. (1997). Fly Pushing: The theory and practice of Drosophila genetics (Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press). Griswold, C. M., Matthews, A. L., Bewley, K. E., and Mahaffey, J. W. (1993). Molecular characterization and rescue of acatalasemic mutants of Drosophila melanogaster. Genetics 134, 781 – 788. Halliwell, B. and Gutteridge, J. M. (1999). Free Radicals in Biology and Medicine (Oxford, UK: Oxford University Press Inc). Hazelrigg, T., Levis, R., and Rubin, G. M. (1984). Transformation of white locus DNA in Drosophila: dosage compensation, zeste interaction, and position effects. Cell 36, 469 – 481. Hirosawa-Takamori, M., Jäckle, H., and Vorbruggen, G. (2000). The class 2 selenophosphate synthetase gene of Drosophila contains a functional mammalian-type SECIS. EMBO Rep. 1, 441 – 446. Inoue, Y., Matsuda, T., Sugiyama, K., Izawa, S., and Kimura, A. (1999). Genetic analysis of glutathione peroxidase in oxidative stress response of Saccharomyces cerevisiae. J. Biol. Chem. 274, 27002 – 27009. Jung, B. G., Lee, K. O., Lee, S. S., Chi, Y. H., Jang, H. H., Kang, S. S., Lee, K., Lim, D., Yoon, S. C., Yun, D. J., et al. (2002). A Chinese cabbage cDNA with high sequence identity to phospholipid hydroperoxide glutathione peroxidases encodes a novel isoform of thioredoxin-dependent peroxidase. J. Biol. Chem. 277, 12572 – 12578. Kanzok, S. M., Schirmer, R. H., Turbachova, I., Iozef, R., and Becker, K. (2000). The thioredoxin system of the malaria parasite Plasmodium falciparum. Glutathione reduction revisited. J. Biol. Chem. 275, 40180 – 40186. Kanzok, S. M., Fechner, A., Bauer, H., Ulschmid, J. K., Muller, H. M., Botella-Munoz, J., Schneuwly, S., Schirmer, R. H., and Becker, K. (2001). Substitution of the thioredoxin system for glutathione reductase in Drosophila melanogaster. Science 291, 643 – 646. Kwong, L.K., Mockett, R.J., Bayne, A.V., Orr, W.C., and Sohal, R.S. (2000). Decreased mitochondrial hydrogen peroxide release in transgenic Drosophila melanogaster expressing intramitochondrial catalase. Archiv. Biochem. Biophys. 383, 303 – 308. Lindsley, D. L. and Zimm, G. G. (1992). The genome of Drosophila melanogaster (London, UK: Academic Press). Michiels, C., Raes, M., Toussaint, O., and Remacle, J. (1994). Importance of Se-glutathione peroxidase, catalase, and Cu/ZnSOD for cell survival against oxidative stress. Free Radic. Biol. Med. 17, 235 – 248. Mills, G. C. (1969). The physiologic regulation of erythrocyte metabolism. Tex. Rep. Biol. Med. 27, 773 – 786. Miranda-Vizuete, A., Damdimopoulos, A. E., and Spyrou, G. (2000). The mitochondrial thioredoxin system. Antiox. Redox Signal 2, 801 – 810.

471

Missirlis, F., Phillips, J. P., and Jäckle, H. (2001). Cooperative action of antioxidant defense systems in Drosophila. Curr. Biol. 11, 1272 – 1277. Missirlis, F., J. K. Ulschmid, Hirosawa-Takamori, M., Gronke, S., Schäfer, U., Becker, K., Phillips, J. P., Jäckle, H. (2002). Mitochondrial and cytoplasmic thioredoxin reductase variants encoded by a single Drosophila gene are both essential for viability. J. Biol. Chem. 277, 11521 – 11526. Morey, M., Serras, F., Baguñà, J., Hafen, E., and Corominas, M. (2001). Modulation of the Ras/MAPK signalling pathway by the redox function of selenoproteins in Drosophila melanogaster. Dev. Biol. 238, 145 – 156. Mustacich, D. and Powis, G. (2000). Thioredoxin reductase. Biochem. J. 346, 1 – 8. Orr, W. C., and Sohal, R. S. (1992). The effects of catalase gene overexpression on life span and resistance to oxidative stress in transgenic Drosophila melanogaster. Arch. Biochem. Biophys. 297, 35 – 41. Orr, W. C. and Sohal, R. S. (1994). Extension of life-span by overexpression of superoxide dismutase and catalase in Drosophila melanogaster. Science 263, 1128 – 1130. Parkes, T. L., Hilliker, A. J., and Phillips, J. P. (1993). Genetic and biochemical analysis of glutathione-S-transferase in the oxygen defense system of Drosophila melanogaster. Genome 36, 1007 – 1014. Rabizadeh, S., Gralla, E. B., Borchelt, D. R., Gwinn, R., Valentine, J. S., Sisodia, S., Wong, P., Lee, M., Hahn, H., and Bredesen, D. E. (1995). Mutations associated with amyotrophic lateral sclerosis convert superoxide dismutase from an antiapoptotic gene to a proapoptotic gene: studies in yeast and neural cells. Proc. Natl. Acad. Sci. USA 92, 3024 – 3028. Radyuk, S.N., Klichko, V.I., Spinola, B., Sohal, R.S., and Orr, W.C. (2001). The peroxiredoxin gene family in Drosophila melanogaster. Free Radic. Biol. Med. 31, 1090 – 1100. Rayman, M. P. (2000). The importance of selenium to human health. Lancet 356, 233 – 241. Rivera-Pomar, R., Lu, X., Perrimon, N., Taubert, H., and Jäckle, H. (1995). Activation of posterior gap gene expression in the Drosophila blastoderm. Nature 376, 253 – 256. Rocher, C., Lalanne, J. L., and Chaudiere, J. (1992). Purification and properties of a recombinant sulfur analog of murine selenium-glutathione peroxidase. Eur. J. Biochem. 205, 955 – 960. Rubin, G. M. and Spradling, A. C. (1982). Genetic transformation of Drosophila with transposable element vectors. Science 218, 348 – 353. Rubin, G. M., Hong, L., Brokstein, P., Evans-Holm, M., Frise, E., Stapleton, M., and Harvey, D. A. (2000). A Drosophila complementary DNA resource. Science 287, 2222 – 2224. Ruiz de Mena, I., Fernandez-Moreno, M.A., Bornstein, B., Kaguni, L.S., and Garesse, R. (1999) Structure and regulated expression of the δ-aminolevulinate synthase gene from Drosophila melanogaster. J. Biol. Chem. 274, 37321 – 37328. Salz, H. K., Flickinger, T. W., Mittendorf, E., Pellicena-Palle, A., Petschek, J. P., and Albrecht, E. B. (1994). The Drosophila maternal effect locus deadhead encodes a thioredoxin homolog required for female meiosis and early embryonic development. Genetics 136, 1075 – 1086. Sambrook, J. and Russel, W. D. (2001). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press). Sandstrom, P. A. and Buttke, T. M. (1993). Autocrine production of extracellular catalase prevents apoptosis of the human CEM T-cell line in serum-free medium. Proc. Natl. Acad. Sci. USA 90, 4708 – 4712. Schal, C., Sevala, V. L., Young, H. P., and Bachmann, J. A. S. (1998). Sites of synthesis and transport pathways of insect hy-

472

F. Missirlis et al.

drocarbons - cuticle and ovary as target tissues. Am. Zoologist 38, 382 – 393. Smith, J. and Shrift, A. (1979). Phylogenetic distribution of glutathione peroxidase. Comp. Biochem. Physiol. B 63, 39 – 44. Sztajer, H., Gamain, B., Aumann, K. D., Slomianny, C., Becker, K., Brigelius-Flohé, R., and Flohé, L. (2001). The putative glutathione peroxidase gene of Plasmodium falciparum codes for a thioredoxin peroxidase. J. Biol. Chem. 276, 7397 – 7403. Tamura, T. and Stadtman, T. C. (1996). A new selenoprotein from human lung adenocarcinoma cells: purification, properties, and thioredoxin reductase activity. Proc. Natl. Acad. Sci. USA 93, 1006 – 1011. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673 – 4680. Thummel, C. S. and Pirrotta, V. (1992). Technical notes: new pCasper P-element vectors. Drosophila Information Service 71, 150. Ursini, F., Maiorino, M., Brigelius-Flohé, R., Aumann, K. D., Roveri, A., Schomburg, D., and Flohé, L. (1995). Diversity of glutathione peroxidases. Methods Enzymol. 252, 38 – 53.

Wilkinson, S. R., Meyer, D. J., Taylor, M. C., Bromley, E. V., Miles, M. A., and Kelly, J. M. (2002). The Trypanosoma cruzi enzyme TcGPXI is a glycosomal peroxidase and can be linked to trypanothione reduction by glutathione or tryparedoxin. J. Biol. Chem. 277, 17062 – 17071. Williams, C. H., Arscott, L. D., Muller, S., Lennon, B. W., Ludwig, M. L., Wang, P. F., Veine, D. M., Becker, K., and Schirmer, R. H. (2000). Thioredoxin reductase two modes of catalysis have evolved. Eur. J. Biochem. 267, 6110 – 6117. Yamada, K., Nakagawa, C. W., and Mutoh, N. (1999). Schizosaccharomyces pombe homologue of glutathione peroxidase, which does not contain selenocysteine, is induced by several stresses and works as an antioxidant. Yeast 15, 1125 – 1132. Zhang, P., Liu, B., Kang, S. W., Seo, M. S., Rhee, S. G., and Obeid, L. M. (1997). Thioredoxin peroxidase is a novel inhibitor of apoptosis with a mechanism distinct from that of Bcl-2. J. Biol. Chem. 272, 30615 – 30618. Zhong, L. and Holmgren, A. (2000). Essential role of selenium in the catalytic activities of mammalian thioredoxin reductase revealed by characterization of recombinant enzymes with selenocysteine mutations. J. Biol. Chem. 275, 18121 – 18128. Received August 6, 2002; accepted October 9, 2002