A Role of Template Cleavage in Reduced ... - Journal of Virology

A Role of Template Cleavage in Reduced Excision of ChainTerminating Nucleotides by Human Immunodeficiency Virus Type 1 Reverse Transcriptase Containing the M184V Mutation Antonio J. Acosta-Hoyos, Suzanne E. Matsuura, Peter R. Meyer,* and Walter A. Scott Department of Biochemistry and Molecular Biology, University of Miami Miller School of Medicine, Miami, Florida, USA

Resistance to nucleoside reverse transcriptase (RT) inhibitors is conferred on human immunodeficiency virus type 1 through thymidine analogue resistance mutations (TAMs) that increase the ability of RT to excise chain-terminating nucleotides after they have been incorporated. The RT mutation M184V is a potent suppressor of TAMs. In RT containing TAMs, the addition of M184V suppressed the excision of 3=-deoxy-3=-azidothymidine monophosphate (AZTMP) to a greater extent on an RNA template than on a DNA template with the same sequence. The catalytically inactive RNase H mutation E478Q abolished this difference. The reduction in excision activity was similar with either ATP or pyrophosphate as the acceptor substrate. Decreased excision of AZTMP was associated with increased cleavage of the RNA template at position ⴚ7 relative to the primer terminus, which led to increased primer-template dissociation. Whether M184V was present or not, RT did not initially bind at the ⴚ7 cleavage site. Cleavage at the initial site was followed by RT dissociation and rebinding at the ⴚ7 cleavage site, and the dissociation and rebinding were enhanced when the M184V mutation was present. In contrast to the effect of M184V, the K65R mutation suppressed the excision activity of RT to the same extent on either an RNA or a DNA template and did not alter the RNase H cleavage pattern. Based on these results, we propose that enhanced RNase H cleavage near the primer terminus plays a role in M184V suppression of AZT resistance, while K65R suppression occurs through a different mechanism.

R

everse transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1) is the key enzyme responsible for the synthesis of a double-stranded copy of the HIV genome that is subsequently integrated into the host chromosome during HIV infection. Treatment of HIV-1-infected patients with RT inhibitors such as 3=-deoxy-3=-azidothymidine (zidovudine, AZT) leads to selection of mutations in RT known as thymidine analogue resistance mutations (TAMs), which include M41L, D67N, K70R, L210W, T215Y or F, and K219Q or E. RTs containing various combinations of these mutations have an elevated excision activity that allows them to remove AZT monophosphate (AZTMP) and other chain-terminating nucleotides after they have been incorporated (1, 2, 10, 33). Treatment of HIV-1-infected patients with (⫺)2=,3=-dideoxy-3=-thiacytidine (lamivudine, 3TC) or (⫺)2=, 3=-dideoxy-5-fluoro-3=-thiacytidine (emtricitabine, FTC) leads to selection of the M184I mutation in RT, which is rapidly replaced with M184V (7, 25, 52, 57). The M184V mutation is a potent suppressor of AZT resistance conferred by TAMs (7, 30, 40, 57), and this suppressor activity is thought to contribute to the beneficial effects of therapies that include 3TC or FTC in combination with other nucleoside RT inhibitors (19, 30, 40, 44, 56). Methionine 184 is part of the YMDD signature motif that makes up the polymerase active site of HIV-1 RT and lies near the binding sites for the primer terminus and the incoming deoxynucleoside triphosphate (dNTP) (28, 31). M184I is usually selected first during therapy with 3TC or FTC, and structural studies to investigate the molecular mechanism of drug resistance have focused on RT containing this mutation. A cocrystal structure of M184I mutant RT with a DNA-DNA primer-template (P/T) shows changes in the positioning of the primer terminus and the dNTP binding site due to the mutation, leading to a model that explains 3TC and FTC resistance through an increased ability of the mutant enzyme to exclude the analogs in favor of the natural

5122

jvi.asm.org

substrate, dCTP (50). M184I RT is defective in binding to natural dNTPs and has defects in primer extension and processivity, as well as increased strand-switching activity (26, 29). These defects result in impaired fitness in vivo, and the M184I mutation is rapidly replaced with M184V during prolonged therapy (52, 53). M184V RT also has a mild defect in processivity (3–5, 8, 23, 39, 54) and ternary complex (RT-dNTP-P/T) stability (18, 24) accompanied by modest reductions in affinity for natural dNTPs (15, 20, 60), but this mutant is selected because of a fitness advantage in vivo. Selection experiments in a TAM background resulted in M184V with no evidence of an M184I intermediate (30), and M184V is usually the only mutation detected at RT position 184 in HIV-1-infected patients undergoing prolonged 3TC therapy (53). The present study focused on M184V since it is the mutation most relevant to ongoing clinical suppression of AZT resistance. The biochemical basis of M184V suppression of TAMs has been the subject of several studies (9, 21, 22, 27, 32, 38, 39, 49, 58, 62). Typically, the M184V mutation confers a reduction in excision activity that can be observed on either RNA or DNA templates. Here we compared M184V-dependent reductions in excision activity on both RNA and DNA templates with the same sequence. Suppression of excision was consistently greater on an RNA template than on a DNA template. This increased suppression depended on the RNase H activity of RT and was associated

Received 22 July 2011 Accepted 21 February 2012 Published ahead of print 29 February 2012 Address correspondence to Walter A. Scott, [email protected]. * Present address: Shaw Science Partners, Atlanta, Georgia, USA. Copyright © 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/JVI.05767-11

0022-538X/12/$12.00

Journal of Virology p. 5122–5133

RNase H Role in Reduced Excision by HIV-1 RT M184V

with enhanced RNase H cleavage at sites in the template near the primer terminus that result in dissociation of the P/T duplex. The M184V mutation favored dissociation of the mutant RT from the site of initial cleavage, resulting in enhanced binding and cleavage at a downstream site near the primer terminus, leading to the dissociation of P/T, which disfavors excision. MATERIALS AND METHODS Expression and purification of wild-type (WT) RT (RTWT) and mutant HIV-1 RTs. His-tagged HIV-1 RT was prepared as previously described, using expression vector pKRT2, which contains RT coding sequence from the HIV-1 BH10 background (12), or pTRc99 (Pharmacia Biotech), which contains RT coding sequence from the HIV-1 LAI background (55). pKRT2 was obtained from the AIDS Research and Reference Reagent Program (contributed by Richard D’Aquila and William C. Summers). Proviral clones of HIV-1 WT-LAI and RT mutants in the LAI background containing restriction sites XbaI and XmaI bracketing most of the RT coding sequence were provided by John Mellors. The XbaIXmaI fragment was transferred into a pTRc99 expression vector, also provided by John Mellors. The expression vectors were further modified by adding an N-terminal polyhistidine tail as previously described (34, 35). RTK65R, RTD67N/K70R/T215Y/K219Q, and RTK65R/D67N/K70R/T215Y/K219Q were expressed in pTRc99 constructs and compared with RTWT-LAI. The other mutant RTs used in this study (RTM41L/T215Y, RTM41L/M184V/T215Y, RTM41L/T215Y/E478Q, RTM41L/M184V/T215Y/E478Q, RTD67N/K70R/T215F/K219Q, and RTD67N/K70R/M184V/T215F/K219Q) were expressed in pKRT2 constructs and compared with RTWT-BH10. Mutations were introduced by the megaprimer method (51) or by site-directed mutagenesis using the QuikChange II kit (Agilent Technologies) and confirmed by sequencing. WT and mutant RTs were purified as previously described (34) and were predominantly homodimeric. For all assays, RT was added in 20- to 40fold excess over the P/T concentration based on the RT protein concentration with no adjustment made for differences in specific activity. Labeled and unlabeled oligonucleotides. Oligodeoxynucleotides L33 (5=-CTACTAGTTTTCTCCATCTAGACGATACCAGAA-3=), D19 (5=-C TACTAGTTTTCTCCATC-3=), and D50 (5=-GAGTGCTGAGGTCTTCA TTCTGGTATCGTCTAGATGGAGAAAACTAGTAG-3=) were purchased from Sigma Genosys and gel purified prior to use. Where indicated, L33 was 5= labeled with [␥-32P]ATP (Perkin-Elmer Life Sciences) and T4 polynucleotide kinase (Promega Corp.). Labeled DNA was separated from unincorporated nucleotide using Micro Bio-Spin Columns (P-30 columns, RNase-Free; Bio-Rad Laboratories), followed by phenol-chloroform extraction and ethanol precipitation. The 5=-biotinylated L33 oligodeoxynucleotide was purchased from Eurofins MWG Operon and gel purified before use. RNA template R52 (5=-GGGAGUG CUGAGGUCUUCAUUCUGGUAUCGUCUAGAUGGAGAAAACUAG UAG-3=) was synthesized by in vitro transcription by following the manufacturer’s protocol (T7-MEGA-shortscript kit; Ambion, Inc.). In brief, 500 nM DNA duplex formed by the oligonucleotide 5=-AATTTAATACG ACTCACTATAGGGAGTGCTGAGGTCTTCATTCTGGTATCGTCTAG ATGGAGAAAACTAGTAG-3= annealed to its complement was incubated for 4 h with T7 RNA polymerase and NTPs at 37°C, treated with RNasefree DNase I (Ambion, Inc.) for 20 min at 37°C, and then heated at 95°C for 5 min. Unincorporated nucleotides were removed with P-30 columns, followed by treatment with 1 U shrimp alkaline phosphatase (Promega Corp.) in the presence of RNase inhibitor (20 U of RNasin-Plus; Promega Corp.) for 30 min at 37°C. The phosphatase was inactivated by heating for 5 min at 95°C, and the unlabeled RNA was gel purified, phenol-chloroform extracted, and ethanol precipitated. Alternatively, after gel purification, the RNA was 5= labeled with [␥-32P]ATP and T4 polynucleotide kinase in a reaction mixture containing 20 U of RNasin-Plus, and labeled nucleotide was removed by centrifugation through a P-30 column, followed by phenol-chloroform extraction and ethanol precipitation. Excision rescue of AZTMP-terminated P/Ts. Sixteen picomoles of 5=-32P-labeled L33 was annealed with 32 pmol of unlabeled R52 or D50

May 2012 Volume 86 Number 9

and incubated with 10 ␮M AZTTP and 190 nM RTM41L/T215Y/E478Q in RB-10 buffer (final concentrations, 10 mM MgCl2, 40 mM HEPES [pH, 7.5], 60 mM KCl, 1 mM dithiothreitol, 2.5% glycerol, and 80 ␮g/ml bovine serum albumin) and 20 U of RNasin-Plus in a total volume of 300 ␮l for 1 h at 37°C. The 32P-labeled, chain-terminated P/T was purified by centrifugation through a P-30 column, phenolchloroform extraction, and ethanol precipitation and resuspended in buffer containing 10 mM Na-HEPES (pH 7.4) and 60 mM KCl. Chain termination was 90 to 94% complete based on primer extension experiments. Excision rescue experiments were initiated by adding WT or mutant RT (110 to 250 nM) to a mixture containing 5 nM 5=-32PL33-AZT primer annealed to unlabeled R52 or D50 template in RB-10 buffer with the four dNTPs at 10 ␮M (each) and 3.2 mM ATP or 15 or 50 ␮M pyrophosphate (PPi) in a final volume of 10 ␮l. The ATP and dNTPs were purchased from GE Healthcare and treated with thermostable pyrophosphatase (Roche Applied Science) as previously described (37). The reaction mixtures were incubated at 37°C for various times (1 to 30 min) and terminated by heating at 90°C for 4 min. An equal volume of 2⫻ urea-TTE loading buffer (16 M urea, 180 mM Tris, 58 mM taurine, 1 mM EDTA, 0.5% bromphenol blue, 0.5% xylene cyanol) was added, and the primer extension products were separated from unextended primer by electrophoresis on 10% polyacrylamide denaturing gels containing 8 M urea. The amount of radioactivity in extended primer was determined on a dried gel with a PhosphorImager (Molecular Dynamics Storm 840) and expressed as a percentage of the total labeled primer detected in the gel. Results are presented without correction for primer extension that occurred in the absence of added ATP or PPi (6 to 10%). Results of repeated experiments were averaged after normalization to the percent extended primer formed in the same experiment by RTWT after 15 min of incubation. Detection and quantification of RNase H cleavage products. 5=-32Plabeled R52 template (12 pmol) was annealed with 24 pmol of unlabeled L33 or D19 primer and incubated with 10 ␮M AZTTP, 125 nM RTM41L/T215Y/E478Q, and 20 U of RNasin-Plus in RB-10 buffer in a total volume of 150 ␮l for 1 h at 37°C. Unincorporated AZTTP was removed by passage through a P-30 spin column. AZTMP-terminated P/T was isolated by phenol-chloroform extraction and ethanol precipitation and resuspended in buffer containing 10 mM Na-HEPES (pH 7.4) and 60 mM KCl. Aliquots of labeled template-primer were incubated with WT or mutant RTs in RB-10 buffer containing 20 U of RNasin-Plus (final volume, 10 ␮l) for various times (5 to 30 min), and the reactions were terminated by heating for 4 min at 90°C and the addition of an equal volume of 2⫻ urea-TTE loading buffer. The RNase H cleavage products were fractionated by electrophoresis on 10% polyacrylamide denaturing gels, and degradation products were quantified by PhosphorImager and expressed as a percentage of the total RNA template. Detection of primer-bound and released RNase H cleavage fragments. 5=-32P-labeled R52 template (12 pmol) was annealed with 24 pmol of unlabeled 5=-biotinylated L33 oligonucleotide and terminated with AZTMP as described above. After purification by P-30 spin columns, phenol-chloroform extraction, and ethanol precipitation, the AZT-terminated, biotinylated P/T was resuspended at a concentration of 100 nM and incubated with streptavidin (SA)-conjugated magnetic beads (Dynabeads M-280 SA; Invitrogen) (30 ␮g of SA-beads, 0.1 pmol of biotinylated primer) for 30 min at room temperature. The indicated mutant RT (110 to 250 nM) was added, and the suspension was incubated as described for RNase H cleavage assays. At the time points indicated, free and SA-bound fractions were separated using a magnet. Samples were diluted with an equal volume of 2⫻ urea-TTE loading buffer and heated for 4 min at 90°C, and free and SA-bound RNase H cleavage products were fractionated by gel electrophoresis and detected as described above.

jvi.asm.org 5123

Acosta-Hoyos et al.

RESULTS

Effect of the M184V mutation on ATP-mediated excision of AZTMP from a chain-terminated primer. Excision rescue of a 5=-32P-labeled AZTMP-terminated DNA primer was evaluated by primer extension assays carried out in the presence of WT or mutant RT, ATP as the excision acceptor substrate, and all four dNTPs. Transfer of the chain-terminating AZTMP to ATP by the excision activity of RT produces an unblocked primer that is extended by the DNA-polymerizing activity of RT. Figure 1 shows the rescue of AZTMP-terminated primer by WT and mutant RTs carried out with DNA template (Fig. 1A, B, E, and F) or with RNA template (Fig. 1C, D, E, and G). As previously reported (35), excision activity was substantially increased in RT containing the M41L and T215Y mutations (RTM41L/T215Y) in comparison with RTWT. The increases were similar for RNA and DNA templates. Addition of the M184V mutation to an M41L/T215Y background (RTM41L/M184V/T215Y) had a variable effect on excision when tested on a DNA template (Fig. 1A and B). In some experiments, the M184V mutation suppressed primer rescue by as much as 25%, and in other experiments, the reduction was less than 10% (the error bars reflect this variability). On an RNA template, the addition of M184V to an M41L/T215Y background consistently reduced primer rescue by 50 to 60% (Fig. 1C and D). To determine whether the RNase H activity of RT was responsible for the difference seen with RNA or DNA templates, the E478Q mutation was introduced into these enzymes (RTM41L/T215Y/E478Q and RTM41L/M184V/T215Y/E478Q). The E478Q mutation knocks out RNase H catalytic activity in HIV-1 RT. When E478Q was present, the M184V mutation failed to significantly reduce excision rescue on either a DNA or an RNA template (Fig. 1E, F, and G). For a quantitative summary of multiple experiments, see Fig. 6A. These results suggest that a major portion of the effect of M184V on excision is dependent on the RNase H activity of RT. Dependence of AZTMP excision on RT concentration. Rates of excision with different concentrations of the mutant RTs were compared (Fig. 2). With all four mutant RTs, the excision reaction approached saturation at 200 nM RT. On an RNA template, excision rescue was reduced 60 to 70% when M184V was present, with little dependence on the RT concentration (Fig. 2A and C). On a DNA template, excision rescue was reduced 25 to 30% when M184V was present over the same range of RT concentrations (Fig. 2B). In contrast, when E478Q was present, M184V enhanced the rate of excision on both RNA and DNA templates at low RT concentrations. At higher RT concentrations, M184V stimulated excision on a DNA template but not on an RNA template (Fig. 2D and E). Since our assays measure excision as a single-turnover reaction, which is approximately linear for 15 min, the initial rates of excision were estimated from the percentage of primer rescue observed after 15 min of incubation. The excision rate data as a function of the RT concentration were fitted to a hyperbolic equation to determine the apparent KD and maximum rate of excision (kexcis) at saturating RT and physiological ATP concentrations (Table 1). Addition of M184V to RTM41L/T215Y increased the apparent KD from 23 to 93 nM on an RNA template. The effect was much smaller on a DNA template (21 nM without M184V compared with 29 nM when the M184V mutation was present). A reduction of kexcis was observed on both DNA and RNA templates when M184V was present. When M184V was added to RT lacking

5124

jvi.asm.org

RNase H activity (RTM41L/T215Y/E478Q), the KD was decreased to a similar extent on either an RNA or a DNA template and there was no significant effect of M184V on kexcis on either template. RNase H cleavage and P/T dissociation after cleavage. RNA template (R52) was labeled with 32P and annealed to primer L33AZT or D19-AZT (shown at the top of Fig. 3A), and RNase H cleavage products were monitored by gel electrophoresis (Fig. 3A). We observed major cleavage sites at ⫺12 and ⫺7 for P/T L33-AZT/R52 and at ⫺18 and ⫺8 for P/T D19-AZT/R52. Nucleotide numbering is given relative to the primer terminus, which is designated ⫺1. In both sequence contexts, RT that contained the M184V mutation showed enhanced secondary-site cleavage. The product of cleavage at ⫺7 predominated after 5 min of incubation. For quantification of the ⫺7 cleavage products formed after 15 min of incubation with the L33-AZT primer and the R52 template, see Fig. 6B. To determine whether the RNase H cleavages observed in these experiments resulted in P/T dissociation, a biotin-labeled, AZTterminated primer (biotin-L33) was annealed to 5=-32P-labeled R52 template (shown at the top of Fig. 3B), and SA-conjugated magnetic beads were used to separate RNase H cleavage products that remained associated with the primer from those that were released during incubation (Fig. 3B). The results show that ⫺12 cleavage products remained associated with the primer but ⫺7 cleavage products were quantitatively released. DNA-RNA duplexes with less than 10 bp have a reduced ability to support either polymerization or ATP-dependent excision, presumably due to the instability of the duplex structure (16, 46). Addition of M184V to the RTM41L/T215Y background enhanced the release of ⫺7 cleavage products, indicating that the remaining DNA-RNA P/T duplex was unstable. Similar effects of the M184V mutation were observed for ddAMP-terminated primer annealed to R52 template and for ddAMP-terminated P/T with an unrelated sequence (data not shown). These results suggest that cleavages within 7 bp of the primer terminus are enhanced when the M184V mutation is present, giving rise to increased P/T dissociation. RNase H cleavage patterns in the presence of a trap. To evaluate the role of the initial RT binding sites in determining the RNase H cleavage events, mutant RTs with or without the M184V mutation were preincubated with a 5=-labeled RNA template annealed to an unlabeled, AZTMP-terminated DNA primer in the absence of MgCl2. After 5 min of preincubation, 15 mM MgCl2 and an excess of poly(rA)-oligo(dT) were added to the mixture and the incubation was continued. Samples were taken after various times of additional incubation, and RNase H cleavage products were fractionated by electrophoresis (Fig. 4A). For both RTM41L/T215Y and RTM41L/M184V/T215Y, the predominant cleavage products corresponded to RNase H cleavage at positions ⫺17 and ⫺12, but cleavage at ⫺7 was not observed, even after 30 min of incubation. Cleavage at ⫺17 occurred more rapidly than that at ⫺12. After 30 min, 70 to 90% of the uncleaved template was depleted, indicating that most of the P/T was saturated with RT during the preincubation and that binding of RT usually led to cleavage prior to dissociation. These results indicate that RT binds predominantly at two alternative positions on this P/T. Binding in the upstream position placed the RNase H active-site residues at the primary RNA cleavage site (leading to ⫺17 cleavage). Binding at the downstream position placed the RNase H active-site residues at a secondary cleavage site (leading to ⫺12 cleavage). RTM41L/T215Y favored ⫺17

Journal of Virology


FIG 1 Effects of RT mutations on rescue of AZTMP-terminated primer annealed to RNA or DNA templates. Excess DNA (D50) or RNA (R52) template was annealed to 5=-32P-labeled L33 and terminated with AZTMP. P/T at 5 nM was incubated with different RTs as indicated in panels A, C, and E for 5, 10, 15, or 30 min in the presence of 3.2 mM ATP and 10 ␮M dNTPs. Controls without RT (No RT) or with RT and dNTPs but no ATP (No ATP) were incubated for 30 min. Reaction products were fractionated by electrophoresis on 10% denaturing polyacrylamide gels. The positions of the unextended primer (Primer) and primer extension products (Extended primer) are indicated on the right. (B, D, F, and G) The full-length extended primer was quantified using a PhosphorImager and expressed as a ratio to extended product formed in 15 min by RTWT-BH10. Values shown are the mean and standard deviation of two or more experiments. wt, wild type.


jvi.asm.org 5125

Acosta-Hoyos et al.

FIG 2 Effect of RT concentration on rescue of AZTMP-terminated primer annealed to RNA or DNA template. Experiments were carried out as described in the legend to Fig. 1, except that the RT concentrations were 5, 25, 50, 100, and 200 nM and incubation was for 15 min. (A) Representative autoradiogram of rescue of AZTMP-terminated primer annealed to RNA template by mutant RTs as indicated. Reaction mixtures were fractionated by electrophoresis on 10% denaturing polyacrylamide gels. The positions of the unextended primer (Primer) and primer extension products (Extended primer) are indicated to the right. Excess DNA template (B and D) or RNA template (C and E) was annealed to 5=-32P-labeled L33 and terminated with AZTMP. P/T at 5 nM was incubated with different RTs as indicated for 15 min in the presence of 3.2 mM ATP and 10 ␮M dNTPs. The percentage of the primer that was extended (percent rescue) was determined using a PhosphorImager. Values are the mean of two or more experiments ⫾ the standard deviation. Where error bars are not visible, they are hidden by the data symbols. The apparent KD for the RT-P/T interaction and the apparent kexcis for the maximum rate of excision at a saturating RT concentration and a physiological ATP concentration are given in Table 1.

cleavage, whereas RTM41L/M184V/T215Y slightly favored the ⫺12 cleavage site. Figure 4B indicates that about 23% of the initial binding by RTM41L/T215Y occurs at the ⫺12 cleavage site, whereas greater than 40% of the initial binding by RTM41L/M184V/T215Y occurs at this site. Neither enzyme was initially bound in a position that allowed cleavage at ⫺7 to occur, despite the fact that incuba-

5126

jvi.asm.org

tion in the absence of a trap resulted in most of the template being cleaved at ⫺7 after 30 min. This agrees with results previously reported by Brehm et al. (11) and suggests that RT dissociates after cleavage at the initial binding site and rebinds at the downstream site on the P/T, leading to cleavage near the primer terminus and P/T dissociation.

Journal of Virology


TABLE 1 Kinetic parameters of mutant RT and template/primera DNA template

RNA template ⫺1

RT mutations

KD (nM)

kexcis (min )

KD (nM)

kexcis (min⫺1)

M41L/T215Y M41L/M184V/T215Y M41L/T215Y/E478Q M41L/M184V/T215Y/E478Q

21.4 ⫾ 5.7 29.0 ⫾ 9.1 16.0 ⫾ 4.1 3.3 ⫾ 1.0

0.17 ⫾ 0.02 0.13 ⫾ 0.02 0.12 ⫾ 0.01 0.12 ⫾ 0.01

23.0 ⫾ 12.9 93.3 ⫾ 35.2 19.2 ⫾ 3.3 3.2 ⫾ 0.4

0.07 ⫾ 0.01 0.04 ⫾ 0.01 0.13 ⫾ 0.01 0.12 ⫾ 0.00

Apparent binding constants (KD) were determined by fitting the observed percent rescue plots (Fig. 2) to the following equation: product ⫽ kexcis ⫻ [RT]/(KD ⫹ [RT]). The values shown are means ⫾ standard deviations of two or three experiments.

a

FIG 3 Effect of the M184V mutation in the M41L/T215Y background on the formation and release of RNase H cleavage products. (A) Excess unlabeled L33 or D19 was annealed to 5=-32P-labeled R52, terminated with AZTMP, and incubated with the indicated mutant RTs for 5, 10, 15 or 30 min. Major RNase H cleavage positions (measured from the primer terminal AZT) are shown at the top and on the left (for L33-AZT P/T) and right (for D19-AZT P/T) of the gel. (B) Biotinylated L33 was annealed to 5=-32Plabeled R52, terminated with AZTMP, and incubated with the indicated mutant RTs in the presence of SA-tagged magnetic beads. At 5, 10, 15, or 30 min, SA-bound and unbound (free) fractions were separated with a magnet. Samples were fractionated by electrophoresis on 10% denaturing polyacrylamide gels.


Additional experiments were carried out to evaluate the effect of M184V on the dissociation of RT from the initial binding sites (Fig. 4C). RTM41L/T215Y and RTM41L/M184V/T215Y were preincubated with labeled, AZT-terminated P/T in the absence of MgCl2, and various concentrations of unlabeled, AZT-terminated P/T (trap) were added to the reaction mixture together with 15 mM MgCl2 to initiate RNase H activity. Unlabeled P/T competed with labeled P/T for binding of RT after its dissociation from the initial binding site, leading to reduced ⫺7 cleavage and protection of the ⫺17 product from secondary-site cleavage. When the M184V mutation was present, higher concentrations of the trap were required to inhibit ⫺7 cleavage and stabilize the ⫺17 cleavage product, suggesting that dissociation of the initially bound RT from the labeled P/T was enhanced by the M184V mutation. Effect of the M184V mutation on ATP-mediated excision rescue and RNase H cleavage in a D67N/K70R/T215F/K219Q background. RTD67N/K70R/T215F/K219Q supports a high level of excision. The addition of M184V to these mutations reduced primer rescue by 30 to 60% when tested on an RNA template (Fig. 5B) but did not reach the level of significance when tested on a DNA template (Fig. 5A). Quantitative comparisons after 15 min of incubation are shown in Fig. 6A (expressed as the amount of extended primer relative to RTWT). A similar effect of M184V was observed in either the RTM41L/T215Y or the RTD67N/K70R/T215F/K219Q background. Figure 5C shows the formation of ⫺7 cleavage products on L33AZTMP/R52 P/T as a function of time of incubation, and a quantitative comparison after 15 min of incubation is summarized in Fig. 6B. The addition of M184V to the RTD67N/K70R/T215F/K219Q background resulted in an about 2-fold increase in the formation of the ⫺7 cleavage product, which is less than the 5-fold increase seen after the addition of M184V to the RTM41L/T215Y background. Both results are consistent with a major role for increased cleavage at ⫺7 in the RNA template in M184V suppression of AZT resistance. Effect of M184V on excision mediated by PPi. The results presented above suggest an indirect mechanism for M184V suppression of TAMs leading to the prediction that the reduced primer rescue may be independent of excision acceptor substrate. Figure 7 shows that the addition of M184V to an RTD67N/K70R/T215F/K219Q background reduced excision rescue mediated by 15 ␮M PPi by 36 to 43% on an RNA template (Fig. 7B) and had little effect when a DNA template was used (Fig. 7A). The rate of excision was greater when 50 ␮M PPi was provided as the acceptor substrate, but the effect of M184V was similar (51 to 54% reduced rescue after 5 to 10 min) (Fig. 7C). The effect of M184V on primer rescue was quantitatively similar with ATP as the acceptor substrate in this TAM background (46% reduction, Fig. 6A). PPi-

jvi.asm.org 5127

Acosta-Hoyos et al.

FIG 4 Effect of the M184V mutation on initial binding and RNase H cleavages in the presence of a trap. The 5=-32P-labeled R52 template was annealed with the L33 primer and terminated with AZTMP. Mutant RTs (200 nM) were preincubated for 5 min with 5 nM labeled, AZTMP-terminated P/T in the presence of 5 mM EDTA. (A) MgCl2 at 15 mM and excess poly(rA)-oligo(dT) were added, and incubation was continued for 5, 10, 15, or 30 min. Reaction products were fractionated by electrophoresis on 10% polyacrylamide gels. Major RNase H cleavage products are indicated at the right. Controls without MgCl2 addition (No Mg2⫹), without poly(rA)-oligo(dT) addition (No trap), or with poly(rA)-oligo(dT) added during preincubation for 5 min in the absence of P/T (Pre trap) are indicated at the top. Controls were incubated for 30 min. (B) The ⫺12 cleavage product in panel A was quantified as a percentage of the total radioactivity in each lane and plotted against the time of incubation. The mean ⫾ standard deviation of two independent experiments is shown. (C) 5=-32P-labeled R52 template annealed to unlabeled L33 primer, terminated with AZTMP, and preincubated as described above. Unlabeled L33-AZTMP/R52 P/T trap (1, 5, 50, 100, 200, and 600 nM) was added together with15 mM MgCl2. After 15 min of further incubation, the reaction products were fractionated by electrophoresis as described above. Controls without L33-AZTMP/R52 ((⫺) Trap) are indicated.

mediated excision was also reduced by the addition of M184V to an RTM41L/T215Y background (data not shown). No reduction was seen when the E478Q RNase H-negative mutation was also present.

5128

jvi.asm.org

FIG 5 Effect of the M184V mutation in a D67N/K70R/T215F/K219Q background on rescue of AZTMP-terminated primer and formation of ⫺7 RNase H cleavage product. (A) DNA (D50) or (B) RNA (R52) template was annealed to 5=-32P-labeled L33 primer, terminated with AZTMP, and incubated with mutant RTs as indicated. The extended product is expressed as a ratio of the extended products formed in 15 min by RTWT-BH10 as described in the legend to Fig. 1. (C) Unlabeled L33 primer was annealed with 5=-32P-labeled R52, terminated with AZTMP, and incubated with mutant RTs. Products of template cleavage at position ⫺7 were detected as described in the legend to Fig. 3 and expressed as a percentage of the total radioactivity in the lane.

Journal of Virology


FIG 6 Rescue of AZTMP-terminated primers and RNase H cleavage at position ⫺7 by WT or mutant RT. (A) Primer rescue determined after 15 min of incubation with 3.2 mM ATP for WT and mutant RTs on DNA or RNA templates as described in the legend to Fig. 1. (B) Formation of ⫺7 cleavage product after 15 min of incubation with labeled RNA template for WT and mutant RTs as described in the legend to Fig. 3. All values are expressed relative to that obtained with RTWT-BH10. The mean for two or three experiments ⫾ the standard deviation is shown.

Effect of K65R on excision rescue and formation of RNase H cleavage products. K65R is also a suppressor of AZT resistance by TAMs (6, 36, 43, 59), and AZTMP excision activity is reduced in RTs containing this mutation (21, 36, 59). In contrast to the results obtained with M184V, the addition of K65R to the RTD67N/K70R/T215Y/K219Q background reduced AZTMP excision activity to similar extents on both DNA (Fig. 8A) and RNA templates (Fig. 8B). Quantitative comparison of excision after incubation for 15 min is summarized in Fig. 8D. The RNase H cleavage pattern was not significantly different for RTD67N/K70R/T215Y/K219Q with or without K65R (Fig. 8C). These results suggest that the mechanisms of suppression of excision rescue are different for K65R and M184V.


FIG 7 Effect of M184V on rescue of AZTMP-terminated primer using PPi as the excision acceptor substrate. (A) A DNA (D50) or (B) RNA (R52) template was annealed to 5=-32P-labeled L33, terminated with AZTMP, and incubated with WT or mutant RTs as indicated for 5, 10, 15, and 30 min in the presence of 15 ␮M PPi and 10 ␮M dNTPs. Radioactivity was quantified using a PhosphorImager and expressed as a percentage of that of the primer that was extended (percent rescue). (C) Same as panel B, except that incubation was for 1, 3, 5, or 10 min in the presence of 50 ␮M PPi and 10 ␮M dNTPs.

jvi.asm.org 5129

Acosta-Hoyos et al.

FIG 8 Effect of the K65R mutation in a D67N/K70R/T215Y/K219Q background on rescue of AZTMP-terminated primer and formation of RNase H cleavage products. (A) A DNA (D50) or (B) RNA (R52) template was annealed to 5=-32P-labeled L33, terminated with AZTMP, and incubated with mutant RTs as indicated. The extended product is expressed as a ratio of the extended products formed in 15 min by RTWT-LAI. (C) Unlabeled L33 was annealed with 5=-32P-labeled R52, terminated with AZTMP, and incubated with indicated mutant RTs, and reaction products were analyzed as described in the legend to Fig. 3. Major cleavage products are indicated at the left. (D) Ratios of the extended products formed in 15 min of incubation by mutant RTs to the products formed by RTWT-LAI. Bars indicate the average of two experiments ⫾ the standard deviation.

DISCUSSION

Enhanced AZTMP excision by RTs containing two to four TAMs was suppressed by the M184V mutation as previously reported. We show that M184V suppression was greater when DNA synthesis occurred on an RNA template than when it occurred on a DNA template. The excision activity was reduced to a similar extent when measured with either ATP or PPi as the acceptor substrate. While total RNase H activity, as measured by disappearance of the full-length template, was not significantly altered by the M184V mutation (in agreement with reference 62, we show that in the presence of TAMs, M184V selectively enhanced cleavage at a downstream RNase H cleavage site near the primer terminus (position ⫺7 on the template). This cleavage leads to P/T dissociation. Trap experiments that detect only cleavage at the initial binding sites indicated that RT first bound and cleaved at ⫺17 or ⫺12 and then dissociated and rebound at the downstream site to produce ⫺7 cleavage products. Our results suggest that the M184V mutation enhances dissociation from the initial binding sites, resulting in increased downstream binding. Previous studies have shown that M184V added to a TAM background reduced excision on RNA templates (32, 48, 58, 62)

5130

jvi.asm.org

and DNA templates (9, 21, 22, 27, 38, 49, 62) by 16 to 58%, though no decrease was detected in one study (39). We found the effect on a DNA template to be variable, ranging from no effect to a 34% decrease. We observed a consistently greater reduction in excision with an RNA template than with a DNA template with the same sequence. This difference was dependent on the RNase H activity of RT. Enhanced cleavage at position ⫺7 on the template due to the presence of the M184V mutation leads to P/T dissociation and would account for reduced excision. Delviks-Frankenberry et al. (13) have shown that several connection domain mutations, including G335C/D, N348I, A360I/N, V365I, and A376S, obtained from treatment-experienced HIV-1infected patients increased AZT resistance in the context of TAMs. These connection domain mutations also produced significantly lower RNase H activity and greater AZTMP excision on an RNA template than on a DNA template. These authors proposed that a balance exists between the RNase H and excision activities of HIV-1 RT that is disrupted by these mutations (13, 14, 41, 42). Reduced RNase H cleavage indirectly enhances AZTMP excision by increasing the time during which excision can occur before RNase H cleavage reduces the length of the P/T duplex to the point

Journal of Virology


FIG 9 Model of increased RNase H secondary cleavage by M184V and inhibition of excision. Addition of M184V to a TAM background reduces the binding affinity of RT at the AZTMP termination site (Z) on the P/T and stimulates RT release after cleavage of the template at a site (⫺17) directed by the initial binding position. This leads to increased rebinding and RNase H cleavage at secondary positions. RNase H cleavage near the primer terminus (⫺7) results in P/T dissociation, which reduces the opportunity for excision to occur.

where it dissociates. The stimulation of excision activity was observed for either ATP or PPi as the acceptor substrate (13, 16, 58), which is consistent with the indirect mechanism proposed. Considerable experimental support for this mechanism has been reported (11, 13, 16, 17, 42, 46–48, 61). The model also predicts that mutations that enhance RNA cleavage will decrease excision activity. This prediction is supported by our results showing that enhanced ⫺7 cleavage by RT due to M184V is correlated with decreased excision activity. One additional prediction of the model is that connection domain mutations such as N348I, which reduce secondary-site RNase H cleavage, may compensate for the reduced excision caused by M184V. Compensation was not observed in two studies (41, 61), but partial compensation was observed in two other studies (48, 58). We show that M184V strongly enhances ⫺7 cleavage when present in a background of TAMs; however, the effect is much less in the absence of TAMs, as has also been reported by other laboratories (24, 26, 58, 62). The binding affinity of RT for P/T is driven primarily by residues near the primer terminus causing RT to bind preferentially in the polymerase mode (16). RTs containing the M184V or M184I mutation are known to have reduced processivity for DNA synthesis (3–5, 8, 23, 54), and the RT-dNTP-P/T ternary complexes formed by these mutant RTs have decreased stability (18, 24; Acosta-Hoyos, unpublished data), suggesting that RTs containing M184V or M184I are bound more weakly and dissociate more readily from the P/T. Increased dissociation of the mutant RT from its initial binding sites would increase the likelihood of rebinding at secondary cleavage sites, thereby increasing the rate of cleavage at these sites. We show that initial binding of TAM-containing RTs with or without M184V occurs at the primer terminus, leading to ⫺17 cleavage, and at a secondary site five nucleotides downstream, leading to ⫺12 cleavage. Initial binding is shifted to favor the ⫺12 cleavage position by addition of M184V, which is consistent with reduced affinity at the primer terminus due to this mutation. Our results (Fig. 4A) and those of Brehm et al. (11) show that cleavage within 10 nt of the primer terminus occurs only after RT has first bound and cleaved at an initial upstream binding site. The mechanism of this sequential pattern of cleavage is not clear, but it may help RT avoid cleavage events that would lead to P/T dissociation during ongoing DNA synthesis


(45). A model of reduced excision due to the M184V mutation is shown in Fig. 9. Other mutations in HIV-1 RT are known to reduce excision activity and suppress the AZT-resistant phenotype of TAMs (reviewed in reference 1). One of these is K65R, which affects interactions with the phosphate chain of the incoming dNTP. In this report, we show that addition of K65R to a TAM background reduced excision activity to similar extents on DNA and RNA templates. We found no evidence of an RNase H-dependent component for K65R suppression and conclude that the mechanism of suppression by this mutation is distinct from that of M184V. Other known TAM suppressors include the L74V and Y181C mutations. Radzio et al. (48) have shown an increase in ⫺10 site RNase H cleavage when Y181C is added to an N348I background. Parallel experiments did not show a similar effect of L74V on ⫺10 cleavage. The ability of the M184V mutation to increase the sensitivity of HIV-1 to nucleoside RT inhibitors has played an important role in antiretroviral therapy for at least 15 years due to the extensive therapeutic use of 3TC or FTC together with thymidine analogue nucleoside RT inhibitors. Our studies contribute to the understanding of the biochemical mechanisms that underlie the ability of this mutation to suppress resistance to AZT and other nucleosides. These insights may lead to the improvement of familiar antiviral therapies and the development of new therapeutic strategies. ACKNOWLEDGMENTS This work was supported by NIH grant AI-39973 (W.A.S.), the University of Miami Developmental Center for AIDS Research (5P30-AI-073961), and fellowships from the American Heart Association (0615079B to A.J.A.-H.) and amfAR (70567-31-RF to P.R.M.).

REFERENCES 1. Acosta-Hoyos AJ, Scott WA. 2010. The role of nucleotide excision by reverse transcriptase in HIV drug resistance. Viruses 2:372–394. 2. Arion D, Kaushik N, McCormick S, Borkow G, Parniak MA. 1998. Phenotypic mechanism of HIV-1 resistance to 3=-azido-3=deoxythymidine (AZT): increased polymerization processivity and enhanced sensitivity to pyrophosphate of the mutant viral reverse transcriptase. Biochemistry 37:15908 –15917. 3. Avidan O, Hizi A. 1998. The processivity of DNA synthesis exhibited by

jvi.asm.org 5131

Acosta-Hoyos et al.

4.

5. 6.

7.

8. 9. 10.

11.

12.

13. 14. 15. 16.

17. 18. 19. 20. 21. 22.

23.

24.

drug-resistant variants of human immunodeficiency virus type-1 reverse transcriptase. Nucleic Acids Res. 26:1713–1717. Back NKT, Berkhout B. 1997. Limiting deoxynucleoside triphosphate concentrations emphasize the processivity defect of lamivudine-resistant variants of human immunodeficiency virus type 1 reverse transcriptase. Antimicrob. Agents Chemother. 41:2484 –2491. Back NKT, et al. 1996. Reduced replication of 3TC-resistant HIV-1 variants in primary cells due to a processivity defect of the reverse transcriptase enzyme. EMBO J. 15:4040 – 4049. Bazmi HZ, et al. 2000. In vitro selection of mutations in the human immunodeficiency virus type 1 reverse transcriptase that decrease susceptibility to (⫺)-␤-D-dioxolane-guanosine and suppress resistance to 3=azido-3=-deoxythymidine. Antimicrob. Agents Chemother. 44:1783– 1788. Boucher CAB, et al. 1993. High-level resistance to (⫺) enantiomeric 2=-deoxy-3=-thiacytidine in vitro is due to one amino acid substitution in the catalytic site of human immunodeficiency virus type 1 reverse transcriptase. Antimicrob. Agents Chemother. 37:2231–2234. Boyer PL, Hughes SH. 1995. Analysis of mutations at position 184 in reverse transcriptase of human immunodeficiency virus type 1. Antimicrob. Agents Chemother. 39:1624 –1628. Boyer PL, Sarafianos SG, Arnold E, Hughes SH. 2001. Selective excision of AZTMP by drug-resistant human immunodeficiency virus reverse transcriptase. J. Virol. 75:4832– 4842. Boyer PL, Sarafianos SG, Arnold E, Hughes SH. 2002. The M184V mutation reduces the selective excision of zidovudine 5=-monophosphate (AZTMP) by the reverse transcriptase of human immunodeficiency virus type 1. J. Virol. 76:3248 –3256. Brehm JH, Mellors JW, Sluis-Cremer N. 2008. Mechanism by which a glutamine to leucine substitution at residue 509 in the ribonuclease H domain of HIV-1 reverse transcriptase confers zidovudine resistance. Biochemistry 47:14020 –14027. D’Aquila RT, Summers WC. 1989. HIV-1 reverse transcriptase/ ribonuclease H: high level expression in Escherichia coli from a plasmid constructed using the polymerase chain reaction. J. Acquir. Immune Defic. Syndr. 2:579 –587. Delviks-Frankenberry KA, et al. 2008. HIV-1 reverse transcriptase connection subdomain mutations reduce template RNA degradation and enhance AZT excision. Proc. Natl. Acad. Sci. U. S. A. 105:10943–10948. Delviks-Frankenberry KA, Nikolenko GN, Pathak VK. 2010. The “connection” between HIV drug resistance and RNase H. Viruses 2:1476 – 1503. Deval J, et al. 2004. Mechanistic basis for reduced viral and enzymatic fitness of HIV-1 reverse transcriptase containing both K65R and M184V mutations. J. Biol. Chem. 279:509 –516. Ehteshami M, et al. 2008. Connection domain mutations N348I and A360V in HIV-1 reverse transcriptase enhance resistance to 3=-azido-3=deoxythymidine through both RNase H-dependent and -independent mechanisms. J. Biol. Chem. 283:22222–22232. Ehteshami M, Götte M. 2008. Effects of mutations in the connection and RNase H domains of HIV-1 reverse transcriptase on drug susceptibility. AIDS Rev. 10:224 –235. Ehteshami M, et al. 2008. Mutations M184V and Y115F in HIV-1 reverse transcriptase discriminate against “nucleotide-competing reverse transcriptase inhibitors.” J. Biol. Chem. 283:29904 –29911. Eron JJ, et al. 1995. Treatment with lamivudine, zidovudine, or both in HIV-positive patients with 200 to 500 CD4⫹ cells per cubic millimeter. N. Engl. J. Med. 333:1662–1669. Feng JY, Anderson KS. 1999. Mechanistic studies examining the efficiency and fidelity of DNA synthesis by the 3TC-resistant mutant (184V) of HIV-1 reverse transcriptase. Biochemistry 38:9440 –9448. Frankel FA, Invernizzi CF, Oliveira M, Wainberg MA. 2007. Diminished efficiency of HIV-1 reverse transcriptase containing the K65R and M184V drug resistance mutations. AIDS 21:665– 675. Frankel FA, Marchand B, Turner D, Götte M, Wainberg MA. 2005. Impaired rescue of chain-terminated DNA synthesis associated with the L74V mutation in human immunodeficiency virus type 1 reverse transcriptase. Antimicrob. Agents Chemother. 49:2657–2664. Gao H-Q, Boyer PL, Arnold E, Hughes SH. 1998. Effects of mutations in the polymerase domain on the polymerase, RNase H and strand transfer activities of human immunodeficiency virus type 1 reverse transcriptase. J. Mol. Biol. 277:559 –572. Gao H-Q, Boyer PL, Sarafianos SG, Arnold E, Hughes SH. 2000. The

5132

jvi.asm.org

25.

26.

27.

28. 29. 30. 31. 32.

33. 34. 35.

36.

37.

38.

39.

40. 41. 42. 43.

44. 45.

role of steric hindrance in 3TC resistance of human immunodeficiency virus type-1 reverse transcriptase. J. Mol. Biol. 300:403– 418. Gao Q, et al. 1993. The same mutation that encodes low-level human immunodeficiency virus type 1 resistance to 2=,3=-dideoxyinosine and 2=,3=-dideoxycytidine confers high-level resistance to the (⫺) enantiomer of 2=,3=-dideoxy-3=-thiacytidine. Antimicrob. Agents Chemother. 37: 1390 –1392. Gao L, et al. 2008. Apparent defects in processive DNA synthesis, strand transfer, and primer elongation of Met-184 mutants of HIV-1 reverse transcriptase derive solely from a dNTP utilization defect. J. Biol. Chem. 283:9196 –9205. Götte M, Arion D, Parniak MA, Wainberg MA. 2000. The M184V mutation in the reverse transcriptase of human immunodeficiency virus type 1 impairs rescue of chain-terminated DNA synthesis. J. Virol. 74: 3579 –3585. Huang H, Chopra R, Verdine GL, Harrison SC. 1998. Structure of a covalently trapped catalytic complex of HIV-1 reverse transcriptase: implications for drug resistance. Science 282:1669 –1675. Jamburuthugoda VK, et al. 2008. Reduced dNTP binding affinity of 3TC-resistant M184I HIV-1 reverse transcriptase variants responsible for viral infection failure in macrophage. J. Biol. Chem. 283:9206 –9216. Larder BA, Kemp SD, Harrigan PR. 1995. Potential mechanism for sustained antiretroviral efficacy of AZT-3TC combination therapy. Science 269:696 – 699. Larder BA, Purifoy DJM, Powell KL, Darby G. 1987. Site-specific mutagenesis of AIDS virus reverse transcriptase. Nature 327:716 –717. Lennerstrand J, Hertogs K, Stammers DK, Larder BA. 2001. Correlation between viral resistance to zidovudine and resistance at the reverse transcriptase level for a panel of human immunodeficiency virus type 1 mutants. J. Virol. 75:7202–7205. Meyer PR, Matsuura SE, Mian AM, So AG, Scott WA. 1999. A mechanism of AZT resistance: an increase in nucleotide-dependent primer unblocking by mutant HIV-1 reverse transcriptase. Mol. Cell 4:35– 43. Meyer PR, Matsuura SE, So AG, Scott WA. 1998. Unblocking of chainterminated primer by HIV-1 reverse transcriptase through a nucleotidedependent mechanism. Proc. Natl. Acad. Sci. U. S. A. 95:13471–13476. Meyer PR, et al. 2002. Effects of specific zidovudine resistance mutations and substrate structure on nucleotide-dependent primer unblocking by human immunodeficiency virus type 1 reverse transcriptase. Antimicrob. Agents Chemother. 46:1540 –1545. Meyer PR, et al. 2003. Relationship between 3=-azido-3=-deoxythymidine resistance and primer unblocking activity in foscarnet-resistant mutants of human immunodeficiency virus type 1 reverse transcriptase. J. Virol. 77:6127– 6137. Meyer PR, Smith AJ, Matsuura SE, Scott WA. 2004. Effects of primertemplate sequence on ATP-dependent removal of chain-terminating nucleotide analogues by HIV-1 reverse transcriptase. J. Biol. Chem. 279: 45389 – 45398. Miranda LR, Götte M, Liang F, Kuritzkes DR. 2005. The L74V mutation in human immunodeficiency virus type 1 reverse transcriptase counteracts enhanced excision of zidovudine monophosphate associated with thymidine analog resistance mutations. Antimicrob. Agents Chemother. 49:2648 –2656. Naeger LK, Margot NA, Miller MD. 2001. Increased drug susceptibility of HIV-1 reverse transcriptase mutants containing M184V and zidovudine-associated mutations: analysis of enzyme processivity, chainterminator removal and viral replication. Antivir. Ther. 6:115–126. Nijhuis M, et al. 1997. Lamivudine-resistant human immunodeficiency virus type 1 variants (184V) require multiple amino acid changes to become co-resistant to zidovudine in vivo. J. Infect. Dis. 176:398 – 405. Nikolenko GN, et al. 2007. Mutations in the connection domain of HIV-1 reverse transcriptase increase 3=-azido-3=-deoxythymidine resistance. Proc. Natl. Acad. Sci. U. S. A. 104:317–322. Nikolenko GN, et al. 2005. Mechanism for nucleoside analog-mediated abrogation of HIV-1 replication: balance between RNase H activity and nucleotide excision. Proc. Natl. Acad. Sci. U. S. A. 102:2093–2098. Parikh UM, Bacheler L, Koontz D, Mellors JW. 2006. The K65R mutation in human immunodeficiency virus type 1 reverse transcriptase exhibits bidirectional phenotypic antagonism with thymidine analog mutations. J. Virol. 80:4971– 4977. Petrella M, Wainberg MA. 2002. Might the M184V substitution in HIV-1 RT confer clinical benefit? AIDS Rev. 4:224 –232. Purohit V, Roques BP, Kim B, Bambara RA. 2007. Mechanisms that

Journal of Virology


46. 47. 48.

49.

50. 51. 52. 53. 54.

prevent template inactivation by HIV-1 reverse transcriptase RNase H cleavages. J. Biol. Chem. 282:12598 –12609. Radzio J, Sluis-Cremer N. 2008. Efavirenz accelerates HIV-1 reverse transcriptase ribonuclease H cleavage, leading to diminished zidovudine excision. Mol. Pharmacol. 73:601– 606. Radzio J, Sluis-Cremer N. 2011. Subunit-specific mutational analysis of residue N348 in HIV-1 reverse transcriptase. Retrovirology 8:69. Radzio J, Yap S-H, Tachedjian G, Sluis-Cremer N. 2010. N348I in reverse transcriptase provides a genetic pathway for HIV-1 to select thymidine analogue mutations and mutations antagonistic to thymidine analogue mutations. AIDS 24:659 – 667. Ray AS, Basavapathruni A, Anderson KS. 2002. Mechanistic studies to understand the progressive development of resistance in human immunodeficiency virus type 1 reverse transcriptase to abacavir. J. Biol. Chem. 277:40479 – 40490. Sarafianos SG, et al. 1999. Lamivudine (3TC) resistance in HIV-1 reverse transcriptase involves steric hindrance with ␤-branched amino acids. Proc. Natl. Acad. Sci. U. S. A. 96:10027–10032. Sarkar G, Sommer SS. 1990. The “megaprimer” method of site-directed mutagenesis. Biotechniques 8:404 – 407. Schinazi RF, et al. 1993. Characterization of human immunodeficiency viruses resistant to oxathiolane-cytosine nucleosides. Antimicrob. Agents Chemother. 37:875– 881. Schuurman R, et al. 1995. Rapid changes in human immunodeficiency virus type 1 RNA load and appearance of drug-resistant virus populations in persons treated with lamivudine (3TC). J. Infect. Dis. 171:1411–1419. Sharma PL, Crumpacker CS. 1999. Decreased processivity of human immunodeficiency virus type 1 reverse transcriptase (RT) containing didanosine-selected mutation Leu74Val: a comparative analysis of RT vari-


55.

56. 57.

58. 59. 60. 61. 62.

ants Leu74Val and lamivudine-selected Met184Val. J. Virol. 73:8448 – 8456. Shi C, Mellors JW. 1997. A recombinant retroviral system for rapid in vivo analysis of human immunodeficiency virus type 1 susceptibility to reverse transcriptase inhibitors. Antimicrob. Agents Chemother. 41: 2781–2785. Staszewski S, et al. 1997. Reductions in HIV-1 disease progression for zidovudine/lamivudine relative to control treatments: a meta-analysis of controlled trials. AIDS 11:477– 483. Tisdale M, Kemp SD, Parry NR, Larder BA. 1993. Rapid in vitro selection of human immunodeficiency virus type 1 resistant to 3=-thiacytidine inhibitors due to a mutation in the YMDD region of reverse transcriptase. Proc. Natl. Acad. Sci. U. S. A. 90:5653–5656. von Wyl V, et al. 2010. Epidemiological and biological evidence for a compensatory effect of connection domain mutation N348I on M184V in HIV-1 reverse transcriptase. J. Infect. Dis. 201:1054 –1062. White KL, et al. 2006. The K65R reverse transcriptase mutation in HIV-1 reverses the excision phenotype of zidovudine resistance mutations. Antivir. Ther. 11:155–163. Wilson JE, et al. 1996. Human immunodeficiency virus type-1 reverse transcriptase. Contribution of Met-184 to binding of nucleoside 5=triphosphate. J. Biol. Chem. 271:13656 –13662. Yap S-H, et al. 2007. N348I in the connection domain of HIV-1 reverse transcriptase confers zidovudine and nevirapine resistance. PLoS Med. 4:e335. Zelina S, Sheen C-W, Radzio J, Mellors JW, Sluis-Cremer N. 2008. Mechanisms by which the G333D mutation in human immunodeficiency virus type 1 reverse transcriptase facilitates dual resistance to zidovudine and lamivudine. Antimicrob. Agents Chemother. 52:157–163.

jvi.asm.org 5133