A Splice-Site Mutation in Exon 4 of the APC Gene in a

0 downloads 7 Views 218KB Size Report
doscopy and none had CHRPE (congenital hypertrophy of the retinal pigment epithelium) or evidence of overt thyroid disease. Discussion. Late-onset hereditary ...

Dig Dis Sci DOI 10.1007/s10620-007-9779-3

A Splice-Site Mutation in Exon 4 of the APC Gene in a Family with Attenuated Familial Adenomatous Polyposis Seamus J. Murphy · Brian McIlhatton · W. Peter Logan · Kenneth G. Porter · Patrick J. Morrison

Received: 6 October 2006 / Accepted: 18 January 2007 C Springer Science+Business Media, LLC 2007 

Keywords Attenuated familial adenomatous polyposis . Adenomatous polyposis coli gene mutation . C.423 G → T (p.R141S) exon 4 mutation

Introduction We describe the case of a 62-year-old woman diagnosed with attenuated familial adenomatous polyposis (AFAP). DNA sequencing of the adenomatous polyposis coli (APC) gene revealed a recently identified mutation c.423 G → T (p.R141S) in exon 4. Reverse transcriptase PCR demonstrated that the G → T transversion caused a splice site mutation which resulted in deletion of exon 4. The mutation was subsequently found in the proband’s sister, niece, and nephew. Screening colonoscopy in these individuals confirmed a clinical phenotype consistent with AFAP and a clear segregation of the mutation with the phenotype of AFAP was demonstrated. The diagnosis of AFAP is often overlooked because the polyposis is not florid and the age at onset is late. However, it is an important diagnosis to make because it has implications for patients and their relatives. S. J. Murphy · K. G. Porter Department of Gastroenterology, Belfast City Hospital, 51 Lisburn Road, Belfast BT9 7AB, UK B. McIlhatton · W. P. Logan · P. J. Morrison Department of Genetics, Belfast City Hospital, 51 Lisburn Road, Belfast BT9 7AB, UK S. J. Murphy () Division of Gastroenterology, Box 1069, Mount Sinai Medical Center, One Gustave Levy Place, New York 10029-6574, USA e-mail: [email protected]

Case report Clinical presentation A 62-year-old woman was referred to our unit for colonoscopy. She had a partial colectomy for carcinoma of the sigmoid colon at age 55 but had refused surveillance colonoscopy for 7 years following surgery. She had agreed to follow-up with barium studies and a surveillance barium enema reported an unusual configuration at the anastomotic site. The patient was asymptomatic but colonoscopy was advised to exclude cancer recurrence. At colonoscopy, the patient was found to have no evidence of cancer recurrence. However, innumerable diminutive sessile polyps, 3–4 mm, were noted throughout the colon. These were most dense in the ascending colon and became progressively less dense distally. In addition, two larger adenomas, 6–8 mm, were noted in the ascending colon. Histology confirmed these polyps to be adenomatous polyps with low-grade dysplasia without evidence of invasive malignancy. There was no family history of colorectal adenomas or carcinoma but there appeared to be an increased cancer risk among family members. The possibility of a late-onset hereditary polyposis syndrome (AFAP and multiple colorectal adenomas) was considered and genetic screening was arranged. Genetic analysis Informed consent was obtained for genetic screening and DNA was extracted from white blood cells. Gene testing to evaluate for the conditions of multiple colorectal adenomas (MYH gene screening) and AFAP (APC gene screening) was performed. Testing for MYH mutations (Northwick Park Hospital, London) was negative. Analysis of exon 15 of the APC gene by protein truncation test was negative. Springer

Dig Dis Sci Fig. 1 The patient’s pedigree. The arrow indicates the patient (proband). Circles represent female family members, squares male family members, and slashes deceased family members. Filled symbols represent individuals who tested positive for the APC gene mutation. The number after each diagnosis is the age at which the diagnosis was made. The number after “d.” is the age at death. AFAP, attenuated familial adenomatous polyposis; MI, myocardial infarction

? Renal failure

I:1

I:2

MI 62

breast 72; d.92

? II:2

II:1 Metastatic cancer ? colon primary 46

AFAP 55

II:3

II:4

Jejunal cancer d.71

III:2

III:1

Metastatic cancer ?colon primary 36

Age 40 Not tested yet

IV:1

IV:2

Age 16 Age 14 Gene test, Not tested colonoscopy yet normal

However, DNA sequencing of exons 1–14 (including all the intron/exon splice junctions) identified a missense mutation c.423 G → T (p.R141S) in exon 4. Family members were invited to attend the Genetics Department at the Belfast City Hospital and were offered screening. The same mutation was subsequently found in the proband’s sister, niece, and nephew (II:4, III:3, and III:4; Fig. 1). To investigate the effect of this mutation on mRNA expression, we obtained blood samples from the proband and affected sister (II:2 and II:4) and extracted total RNA from blood lymphocytes using the PureGene Kit (Gentra Systems Inc., Minneapolis, MN, USA) as outlined in the manufacturer’s protocol. Reverse transcriptase PCR was carried out using the SuperScript III One-Step Kit (Invitrogen Corp., Carlsbad, CA, USA) with the following primers: exon 3 forward (AGG ATC TGT ATC AAG CCG TTC TGG) and exon 5 reverse (CAT CGC ACC TCT GAT TTG CCT TGC); see Fig. 2A. The predicted PCR product was 301 bp, but for affected patients with the c.423 G → T mutation a second band corresponding to 192 bp was also produced (Fig. 2B). In normal controls only the wild-type fragment was present. These results confirmed that the G → T transversion Springer

II:5

AFAP 77, colon cancer 77

II:6

Melanoma 77, d. 79

III:3 AFAP 47

MI

III:4

III:5

AFAP 32

IV:3 Age 13 Not tested yet

Age 48 Not tested yet

IV:4 Age 10 Not tested yet

caused a splice site mutation which resulted in deletion of exon 4. Clinical genetics A detailed family history was taken from the proband, and from this a pedigree was constructed (Fig. 1), and family members were invited to attend the Genetics Department at Belfast City Hospital. The proband had multiple colonic polyps throughout the colon with evidence of low-grade dysplasia on biopsy. She had no polyps detected on upper GI endoscopy. She has declined colectomy and is currently being treated with chemoprevention using a cyclo-oxygenase-2 inhibitor and undergoing annual colonoscopy. Patient II:4 had multiple colonic polyps at colonoscopy and has recently been diagnosed with a cancer of the sigmoid colon at the age of 77. She has undergone surgery and is now finishing chemotherapy. Of interest, her husband (II:3) died at age 71 of jejunal cancer but there is no other history known on his side of the family and no genetic testing was carried out. The patient’s son, III:1, is currently asymptomatic and undergoing testing. Patient III:2 died at aged 36 from widespread

Dig Dis Sci Fig. 2 Genetic analysis. (A) DNA sequence of part of the adenomatous polyposis coli (APC) gene showing primers used in the reverse-transcriptase PCR assay (highlighted in gray) and the c.DNA sequence which is subsequently amplified. Exon 4 of the APC gene is underlined. (B) Reverse-transcriptase PCR products generated. Normal controls produced a single PCR product 301 bp in length, but for affected patients with the c.423 G → T mutation a second band corresponding to 192 bp was also produced. M, 1-kb DNA ladder; 1, Patient II:2; 2, Patient II:4; 3, Patient III:3; N, normal control; 4, H2 O control

A AGGATC TGTATCAAGCCGT TCTGGAGAGTGCAGTCCTGTTCCTATG GGTTCATTT CCA AGAAGAGGGTTTGTAAA TGGAAGCAGAGAAAGTACTG GATATTTAGAA GAACTTGAGA AAGAGAGGTCATT GCTTCTTGCTGATCTTG ACAAAGAAGAAAAGGAAAAAGACTGGTA TTACGC TCAACTTCAGAATCTCACTA AAAGAATAGAT AGTCTTCCTTTA ACTGAAAAT TT TTCCTTACAAACAGATATGAC CAGAAGGCAAT TGGAATATGAA GCAAGGCAAATCAGA GTTGCGATG

B

M

1

1

2

3

3

N

4

M

298 bp 220 bp 201 bp

metastases from a presumed colonic primary. He had two daughters, one age 16 (IV:1), who had a normal gene test and normal colonoscopy, and one age 14 (IV:2), who has not been tested yet and is asymptomatic. Patient III:3 is a gene carrier and had adenomatous gastric and colonic polyps at index endoscopy. Patient III:4 is a gene carrier diagnosed with adenomatous gastric and right-sided colonic polyps at age 32. He has a daughter age 13 (IV:3) and a son age 10 (IV:4); neither has been tested yet and both are asymptomatic. All cases had a thorough physical examination including fundoscopy and none had CHRPE (congenital hypertrophy of the retinal pigment epithelium) or evidence of overt thyroid disease.

Discussion Late-onset hereditary polyposis syndromes have been increasingly recognized and characterized in recent years. FAP is now subclassified into two types: classic FAP and attenuated FAP (AFAP). Classic FAP is characterized by the presence of thousands of polyps throughout the colon which appear in childhood and have 100% risk of progression to colorectal cancer if left untreated. Attenuated FAP is characterized by the presence of usually fewer than 100 polyps, which tend to be flat and predominantly right-sided (proximal to the splenic flexure) [1], so colonoscopy as opposed to sigmoidoscopy is required to establish the diagnosis. The risk of progression to malignancy has been difficult to define because the condition is often not recognized but is estimated

to be 80%–100% [2]. Extracolonic tumors are found in both disorders. Gastric fundic-gland polyps, duodenal adenomas, and ampullary adenomas are the most common. The APC gene encodes a protein which plays multiple roles in crucial cellular functions but it is best known as a classical tumor suppressor gene with a gatekeeper function, because it initiates the adenoma-carcinoma sequence [3, 4]. Gene mutation testing has greatly facilitated diagnosis of the condition, and there is good genotype-phenotype correlation with respect to FAP and AFAP (Fig. 3). The mutations in the APC gene associated with AFAP have mainly been located in three regions of the gene: the extreme 5  end (exons 1– 5), the 3 end and the alternatively spliced region of exon 9 [5–8]. Mutations at the 5 end end of the gene have been reported most frequently. Alternatively spliced transcripts with deletions of exons 3 and 4 have been suggested as a possible explanation for AFAP, since a reduction in the amount of mutant APC transcript could account for the reduction in severity of the phenotype [9]. The c.423 G → T mutation described in this report was recently identified in a German study. Aretz et al. [10] found the mutation in two unrelated patients and, using splice-prediction software programs, predicted that the mutation caused aberrant splicing of exon 4 as opposed to a missense mutation. They proposed that the mutation probably exerted its effect by affecting exonic splicing enhancer (ESE) motifs resulting in subsequent aberrant splicing. This study provides confirmation that the c.423 G → T mutation is a splice site mutation and is the first report of its occurrence in a family in the United Kingdom.

Springer

Dig Dis Sci

Fig. 3 Correlations between the APC genotype and the clinical phenotype. The 15 exons of the APC gene are shown. The locations of germ-line mutations that are associated with specific clinical phenotypes are indicated by the dark horizontal lines. Mutations causing attenuated familial adenomatous polyposis (AFAP) are clustered either at the far 5 end (before codon 436) or at the 3 end (after codon 1596)

of the APC gene. In contrast, mutations causing classic familial adenomatous polyposis are located in the central region. The position of the mutation described in this report (exon 4) is shown by the black arrow and is consistent with the good genotype-phenotype correlation of the APC gene. Adapted from Ref. 2

Gene testing among family members has led to detection of the mutation in three persons to date. Endoscopic examination of the gastrointestinal tract in these family members has confirmed a clinical phenotype consistent with AFAP and they are currently in an annual surveillance endoscopy program. Gene testing in other family members is ongoing and is planned in the youngest members of the pedigree when they reach 16 years of age. The diagnosis of AFAP may be overlooked for several reasons: first, the polyposis is not florid; second, the age at onset is late; and third, there is marked heterogeneity, with some individuals presenting with as few as 1 to 10 polyps or with colon cancer as late as 60 to 70 years of age. For all these reasons, AFAP is probably underdiagnosed. However, as demonstrated in this report, it is an important diagnosis to make because it has implications for patients and their relatives. In this report we are able to show that the mutation is disease-causing and is segregating within the family. Appropriate follow-up with upper gastrointestinal and colonoscopic surveillance has been offered to individuals with the mutation. This case illustrates that genetic screening of selected individuals with suspected colon cancer syndromes should be the standard of care so that colonoscopic screening is targeted at mutation-carrying persons and reassurance is given to those persons who do not have the mutation.

References

Acknowledgments We are grateful to Dr. Steven Itzkowitz, the Dr. Burrill B. Crohn Professor of Medicine, Mount Sinai Medical Center, New York, for critical review of the manuscript.

Springer

1. Knudsen AL, Bisgaard ML, Bulow S (2003) Attenuated familial adenomatous polyposis (AFAP). A review of the literature. Fam Cancer 2(1):43–55 2. Chung DC, Mino M, Shannon KM (2003) Case records of the massachusetts general hospital. weekly clinicopathological exercises. case 34-2003. A 45-year-old woman with a family history of colonic polyps and cancer. N Engl J Med 349(18):1750–1760 3. Kinzler KW, Vogelstein B (1996) Lessons from hereditary colorectal cancer. Cell 87(2):159–170 4. Powell SM, Zilz N, Beazer-Barclay Y, et al (1992) APC mutations occur early during colorectal tumorigenesis. Nature 359(6392):235–237 5. Soravia C, Berk T, Madlensky L, et al (1998) Genotype-phenotype correlations in attenuated adenomatous polyposis coli. Am J Hum Genet 62(6):1290–1301 6. Young J, Simms LA, Tarish J, et al (1998) A family with attenuated familial adenomatous polyposis due to a mutation in the alternatively spliced region of APC exon 9. Hum Mutat 11(6):450– 455 7. Van Der Luijt RB, Vasen HF, Tops CM, et al (1995) APC mutation in the alternatively spliced region of exon 9 associated with late onset familial adenomatous polyposis. Hum Genet 96(6):705– 710 8. Rozen P, Samuel Z, Shomrat R, et al (1999) Notable intrafamilial phenotypic variability in a kindred with familial adenomatous polyposis and an APC mutation in exon 9. Gut 45(6):829–833 9. Samowitz WS, Thliveris A, Spirio LN, et al (1995) Alternatively spliced adenomatous polyposis coli (APC) gene transcripts that delete exons mutated in attenuated APC. Cancer Res 55(17):3732– 3734 10. Aretz S, Uhlhaas S, Sun Y, et al (2004) Familial adenomatous polyposis: Aberrant splicing due to missense or silent mutations in the APC gene. Hum Mutat 24(5):370

Suggest Documents