Abstracts of Presentations at the 2005 Spring Meeting

Mycobiology

ISSN: 1229-8093 (Print) 2092-9323 (Online) Journal homepage: http://www.tandfonline.com/loi/tmyb20

Abstracts of Presentations at the 2005 Spring Meeting of the Korean Society of Mycology at The University of Seoul, Seoul, Korea, May 13. Hyun Park, Bong Hoon Lee, Jin Sung Lee, Hack Sung Jung, Young Jin Koh, GilHo Shin, Gyoung Hee Kim, Jong Kyu Park, Jae-Seoun Hur, Gyoung Hee Kim, Soon-Ok Oh, Jong Kyu Park, Jae-Seoun Hur, Young Jin Koh, Hyang Burm Lee, Kyoung Mo Kim, Hack Sung Jung, Hae Young Kim, Gyung Ja Choi, Kyoung Soo Jang, He Kyoung Lim, Kwang Yun Cho, Hyung-Ki Lee, Hyang Burm Lee, Hack Sung Jung, Jin-Cheol Kim, Yong-Bo Lee, Young-Hee Na, Chae-Kyu Lim, ByongSoo Heo, Kang-Soo Lee, Yang-Soo Lee, Hyun Ju Lee, Byung Re Min, JungSuk Sung, Yeong-Il Kim, Jin-A Kim, Yoo Mee Lee, Ahn-Heum Eom, Hyeon-Suk Jeong, Sang-Hyun Park, Ahn-Heum Eom, Keum Chul Shin, Nam Kyu Kim, Byung Ju Cho, Sang Yong Lee, Jong Kyu Lee, In-Pyo Hong, Sung-Hee Nam, I-Yeon Jung, Gyoo-Byung Sung, Pil-Don Kang, Seok-Woo Kang, Hyeon Hur, Min-Woong Lee, Shun-Xing Guo, Hyung-Eun Yu, Dae-Hyoung Lee, SeungChan Jeong, Jong-Soo Lee, In-Hye Park, Hyo-Cheol Ha, Kum Ju Park, Tae-Suck Kim, Hyun Su Kim, Jin-Hyeuk Kwon, Hyeong-Jin Jee, Yong Tae Jeong, Byung Keun Yang, Sang Chul Jeong, Young Ah Gu, Guk Nam Kim, Hun Jeong, Chi Hyun Song, Hae-Sook Jeon, Soon-Ok Oh, Kwang-Mi Lim, Young Jin Koh, JaeSeoun Hur, Kwang-Mi Lim, Hyung-Yeel Kahng, Soon-Ok Oh, Young Jin Koh, Jae-Seoun Hur, Yue-Qin Xiao, Li-Song Wang, Jae-Seoun Hur, Soon-Ok Oh, Young Jin Koh, Kwang-Mi Lim, Jeong-Ok Lee, Jae-Seoun Hur, Jeong-Ok Lee, Soon-Ok Oh, Young Jin Koh, Kwang-Mi Lim, Jae-Seoun Hur, Li-Song Wang, Young Jin Koh, Jae-Seoun Hur, Yong Il Kim, Kwang Choon Chang, Youn Su Lee, Jae Ouk Shim, U Youn Lee, Tae Soo Lee, Min Woong Lee, Fun Hee Bae, Su Bin Min, Cheong Ha Park, Yeong Sub Park, Jae-Seoun Hur, Young Jin Koh, Myeong Hyeon Nam, Nam Gyu Kim, Suck Kee Jung, Sung Joon Yoo, Hong Gi Kim, Mi Sun Ko, Soh Young Oh, Myung Soo Park, Seung Hun Yu, KangHyo Lee, Hang-Yeon Weon, Soon-Ja Seok, Soon-Ik Kwon, Yang-Sup Kim, JaeMo Sung, Wan-Gyu Kim, Hye Jin Kwon, Won-Sik Kong, Han Gyu Ko, Hyuk Gu Park, Seong Hwan Kim, Jae Mo Sung, Won Mok Park, Min Woo Hyun, Seong Hwan Kim, Bhushan Shrestha, Sang-Kuk Han, Kwon-Sang Yoon, Jae-Mo Sung, Bhushan Shrestha, Jae-Mo Sung, Kwang-Yeol Jeong, Sang-Kuk Han, WonHo Lee, Jae-Mo Sung, Jae-Mo Sung, Kwang-Yeol Jeong, Bhushan Shrestha, Sung-Keun Choi, Won-Ho Lee, Sang-Kuk Han, Je-O Lee, Jung-Hoon Lee, SooYong Lee, Sang-Kuk Han, Kwang-Yeol Jeong, Jae-Mo Sung, Pham Thi Vuong, Luong Van Ha, Je-O Lee, Bhushan Shrestha, Jung-Hoon Lee, Jae-Mo Sung, Sung-Keun Choi, Won-Ho Lee, Sang-Kuk Han, Kwang-Yeo Jeong, Bhushan Shrestha, Soo-Yong Lee, Jae-Mo Sung, Won-Ho Lee, In-Yeup Kim, YoungJin Kim, Young-Hyun Lee, Sang-Kuk Han, Gwang-Reul Jung, Soo-Yong Lee, Jae-Mo Sung, Wi Young Lee, Youngki Park, Jin Kwon Ahn, So Young Park, Wi Young Lee, Youngki Park, Jin Kwon Ahn, So Young Park, Young-Joon Choi,

Seung-Beom Hong, Hyeon-Dong Shin, Young-Joon Choi, Seung-Beom Hong, Hyeon-Dong Shin, Seong Hwan Kim, Jae-Jin Kim, Colette Breuil, Gyu-Hyeok Kim, Jong-In Choi, Tai-Moon Ha, Jeong-Hyun Chi, Young-Cheol Ju, Soon-Ja Seok, Yang-Sup Kim, Sol Yun, Yang-Sup Kim, Kang-Hyo Lee, Soon-Ja Seok, Tae-Wan Kim, Kyong-Hee Min, Si Jung Ha, Jun-Oh Choi, Sung-Soon Kim, Hyeon-Su Ro, Hyun-Sook Lee, Hyeon-Su Ro, Sung-Soon Kim, Jae San Ryu, Tae Su Lee, Hyun-Sook Lee, Kyung-Ju Jung, Duck-Soo Choi, Hyeung-Kuk Choi, Jung-Sik Park & Ki-Chul Chung To cite this article: Hyun Park, Bong Hoon Lee, Jin Sung Lee, Hack Sung Jung, Young Jin Koh, Gil-Ho Shin, Gyoung Hee Kim, Jong Kyu Park, Jae-Seoun Hur, Gyoung Hee Kim, Soon-Ok Oh, Jong Kyu Park, Jae-Seoun Hur, Young Jin Koh, Hyang Burm Lee, Kyoung Mo Kim, Hack Sung Jung, Hae Young Kim, Gyung Ja Choi, Kyoung Soo Jang, He Kyoung Lim, Kwang Yun Cho, Hyung-Ki Lee, Hyang Burm Lee, Hack Sung Jung, Jin-Cheol Kim, Yong-Bo Lee, Young-Hee Na, Chae-Kyu Lim, Byong-Soo Heo, Kang-Soo Lee, Yang-Soo Lee, Hyun Ju Lee, Byung Re Min, JungSuk Sung, Yeong-Il Kim, Jin-A Kim, Yoo Mee Lee, Ahn-Heum Eom, Hyeon-Suk Jeong, SangHyun Park, Ahn-Heum Eom, Keum Chul Shin, Nam Kyu Kim, Byung Ju Cho, Sang Yong Lee, Jong Kyu Lee, In-Pyo Hong, Sung-Hee Nam, I-Yeon Jung, Gyoo-Byung Sung, Pil-Don Kang, Seok-Woo Kang, Hyeon Hur, Min-Woong Lee, Shun-Xing Guo, Hyung-Eun Yu, Dae-Hyoung Lee, Seung-Chan Jeong, Jong-Soo Lee, In-Hye Park, Hyo-Cheol Ha, Kum Ju Park, Tae-Suck Kim, Hyun Su Kim, Jin-Hyeuk Kwon, Hyeong-Jin Jee, Yong Tae Jeong, Byung Keun Yang, Sang Chul Jeong, Young Ah Gu, Guk Nam Kim, Hun Jeong, Chi Hyun Song, Hae-Sook Jeon, Soon-Ok Oh, Kwang-Mi Lim, Young Jin Koh, Jae-Seoun Hur, Kwang-Mi Lim, Hyung-Yeel Kahng, Soon-Ok Oh, Young Jin Koh, Jae-Seoun Hur, Yue-Qin Xiao, Li-Song Wang, Jae-Seoun Hur, Soon-Ok Oh, Young Jin Koh, Kwang-Mi Lim, Jeong-Ok Lee, Jae-Seoun Hur, Jeong-Ok Lee, Soon-Ok Oh, Young Jin Koh, Kwang-Mi Lim, Jae-Seoun Hur, Li-Song Wang, Young Jin Koh, Jae-Seoun Hur, Yong Il Kim, Kwang Choon Chang, Youn Su Lee, Jae Ouk Shim, U Youn Lee, Tae Soo Lee, Min Woong Lee, Fun Hee Bae, Su Bin Min, Cheong Ha Park, Yeong Sub Park, Jae-Seoun Hur, Young Jin Koh, Myeong Hyeon Nam, Nam Gyu Kim, Suck Kee Jung, Sung Joon Yoo, Hong Gi Kim, Mi Sun Ko, Soh Young Oh, Myung Soo Park, Seung Hun Yu, Kang-Hyo Lee, Hang-Yeon Weon, SoonJa Seok, Soon-Ik Kwon, Yang-Sup Kim, Jae-Mo Sung, Wan-Gyu Kim, Hye Jin Kwon, Won-Sik Kong, Han Gyu Ko, Hyuk Gu Park, Seong Hwan Kim, Jae Mo Sung, Won Mok Park, Min Woo Hyun, Seong Hwan Kim, Bhushan Shrestha, Sang-Kuk Han, Kwon-Sang Yoon, Jae-Mo Sung, Bhushan Shrestha, Jae-Mo Sung, Kwang-Yeol Jeong, Sang-Kuk Han, Won-Ho Lee, Jae-Mo Sung, Jae-Mo Sung, Kwang-Yeol Jeong, Bhushan Shrestha, Sung-Keun Choi, Won-Ho Lee, SangKuk Han, Je-O Lee, Jung-Hoon Lee, Soo-Yong Lee, Sang-Kuk Han, Kwang-Yeol Jeong, Jae-Mo Sung, Pham Thi Vuong, Luong Van Ha, Je-O Lee, Bhushan Shrestha, Jung-Hoon Lee, Jae-Mo Sung, Sung-Keun Choi, Won-Ho Lee, Sang-Kuk Han, Kwang-Yeo Jeong, Bhushan Shrestha, SooYong Lee, Jae-Mo Sung, Won-Ho Lee, In-Yeup Kim, Young-Jin Kim, Young-Hyun Lee, Sang-Kuk Han, Gwang-Reul Jung, Soo-Yong Lee, Jae-Mo Sung, Wi Young Lee, Youngki Park, Jin Kwon Ahn, So Young Park, Wi Young Lee, Youngki Park, Jin Kwon Ahn, So Young Park, Young-Joon Choi, Seung-Beom Hong, Hyeon-Dong Shin, Young-Joon Choi, Seung-Beom Hong, Hyeon-Dong Shin, Seong Hwan Kim, Jae-Jin Kim, Colette Breuil, Gyu-Hyeok Kim, Jong-In Choi, Tai-Moon Ha, Jeong-Hyun Chi, Young-Cheol Ju, Soon-Ja Seok, Yang-Sup Kim, Sol Yun, Yang-Sup Kim, Kang-Hyo Lee, Soon-Ja Seok, Tae-Wan Kim, Kyong-Hee Min, Si Jung Ha, Jun-Oh Choi, SungSoon Kim, Hyeon-Su Ro, Hyun-Sook Lee, Hyeon-Su Ro, Sung-Soon Kim, Jae San Ryu, Tae Su Lee, Hyun-Sook Lee, Kyung-Ju Jung, Duck-Soo Choi, Hyeung-Kuk Choi, Jung-Sik Park & KiChul Chung (2005) Abstracts of Presentations at the 2005 Spring Meeting of the Korean Society of Mycology at The University of Seoul, Seoul, Korea, May 13., Mycobiology, 33:4, 245-254, DOI: 10.1080/12298093.2005.12015970 To link to this article: https://doi.org/10.1080/12298093.2005.12015970

© 2000 by The Korean Society of Mycology

Published online: 22 Jun 2018.

Submit your article to this journal

Article views: 18

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tmyb20

Abstracts of Presentations

at the 2005 Spring Meeting of the Korean Society of Mycology at The University of Seoul, Seoul, Korea, May 13. Isolation of Inonotus obliquus from Betula costata in Korea

spots on leaves were collected from various plants in major botanical gardens or plantations. The causal fungi isolated from lesions on the diseased leaves were identified at the genus level. Pestalotiopsis spp. were isolated from 169 specimens of 142 species of plants. Among the plant species, 18 species have been recorded as the host plants of Pestalotiopsis spp., but 124 species of plants were new host plants in Korea. All the voucher specimens of diseased leaves are now deposited at Plant Pathology Laboratory, Sunchon National University and the fungal isolates are now under investigation to identify the species of the genus Pestalotiopsis.

Hyun Park* and Bong Hoon Lee

Division of Wood Chemistry & Microbiology, Korea Forest Research Institute, Seoul, Korea

Inonotus obliquus, known as ‘Chaga’, has been widely used as a folk medicine in several countries such as Russia and Poland. The sterile form of the fungus is used for preparation of the medicine befungin that is effective in the treatment of gastritis, gastric ulcers, and several tumors. But, the physiochemical properties of pigments isolated from the naturally occurring sterile form (sclerotium) of the fungus and those of melanins synthesized by cultured fungus showed differences in chemical structures (Kukulyanskaya et al., 2002). Thus, the demand of natural sclerotium is expected to increase although we can culture the fungus in vitro. The natural resources of the fungus are known to be limited at the stands of Betula platyphylla var. japonica Hara that grows at high altitudinal region in Korea. However, we found the mushroom on the stem of Betula costata Trautv. at Mt. Jumbong in Korea. We could isolate a pure culture of the fungus from the stem of B. costata by use of PDA medium. The mycelium showed 2.5~5.0 × 10− m for thickness, and grew well around 30 C at dark condition. To get more sclerotium of the fungus, we plan to cultivate the fungus by use of living trees in the genus of Betula in Korea.

Bacillus subtilis BD0310 as a Potent Biocontrol Agent

Against Green and Blue Mold Diseases of Mandarins

Gyoung Hee Kim*, Soon-Ok Oh, Jong Kyu Park, Jae-Seoun Hur and Young Jin Koh 1

*Department of Plant Medicine. Environmental Education, Sunchon National University 1

Green and blue mold diseases caused by Penicillium digitatum and P. italicum, respectively, are the most destructive among the post-harvest diseases of mandarins in Korea. The diseases have been mainly controlled by application of chemical fungicides, but the increasing consumer demand without fungicide residues have emphasized the need for development of biocontrol agents as alternative disease control strategies. Bacillus subtilis BD0310, which was isolated from tea leaves and had antagonistic performance against gray blight and anthracnose of tea plants, showed strong antifungal activities against green and blue mold of mandarins. A wettable powder formulation including 20% soybean and rice powders was obtained from the various formulation studies for the stabilization of the antifungal activities of B. subtilis BD0310. Pre-treatment of the formulation 5 days before inoculation of P. digitatum and P. italicum under room temperature showed 72% and 66% control efficacies of green and blue mold diseases on fruits of mandarins, respectively. The results indicate that B. subtilis BD0310 may be a potent biocontrol agent against green and blue mold diseases of mandarins.

6

o

Taxonomic Study on Some Unrecorded Taxa of Korean Aphyllophorales Jin Sung Lee* and Hack Sung Jung

Department of Biological Sciences, College of Natural Sciences, Seoul National University, Seoul 151-747, Korea

Through the specimen examination of Seoul National University Fungus Collection (SFC), four genera and seven species belonging to the Aphyllophorales were confirmed new to Korea. Unrecorded genera were Abundisporus, Cyphellopsis, Hexagonia, and Ischnoderma, and unrecorded species were Abundisporus fuscopurpureus, Cyphellopsis confusa, Hexagonia tenuis, Hyphodontia tropica, Inonotus dryophilus, Ischnoderma benzoinum, and Phellinus lonicericola. Nuclear ribosomal DNA regions from unrecorded taxa were sequenced and compared with those retrieved from GenBank. Their phylogenetic positions were confirmed and their identities were verified. New Korean names were registered for unrecorded taxa along with English descriptions in this study.

Paraphaeosphaeria recurvifoliae, a New Species Causing Leaf Spots and Necrosis on Yucca recurvifolia Hyang Burm Lee*, Kyoung Mo Kim and Hack Sung Jung Department of Biological Sciences, College of Natural Sciences, Seoul National University, Seoul 151-747, Korea

Brown leaf spot and necrosis was observed on a pendulous yucca (Yucca recurvifolia Salisb.) in house gardens of Korea. The causal fungus was isolated from the leaf lesion. Its pathogenicity to yucca plant was tested, morphology of pycnidia and pycnidiospores was observed, and internal transcribed spacer (ITS) 1 and 2 regions including 5.8S rDNA were compared to those of related species of Coniothyrium, Microsphaeropsis and Paraphaeosphaeria in order to determine its phylogenetic status. The fungus was identified as a new species of Paraphaeosphaeria and named Paraphaeosphaeria recurvifoliae Lee, Kim & Jung.

Surveys of Host Plants of Pestalotiopsis spp. in Korea

Young Jin Koh*, Gil-Ho Shin , Gyoung Hee Kim, Jong Kyu Park, and Jae-Seoun Hur 1

2

*Department of Plant Medicine, Sunchon National University. Jeollanamdo Agricultural Research and Extension Service. Environmental Education, Sunchon National University Collection and identification of Pestalotiopsis genus were attempted 1

2

within the nation-wide survey framework from 23 March to 30 October 2004. More than six hundred plant specimens with

245

246

Abstracts of the 2005 Spring Meeting of the Korean Society of Mycology

Selection of Endophytic Fungi Antagonistic to Phytophthora infestans on Tomato Plants

Hae Young Kim, Gyung Ja Choi, Kyoung Soo Jang, He Kyoung Lim, Kwang Yun Cho, Hyung-Ki Lee , Hyang Burm Lee , Hack Sung Jung and Jin-Cheol Kim 1

1

1

Biological Function Research Team, Korea Research Institute of Chemical Technology, Taejon 305-600, Korea. School of Biological Sciences, Seoul National University, Kwanak-Gu, Seoul 151-747, Korea 1

In an attempt to develop new microbial fungicides using endophytic fungi, a total of 151 isolates were obtained from 67 healthy tissue samples of vegetable plants such as chinese cabbage, red pepper, cucumber, and tomato. After they were incubated in potato dextrose broth medium, the cultures were tested for their control efficacy against Phytophthora infestans on tomato plants. Among 151 isolates, 23 showed potent in vivo antifungal activity over 90%. Based on nuclear ribosomal ITS15.8S-ITS2 sequence analysis, 10 out of 23 isolates were classified as Fusarium oxysporum, 5 as Fusarium sp., 2 as Chaetomium sp., 2 as Penicillium spp., 1 as Coniochaeta ligniaria, 1 as Colletotrichum sp., 1 as Laromyces sp., and the last one was not determined. Fusarium sp. EF119 was the most active, showing 92% and 50% control values at doses of 5-fold and 50-fold dilutions of the liquid culture, respectively. Solvent fractionation of the liquid cultures of Fusarium sp. EF119 showed the strongest antifungal activity against P. infestans in the ethyl acetate fraction, with 98% control value at 500 mg/ml, followed by the butanol fraction with 78% control value at 500 mg/ml. However, little antifungal activity was shown in the aqueous fraction. Further study on the isolation of antifungal substances from the ethyl acetate fraction is in progress.

Notes on Three Species of the Laboulbeniales Newly Collected in Korea (II) Yong-Bo Lee*, Young-Hee Na and Chae-Kyu Lim 1

2

Division of Science Education, College of Education, Chosun University, GwangJu 501-759, Korea. Department of Biology, Graduated School, Chosun University, GwangJu 501-759, Korea. Department of Herbal Medicine Resources Development, Naju College, Naju 520-713, Korea 1

2

Three species of the Laboubeniales based on the materials from Korea are described. They are new to the mycological flora of Korea. Corethromyces purpurascens on several parts of Ochthephilum densipenne, Laboulbenia barbara on the metasternum of Philonthus longicornis and L. compressa on the elytra of Harpalus tinctulus were found.

Cultural Conditions for the Mycelial Growth of Sparassis crispa Byong-Soo Heo, Kang-Soo Lee and Yang-Soo Lee*

Institute of Agriculture Science and Technology, Chonbuk National University, Jeonju 561-756, Korea

The optimum cultural conditions were estimated for seven different strains of Sparassis crispa well known as brown rot fungi. The favorable mycelial growth was accomplished at pH 4.0, at 25 C and on both RM and PDA media. Adjustment of pH using inorganic acid and organic acid allowed the similar mycelial growth rate at pH 4.0. However, the use of inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid and phosphoric acid resulted in slightly better growth rate than the other organic acids exception of oxalic acid. Accordingly, it can not be seen that most of the organic acids supply a nutrient for favorable mycelial growth, that is, occasionally those acids can o

rather inhibit the mycelial growth. Using nitric acid for adjustment pH of media, a characteristic mycelial shape on the RM medium was observed. The mycelial growth was optimum in the range of pH 4.0~5.0 and that of these fungi were not even observed at higher pH condition. The favorable temperature was between 15 and 25 C but the mycelia growth was not occurred over 30 C. A strain (KCTC 26169) showed the fastest growth rate on the RM medium, comparing to the other six strains. Sparassis crispa obtained from Rural Development Administration (RDA) indicated the fastest growth rate on the PDA medium. o

o

Partial DNA Sequence of β-Tubulin Gene in Fusarium Hyun Ju Lee* and Byung Re Min

Department of Biology, Sang Myung University β-Tubulin, one of the strongly conserved gene, are involved in

both cytoskeletal framework and various cellular functions such as cell division, intracellar transport, maintenance of cell shape, and flagellar and ciliary motility. In order to compare genetic relationship among 14 strains of Fusarium species, partial βtubulin genes were amplified, using the forward primer T10 (ACGATAGGTTCACCTCCAGAC) and the reverse primer T224 (GAGGGAACGACGGAGAAGGTGG). The PCR products were showed length polymorphism ranging from 603 in F. solani MAFF 7475 to 661 bp in F. solani phaseoli MAFF 305607. The PCR products were cloned by yT&A cloning kit and compared DNA sequence. Based on the alignment of the partial β-tubulin gene sequence nucleotide identify was above 90%.

5'-Deoxyribose-5-phosphate Lyase Activity and its Involvement in Base Excision DNA Repair in Saccharomyces cerevisiae Jung-Suk Sung

Department of Biology, Dongguk University

The major mechanisms of cellular response to DNA damage are well conserved throughout the evolution from yeast to human. However, unlike to most mammalian cells, yeast does not possess a DNA polymerase endowed with the lyase activity that removes a 5'-deoxyribose-5-phosphate (dRP) from the abasic (AP) site in DNA during base excision repair (BER). By employing a cell-free extract system of Saccharomyces cerevisiae, we have identified an enzymatic activity that leads to covalent trapping of the protein to the abasic (AP) site in DNA upon simultaneous reduction of its reaction intermediate with sodium borohydride. Comparative analysis to mammalian DNA polymerase β revealed that the reactivity of this yeast dRP lyase-like protein is highly specific to the AP site of DNA. The molecular weight of this protein was estimated to be 59 kDa from the resulting DNA-protein cross-link analyzed by SDSPAGE. Consistent with this observation, yeast cell-free extracts displayed an efficient removal of dRP residues from duplex DNA. Complete BER assay demonstrated that short-patch BER pathway also occurred in Saccharomyces cerevisiae, suggesting that this novel yeast dRP lyase activity may play a key role in the repair of various base damage lesions in DNA.

Molecular Identification of Arbuscular Mycorrhizal Fungal Spores Collected in Korea

Yeong-Il Kim, Jin-A Kim, Yoo Mee Lee and Ahn-Heum Eom* Department of Biology Education, Korea National University of Education, Chungbuk 363-791, Korea

Arbuscular mycorrhizas (AM) are mutualistic symbiosis and

Abstracts of the 2005 Spring Meeting of the Korean Society of Mycology benefit plant growth and efforts have been placed on application of these symbiotic relationships to agricultural and environmental fields. However, the relationship between plant and fungi has not been understood clearly, mainly due to the inability of culture of these fungi. It is important to develop techniques identifying AM fungi colonizing roots for further studies and applications of AM fungi. In this study, AM fungi were collected from 46 sites in Korea growing with 21 host plant species and cultured with Sorghum bicolor in greenhouse condition. AM fungal spores were extacted and identified using both morphological and molecular techniques. Using morphological characters of the spores, total 11 morpho-speices were identified. DNA were extracted from single spores of AM fungi and amplified a partial region on 18s RNA genes using nested PCR. Total 30 sequences were analysed and 12 AM fungal type were identified. These molecular analysis were consistent with morphological identification except for one species, Glomus etunicatum which were identified as one species morphologically but sequence analysis showed highly divergent. Both morphological and molecular data on spores from this study could help direct identification of AM fungi in roots.

Molecular Diversities of Arbuscular Mycorrhizal Fungi Colonizing Roots of Trifolium repens Hyeon-Suk Jeong, Sang-Hyun Park and Ahn-Heum Eom*

Department of Biology Education, Korea National University of Education, Chungbuk 363-791, Korea

Arbuscular mycorrhizal (AM) fungi plays important roles in plant community structures and it would be due to specific interactions between host plant species and AM fungal species. This study investigated relationships between host plants and AM fungal species diversity in a field study using molecular techniques. The 18s rDNA sequences of AM fungal species in the roots of Trifolium repens growing in a grasslands and a woodland were compared. Four species of AM fungi, Paraglomus brasilianum, Glomus caledonium, G. intraradices and G. fasciculatum were found in the roots of the T. repens growing in the grassland and 8 species of Glomus were found in the roots growing in the woodland. More diverse AM fungal species were found in the plant roots of the sites with higher plant species diversity. This study suggested that plant community structures would affect mycorrhizal fungal diversity.

Studies on RAPD Analysis of Lentinus lepideus Isolates and Liquid Culture Keum Chul Shin, Nam Kyu Kim, Byung Ju Cho, Sang Yong Lee and Jong Kyu Lee

Tree Pathology and Mycology laboratory, Division of Forest Resources, Kangwon National University, Chunchon 200-701, Korea In order to investigate the genetic diversity of Lentinus lepideus

isolates, 12 isolates from various origins were compared by RAPD analysis. L. lepideus isolates tested showed 83 to 100% homology by phylogenetic tree. To obtain the basic data for large scale cultivation of L. lepideus with biological activities, liquid culture and liquid spawn cultivation were carried out. L. lepideus showed the most favorable growth on GPB (Glucose Peptone Broth) culture media. Mycelial growth and fruiting body production was generally increased by adding wood vinegar into culture media and sawdust media, respectively. In the case of using liquid spawn, the required periods for spawn preparation and the first primordia formation after inoculation of spawn onto sawdust media were 44 days shorter than the

247

normal period required for the sawdust spawn cultivation. In addition, dry weight of fruiting body by liquid spawn cultivation was higher than those by sawdust spawn cultivation. Thus, liquid spawn cultivation seems to be effective for large scale cultivation of L. lepideus.

Cultural Characteristics of an Entomogenous Fungus, Paecilomyces tenuipes (Peck) Samson In-Pyo Hong*, Sung-Hee Nam, I-Yeon Jung, Gyoo-Byung Sung, Pil-Don Kang, Seok-Woo Kang , Hyeon Hur, MinWoong Lee and Shun-Xing Guo 1

2

3

Department of Sericulture and Entomology, National Institute of Agricultural Science and Technology, R.D.A., Suwon 441-707, Korea. Dept. of Applied Biology, Dongguk University, Seoul 100-715. Institute of Medicinal Plant, Chinese Academy of Medical Sciences, P.R.China To develop techniques for the production of P. tenuipes stromata on a large scale, the infection of P. tenuipes and the 2

3

growth of stroma were investigated by silkworm (Bombyx mori) variety. Also, studied about biological activities of fruiting body formed on silkworm. Infection rate of the 5th instar larvae of the silkworm with P. tenuipes was the highest in Yangwonjam, followed by Hachojam, Baegokjam and Chilbojam in that order. Also, as the inoculation times was increased, infection rate tended to be raised. The rate of fruiting body formation of the silkworm pupae infected with P. tenuipes was the highest in Baegokjam, followed by Yangwonjam and Chilbojam in that order. But, actually the fruiting body formation of the 5th instar larvae of the silkworm tested was good in Chilbojam, followed by Yangwonjam and Baegokjam in that order in 3 times spraying inoculation. Mannitol concentration was high in the fruiting bodies of the silkworm infected with C. militaris on a dry weight basis. The fruiting bodies of Yangwonjam and Chilbojam infected with P. tenuipes had high amount of Mannitol, but Baegokjam and Hachojam had high concentration of Glucose. The most abundant amino acid in the fruiting bodies of the Baegokjam, Chilbojam and Hachojam infected with P. tenuipes was arginine, while Yangwonjam was Glycine. C. militaris, had a large amount of Glycine, followed by Serine.

Production of Anticholesterolemic β-Hydroxy-β-methylglutaryl Coenzyme A Reductase Inhibitor from Edible Mushroom Pholiota adiposa

Hyung-Eun Yu*, Dae-Hyoung Lee, Seung-Chan Jeong and Jong-Soo Lee Department of Genetic Engineering, Paichai University, Daejeon 302-735, Korea

Lipid metabolism normally maintains an elegant between synthesis and degradation. When the balance is lost, hypercholesterolemia and hyperlipidemia may develop. This can cause variety of serious diseases such as arteriosclerosis, hypertension, obesity, diabetes, functional depression of some organs, etc. βHydroxy-β-Methylglutaryl Coenzyme A Reductase (HMG-CoA reductase, E.C. 1.1.1.34) is known to be rate-limiting enzyme in cholesterol biosynthesis. Therefore, HMG-CoA reductase inhibitor is very useful in the remedy or precaution of hyperlipidemia. For the purpose of development of a new anticholesterolemic drug or nutraceuticals from natural sources, screening of a potent HMG-CoA reductase inhibitor-producing mushroom and optimal extraction condition of the HMG-CoA reductase inhibitor were investigated. The methanol extracts of Pholiota adiposa ASI 24018 showed the highest HMG-CoA reudctase inhibitory activity of 55.8%. The HMG-CoA reductase inhibitor of Pho-

248


liota adiposa ASI 24018 was also maximally extracted when it was treated with methanol at 30 C for 12 hrs. The HMG-CoA reductase inhibitor of Pholiota adiposa ASI 24018 was further purified by systematic solvent extraction, silica gel column chromatography and RP-HPLC [This study was supported by technology Development Program for Agriculture and Forestry, Ministry of Agriculture and Forestry, Republic of Korea]. o

Alpha-Glucosidase Inhibitory Effect of the High Molecular Compounds Extracted with Cold Water from the Fruit Body of Grifola frondosa

In-Hye Park, Hyo-Cheol Ha*, Kum Ju Park, Tae-Suck Kim and Hyun Su Kim R&D Center for Functional Foods, Institute of Food and Culture, Pulmuone Co. Ltd. Seoul, Korea

This study investigated inhibitory effect of the high molecular fraction (Fr. CWH) extracted with cold water from the fruit body of Grifola frondosa (Maitake) on rat intestinal mucosa alpha-glucosidase. The alpha-glucosidase is responsible for digestion of carbohydrate to monosaccharides in the process of intestinal absorption. While the cold water fraction (Fr. CW) extracted from the fruit body of Grifola frondosa exhibited high inhibitory effect on alpha-glucosidase (maltase, sucrase), the hot water fraction (Fr. HW) extracted after extraction with cold water showed very low inhibitory effect on alpha- glucosidase. The cold water fraction (Fr. CW) was separated into high molecular fraction (Fr. CWH) and low molecular fraction (Fr. CWL) using a ultrafiltration system with YM1. The Fr. CWH showed higher inhibitory effect then the Fr. CWL on alpha-glucosidase. These results suggest that the high molecular fraction (Fr. CWH) could be an anti-hypoglycemic food if it has in vivo effectiveness.

Fruit Soft Rot of Eggplant (Solanum melongena) Caused by Choanephora cucurbitarum in Korea Jin-Hyeuk Kwon* and Hyeong-Jin Jee

1

Gyeongsangnam-do Agricultural Research and Extension Services, Jinju 660-360, Korea. Organic Farming Technology Division, National Institute of Agricultural Science and Technology, RDA, Suwon 441-707, Korea In April 2002 to 2003, fruit soft rot of Solanum melongena caused by Choanephora cucurbitarum was found in the exper1

imental fields at Gyeongsangnam-do Agricultural Research and Extension Services, Korea. The disease started with water-soaking, dark-green lesions, and then infected tissues were rapidly rotten. Sporangium was subglobose in shape and was 40~130 µm in size. Monosporous sporangiola were elliptic, fusiform or ovoid, brown in color, and was 12~20 × 6~14 µm in size. Sporangiospores were elliptic, fusiform or ovoid in shape, dark brown or brown in color, and was 14~20 × 7~16 µm in size, and had three or more appendages. The fungus grew on PDA at 15~40 C, and optimum temperature was 30 C. This is the first report on the fruit soft rot of S. melongena caused by C. cucurbitarum in Korea. o

o

Optimum Conditions for the Mycelial Growth and Exobiopolymer Production by a Submerged Culture of Elfvin-

gia applanata Yong Tae Jeong*, Byung Keun Yang, Sang Chul Jeong, Young Ah Gu, Guk Nam Kim, Hun Jeong and Chi Hyun Song Department of Biotechnology, Daegu University

The influences of pH, temperature, inoculum content, and medium composition on mycelial growth and exo-biopolymer production

of Elfvingia applanata were investigated in shake flasks culture. The optimum initial pH for mycelial growth and exo-biopolymer production was 4.0 and 6.0, respectively. The optimal temperature and inoculum content were identified to be 25 C and 3.0% (v/v). The optimization of carbon and nitrogen sources promoting mycelial growth and exo-biopolymer production were glucose (8%) and corn steep powder (10%), respectively. The time courses for the mycelial growth and exo-biopolymer production were achieved at 12 days which was at the end of log phase. The exo-biopolymer was found to contain 58.9% carbohydrate and 17.1% protein. The sugar and amino acid compositions of the exo-biopolymer were also analyzed in detail [This work was supported by RRC program of MOST and KOSEF]. o

Broad Spectrum Antibacterial Activity of East Asian Lichen Species

Hae-Sook Jeon, Soon-Ok Oh , Kwang-Mi Lim , Young Jin Koh and Jae-Seoun Hur* 1

2

1

Department of Environmental Education. Department of Applied Biology, Department of Biology, Sunchon National University, Sunchon, 540-742, Korea 1

2

The antibacterial activities of East Asian lichens were evaluated against pathogenic bacteria of Escherichia coli O-157, Salmonella anterotidis, Streptococcus mutans, and Helicobacter pylori. Lichen specimens were collected from Korea and southwestern China on 2003 and 2004. Total 197 lichen specimens of 60 genera and ca. 90 species were screened in this study. Acetone extract of lichen thalli exhibited broad spectrum of antimicrobial activity against gram positive and negative bacteria. Allocetraria, Evernia, Lethariella, Oropogon, Ramalina and Usnea lichens showed the strongest antibacterial activity against all the tested bacteria. Lethariella zahlbruckneri, successfully inhibited bacterial growth of H. pylori. Until now, there is no report on antibacterial activity of L. zahlbruckneri agaisnt pathogenic bacteria. This is the first report on large scale screening of antibacterial substances originated from East Asian lichens against clinically important bacteria. Purification and chemical identification of the antibacterial substances are now under progress.

Variation in the Ribosomal ITS-Sequence of the Ichens Nephroma from South Korea

Kwang-Mi Lim, Hyung-Yeel Kahng , Soon-Ok Oh , Young Jin Koh and Jae-Seoun Hur * 1

2

2

1

Department of Biology, Department of Environmental Education*, Department of Applied Biology, Sunchon National University, Sunchon 540-742, Korea Thalli of the lichens Nephroma bellum, N. helveticum, N. parile, N. resupinatum, and N. tropicum were collected from 1

2

South Korea on 2003 and 2004. DNA was extracted from whole thalli and the ribosomal ITS region was amplified by PCR using fungal specific primers. Resulting products were sequenced to analyze the relationship of Korean Nephroma lichen species. N. helvitcum, the commonest species, was closely related with in the order of N. tropicum, N. parile, N. bellum and N. resupinatum. N. helveticum and N. tropicum have been regarded to be synonymous in Europe. However, the sequence difference at 6% of nucleotide positions between the two Korean species suggests that N. tropicum can be separated from N. helveticum. This separation was further supported by HPLC analysis of lichen substances and morphological characteristics. This is the first report on molecular phylogeny of Korean lichen species.

Abstracts of the 2005 Spring Meeting of the Korean Society of Mycology Lichenomphalina hudsoniana, a Basidiolichen from China Yue-Qin Xiao, Li-Song Wang and Jae-Seoun Hur * 1

2

Department of Agricultural Chemistry, Department of Biology, Department of Environmental Education*, Sunchon National University, Sunchon 540-742, Korea 1

2

Eight species of Lichenomphalia have been frequently reported from Europe and North America, but only occasionally from East Asia. Although the sterile thallus of L. hudsoniana have been reported from Tibet and Yunnan, the fertile fruitbodies of L. hudsoniana are reported for the first time in China. According to the rechecking of the omphalinoid fungal specimens deposited in the Lichen section of Cryptogamic Herbarium, Kunming Institute of Botany, the fertile fruitbodies of L. hudsoniana were identified and described for the first time in China. External morphology, anatomy and habitat data are also provided, as well as the distribution in China.

Taxonomic Revision of Anzia (Lichenized Ascomycota) in South Korea

Soon-Ok Oh, Young Jin Koh, Kwang-Mi Lim , Jeong-Ok Lee and Jae-Seoun Hur * 1

2

2

Department of Applied Biology, Department of Biology, Department of Environmental Education*, Sunchon National University, Sunchon 540-742, Korea 1

2

Based on extensive field studies and herbarium research, the taxonomy and distribution of 4 species of Anzia in South Korea are discussed. A key to the species is provided and their Korean names are suggested. Voucher specimens are deposited in Korean Lichen Research Institute (KoLRI) at Sunchon National University. This is the first report on taxonomic revision of Anzia in South Korea.

Taxonomic Revision of Ramalina (Lichenized Ascomycota) in South Korea

Jeong-Ok Lee, Soon-Ok Oh , Young Jin Koh , Kwang-Mi Lim and Jae-Seoun Hur* 1

1

2

*Department of Environmental Education, Department of Applied Biology, Department of Biology, Sunchon National University, Sunchon 540-742, Korea 1

2

Based on extensive field studies and herbarium research, the taxonomy and distribution of 10 species of Ramalina in South Korea are discussed. A key to the species is provided and their Korean names are suggested. Voucher specimens are deposited in Korean Lichen Research Institute (KoLRI) at Sunchon National University. Five more species previously reported in South Korea were also discussed in this communication. This is the first report on taxonomic revision of Ramalina in South Korea.

Taxonomic Study of Genus Bryoria (Lichenized Ascomycota, Parmeliaceae) from the Sino-Himalayas Li-Song Wang*, Young Jin Koh and Jae-Seoun Hur 1

2

*Department of Biology, Department of Applied Biology, Department of Environmental Education, Sunchon National University, Sunchon 540-742, Korea Twenty lichen genus Bryoria taxa were recognized and recorded 1

2

in the Sino-Himalayas. Among them, Bryoria fastigiata L. S. Wang and B. flocculosa L. S. Wang are new species; B. himalayana var. sorediata L. S. Wang is a new variety; Bryoria nadvornikiana, B. trichodes subsp. trichodesare new to China and B. trichodes subsp. americana, B. furcellataare new to the SinoHimalayas. Secondary chemical products were studied for each taxon. Usnic and lobaric acids were first reported in the genus

249

from the region. A key to the species and notes on morphology, habitat and distribution are given in this study.

The Fruiting Body of Oudemansiella radicata formed on the Sawdust Media

Yong Il Kim, Kwang Choon Chang, Youn Su Lee , Jae Ouk Shim, U Youn Lee , Tae Soo Lee and Min Woong Lee* 1

2

2

Department of Biology, Dongguk University, Seoul 100-715, Korea. Division of Applied Plant Science, Kangwon National University, Chuncheon 200-701. Department of Biology, University of Incheon, Incheon 402-749, Korea 1

2

Oudemansiella radicata, one of edible fungi belongs to Tricholomataceae of Agaricales, and has been known to exhibit outstanding therapeutic effects on the hypertension caused by a high pressure of blood into human, s blood vessels, and inhibitory effects on the sarcoma 180 and Erhrlich carcinoma. As one of preliminary experiments for achieving mass production of O. radicata, this study was carried out to check its mycelial growth and fruiting body in the sawdust media mixed with each of some additives (such as rice bran, powder of fermented soybean or wheat bran). After 110 days of incubation in column (20 × 2.0 cm), the fruiting bodies of O. radicata have been formed gradually on the surface of sawdust media and observed in the sawdust media mixed with each of rice bran, powder of fermented soybean or wheat bran. Particularly, the fruiting bodies of O. radicata were formed more intensively in the sawdust media mixed with rice bran than soybean or wheat bran.

Biocontrol of Pear Scab by Using Antagonistic Soil-fungi

Fun Hee Bae*, Su Bin Min, Cheong Ha Park, Yeong Sub Park , Jae-Seoun Hur and Young Jin Koh 1

2

3

Chonnam Science High School, Pear Experiment Station, National Horticultural Research institute, Department of Environmental Education, Department of Plant Medicine, Sunchon National University 1

2

3

A biofungicide against Venturia nashicola, causal agent of pear scab, was developed in this study. The antifungal agent of Trichoderma atroviride against the pathogen was selected among 72 fungal isolates from pear orchard soil. The fungal antagonist successfully colonized the hypha of the pathogen. The antagonist grew well on the condition of pH 5.4 to 5.6, and 26 to 28 C. There was no difference in growth rates of the antagonist on potato dextrose agar (PDA) between full strength (20 g/l) and half strength of concentration. Spore was effectively formed at PDA concentration of 5 g per liter. Mixtures of corn starch with mung bean hull or rice bran were found to the most effective materials of carbon and nitrogen source for mass cultivation of the antagonist. A granule formulation of biofungicide with use of T. atroviride spore exhibited preventive and curative activity in controlling pear scab. There were no side effects of the biofungicide on non-target organisms such as animals, insects and plants. For example, no harmful effects on behavior, birth and growth of white rats were detected. The flora of soil microorganisms was likely to be affected by the application of the biofungicide, but gradually recovered to the initial status. The results suggest that the biofungicide of T. atroviride can be an alternative disease control strategy to synthetic fungicides with emphasis on human health and environmental safety. o

Resistance Analysis of Cultivars and Occurrence Survey of Fusarium Wilt on Strawberry Myeong Hyeon Nam, Nam Gyu Kim , Suck Kee Jung, Sung Joon Yoo and Hong Gi Kim * 2

1

2

250


Nonsan Strawberry Experiment Station, Chungnam ARES, Nonsan 320-862, Korea. Bioshield Co. Ltd. HTVC KAIST, Daejeon 305-701, Korea. Dept. of Appl. Biol., Chungnam National University, Daejeon 305-764, Korea 1

2

The occurrence of Fusarium wilt in strawberry fields in Korea was assessed from 2001 to 2003. Fusarium wilt was found from June to August in nursery beds, from September to October after planting in production beds, and from January to March during harvesting period. The symptoms were root rots, discolored vascular tissue in the crown and deformation and yellowing of central leaflets. The disease occurred in up to 30% of plants in 37 of 214 fields surveyed. Fusarium wilt occurred from cvs. ‘Dochiodome’, ‘Maehyang’, ‘Redpearl’, ‘Samaberry’ and ‘Akihime’ and more severe from cvs. ‘Samaberry’, ‘Maehyang’ and ‘Dochiodome’. Infested soils had high salt concentrations, high nitrogen, phosphate concentrations and low pH. The results of pathogenicity test showed that Fo47 and Fo79 isolated from cvs. ‘Dochiodome’ and ‘Samaberry’ were strong pathogenic to all of four cultivars and ‘Dochiodome’, ‘Redpearl’, ‘Maehyang’ were relatively susceptible to the all isolates.

Morphological and Phylogenetic Analysis of Penicillium Species Associated with Blue Mold of Citrus in Korea

Mi Sun Ko*, Soh Young Oh , Myung Soo Park and Seung Hun Yu 1

Plant Pathology, College of Agriculture and Life Sciences, Chungnam National University. Postharvest Technology Research Division, National Horticultural Research Institute, Suwon 440706, Korea A total of 120 isolates of Penicillium species were isolated 1

from citrus in Korea. According to cultural and micromorphological characteristics, the Penicillium species were divided into approximately 6 groups. On the basis of previous description by Pitt (1991), each group was identified as P. digitatum, P. italicum, P. expansum, P. sp. P. solitum and P. polonicum. The predominant species was P. digitatum (41.6%) followed by P. italicum (32.5%). Phylogenetic analysis of the β-tubulin gene sequence also revealed that the isolates were divided into 6 distinct species-groups, which correlated well with morphological species.

Fungal Flora in Agricultural Upland Lysimeter Treated with Sewage Sludge Kang-Hyo Lee*, Hang-Yeon Weon, Soon-Ja Seok, Soon-Ik Kwon , Yang-Sup Kim, Jae-Mo Sung and Wan-Gyu Kim 1

2

Applied Microbiology Division, National Institute of Agricultural Science and Technology, Rural Development Administration, Suwon. Environment and Ecology Management Division, National Institute of Agricultural Science and Technology, Rural Development Administration, Suwon. Dept. of Agricultural biology, Kangwon Nat’l Univ., Chuncheon 1

2

In this study, influence of sewage sludge on fungal diversity and soil characteristics was investigated and relationships between fungal flora and soil quality were analyzed. The fungal flora was investigated from the lysimeter soil treated with municipal sewage sludge (MSS), pig manure compost (PMC), industrial sewage sludge (ISS), leather processing sludge (LS), and alcohol fermentation processing sludge (FS). Fungal populations were higher in the FS, ISS, LS, or MSS-treated soil than in the chemical fertilizer-treated soil. Isolated fungi from the sewage sludge were identified as Penicillium spp., Gliocladium spp., Acremonium spp., Trichoderma spp., Aspergillus spp., Blastomyces spp., and Phoma spp. To study the effect of sludge and

heavy metals on fungal diversity, Isolated strains were cultured on solid media added with heavy metals and sewage sludge for 7 days at 25 C. The experiment results showed that mycellial growth pattern of fungal isolates varied depending on the added materials. Cultural characteristics of selected isolates could provide an opportunity for the biological risk assessment of contaminants in agricultural/natural land. It needs more research to clarify relationships between fungal species and the physical/ chemical properties in the contaminated soil. o

Proton Beam Sensitivity of Basidiospore and Mycelium in Pleurotus ostreatus Hye Jin Kwon and Won-Sik Kong

1

Doorae Research Institute for the Environment-Friendly Agriculture, Seoul, Korea. Applied Microbiology Division, National Agricultural Science and Technology, RDA, Suwon, Korea To induce the cellulolytic variants of oyster mushroom (Pleurotus ostreatus), basidiospores and mycelium were irradiated at 1

the dose of 10 Gy~2 kGy of proton beam. After irradiation, to assess the effects of proton beam on radiation sensitivity of the basidiospore and mycelium, the germination rate and microscopic changes were analysed. By the proton beam radiation, the germination rates increased at the dose of 10 Gy~100 Gy. D10 values of basidiospore and mycelium of Pleurotus ostreatus were 1 kGy and 500 Gy, respectively. To use the proton beam for mutation source, proper dose on oyster mushroom would be below 750 Gy and mycelium was more sensitive on proton beam radiation than basidiospores.

Developing RAPD-Derived Specific PCR Primers for Cordyceps militaris Han Gyu Ko*, Hyuk Gu Park, Seong Hwan Kim , Jae Mo Sung and Won Mok Park 1

2

*School of Life Sciences and Biotechnology, Korea University. Department of Microbiology and Institute of Basic Science, Dankook University. Department of Applied Biology, Kangwon National University 1

2

To develop Cordyceps militaris specific PCR primers, random amplified polymorphic DNA (RAPD) analysis was performed against twenty-seven isolates of five Cordyceps species and two entomopathogenic species with different geographical origin. Tests with Operon primer sets resulted in amplification of DNA fragments ranged from 100 bp to 5 kb sizes. Among the tested primers, OPA-01, OPA-10 and OPA-13 primers produced DNA fragments of 300 bp to 3 kb. Genetic distance analysis of the RAPD bands resolved the separation of C. militaris from C. scarabaeicola, C. pentatomi, C. yongmoonensis, C. longissima, Shimizuomycea paradoxa, and Paecilomyces tenuipes. A DNA band among the RAPD bands was found to be unique to C. militaris. Subsequently, it was isolated and its nucleotide sequence was determined. Based on the determined sequence, PCR primers was designed and tested against all the isolates used in this study. The primers amplified the DNA only from C. militaris, indicating that the RAPD-derived primers are specific for C. militaris.

Molecular Cloning of a Cellulase-like Gene from a Sapstaining Fungus Ophiostoma piceae Min Woo Hyun* and Seong Hwan Kim

Department of Microbiology and Institute of Basic Science, Dankook University

Ophiostoma piceae is one of most dominant sapstaining species. In an effort to understand its nutrient physiology, we have been

Abstracts of the 2005 Spring Meeting of the Korean Society of Mycology working on the enzymes utilized for carbon acquisition. In this study we report cloning and sequencing of a cellulase-like gene from the sapstaining fungus. Based on information of a partial cDNA sequence of one of O. piceae EST clones that had been generated from the fungal cells grown on a starch-supplemented medium, the full length gene of the EST clone was obtained from genomic DNA of the fungus through RACE-PCR approach and its nucleotide sequence was determined. The determined sequence is about 1.5 kb in size and found to be homologous with other fungal cellulase-coding genes. Analysis through protein-databases of the deduced protein sequence of the gene suggests that the cloned gene could be cellobiohydrolase I, a family 7 of glycosylhydrolases containing N-terminal transmembrane domain and non-containing C-terminal cellulose binding domain. The putative O. piceae CHB I has molecular mass of about 50kD and N-glycosylation sites. Further properties of the protein will be presented.

Microscopic Studies on Conidiogenesis of Cordyceps militaris

Bhushan Shrestha*, Sang-Kuk Han, Kwon-Sang Yoon and JaeMo Sung 1

Entomopathogenic Fungal Culture Collection, Department of Applied Biology, Department of Microbiology, Kangwon National University, Chuncheon 200-701, Korea Conidia development of Cordyceps militaris was observed from 1

germinating ascospores and vegetative hyphae through light microscopy and scanning electron micrographs (SEM). Under submerged condition in sterile water, partspores germinated mostly in unidirectional after 12~24 h of ascospore discharge. Germinating hyphae were mostly simple and unbranched. Conidia were developed directly in tips of germinating hyphae within 36 h of ascospore discharge, showing microcyclic conidiation character of C. militaris. Usually, firstformed conidia were cylindrical or clavate followed by globose and ellipsoidal ones in slimy heads. On SDAY agar medium, slimy heads of conidia developed on variously arranged phialides, from solitary to whorl, on sixth day of ascospore discharge. Conidia were shown to be uninucleate with DAPI staining. Conidiogenous cells were not much differentiated from vegetative hyphae, although they were more slender and pointed towards tip. Microcyclic conidiation, undifferentiated conidiogenous hyphae (phialides), polymorphic conidia and solitary, opposite to whorled types of phialidic arrangements are reported here as the characteristic features of anamorph stage of C. militaris, which can distinguish it from other similar Cordyceps species.

Cordyceps Diversity in Nepal Bhushan Shrestha* and Jae-Mo Sung

Entomopathogenic Fungal Culture Collection, Department of Applied Biology, Kangwon National University, Chuncheon 200-701, Korea Cordyceps species (Clavicipitaceae, Hypocreales, Ascomycota)

have been reported from different parts of the world. The species infect different stages of insects ranging from larva to adult, kill them and eventually grow out of dead bodies of insects, except few which grow on hypogeal Elaphomyces species. Only few Cordyceps species, including C. sinensis, have been reported from Nepal. However, scientific research on these species has been lacking although knowledge on their medicinal properties such as tonic and aphrodisiac values, are common in the Nepalese society. The present study has been carried out to explore the Cordyceps species and other entomopathogenic fungal flora around Kathmandu Valley and few high altitude loca-

251

tions of Nepal since 1997. In this paper, we report natural existence of different Cordyceps species such as C. agriota, C. gracilis, C. ishikariensis, C. konnoana, C. liangshanensis, C. martialis, C. militaris, C. nigrella, C. nutans, C. pruinosa, C. scarabaeicola, C. sinensis, C. sphecocephala, C. tricentri and allied genera Beauveria, Gibellula, Hirsutella, Paecilomyces and Polycephalomyces, showing their diversity in Nepal. Further collections from different ecological regions of Nepal will show the richness of Cordyceps diversity of Nepal. Scientific descriptions of Nepalese Cordyceps and allied species will help to generate consciousness among general people of Nepal regarding their commercial values.

Cultural Characteristics and Mating System of Cordyceps

kyushuensis Kwang-Yeol Jeong*, Sang-Kuk Han, Won-Ho Lee and Jae-Mo Sung

Entomopathogenic Fungal Culture Collection, Department of Applied Biology, Kangwon National University, Chuncheon 200-701, Korea

This experiment was carried out to observe cultural characteristics and artificial fruit body formation of Cordyceps kyushuensis C. kyushuensis isolates preserved in Entomopathogenic Fungal Culture Collection (EFCC), Kangwon National University, were used in the present study. The optimal medium, temperature and pH level for mycelial growth of C. kyushuensis were SDAY, 25 C and 6.0, respectively. Optimal carbon sources, nitrogen sources and mineral salts for the mycelial growth were dextrin, yeast extract and KH2PO4, respectively. It could be shown that fruiting bodies were produced from combinations of single spore strains. Single spore strains, however, did not produce stromata without combination. It is concluded that C. kyushuensis is a heterothallic fungus. o

Distribution and Characteristics of Cordyceps species Infecting Cicadae in Korea

Jae-Mo Sung*, Kwang-Yeol Jeong, Bhushan Shrestha, SungKeun Choi, Won-Ho Lee, Sang-Kuk Han, Je-O Lee, Jung-Hoon Lee and Soo-Yong Lee 1

Entomopathogenic Fungal Culture Collection, Department of Applied Biology, Kangwon National University. Mushtech Co. Ltd, Chuncheon 200-701, Korea 1

This study reports the distribution of Cordyceps and related species growing on dead larva and adults of Cicadae in Korea. The specimens collected from 1990 till 2004 by Entomopathogenic Fungal Culture Collection (EFCC), Kangwon National University, were observed during the present study. Eleven species belonging to fiver genera were identified. In the genus Cordyceps, C. heteropoda, C. ishikariensis, C. longissima, C. prolifica, C. ramosopulvinata, C. sobolifera and C. yakushimensis were identified. Other genera growing on Cicadae were Beauveria, Metarhizium, Paecilomyces and Isaria species. In the genus Beauveria, B. bassiana was identified. In the genus Isaria, I. takamizusanensis wass identified. In the genus Metarhizium, M. anisopliae was identified. In the genus Paecilomyces, P. tenuipes and P. cicadae were identified. C. heteropoda, C. longissima, C. prolifica, C. ramosopulvinata and C. sobolifera were mostly collected from Jeju-Do, the southernmost part of Korean peninsula. However, anamorph species, B. bassiana, M. anisopliae, P. cicadae and P. tenuipes, were collected from different parts of Korea. Late May to August was found the optimum period for collection of Cicadae-grown Cordyceps species.

252


Diversity of Cordyceps and its Allies in Cuc Phuong National Park, Vietnam

Sang-Kuk Han*, Kwang-Yeol Jeong, Jae-Mo Sung, Pham Thi Vuong and Luong Van Ha 1

2

Entomopathogenic Fungal Culture Collection, Department of Applied Biology, Kangwon National University, Chuncheon 200-701, Korea. National Institute for Plant Protection, Hanoi, Vietnam. Scientific and International Co-operation Department, Cuc Phuong National Park, Vietnam For investigating the species diversity of Cordyceps and its 1

2

allied species in Cuc Phuong National Park, Vietnam, a field survey was done from February 25 to 28, 2005. In this study, a total of 48 specimens were collected from 9 sites and investigated for macroscopic and microscopic features. Three different Cordyceps species, viz. C. nutans, C. pruinosa, C. shpecocephala, have been described from Vietnam for the first time. Similarly, other Cordyceps allied species, such as Beauveria bassiana, Gibellula sp. have also been reported as new entomopathogenic-fungal species to Vietnam. Monitoring of such fungal species show that Cordyceps diversity exists in Vietnam too, which can be explored for its application such as medicinal, biological control activities, etc. Regular monitoring of entomopathogenic fungal flora is highly recommended in future at different seasons of the year.

In vitro Synnemata Production of Cordyceps staphylinidaecola using Single Conidium Isolates Je-O Lee*, Bhushan Shrestha, Jung-Hoon Lee and Jae-Mo Sung Entomopathogenic Fungal Culture Collection, Department of Applied Biology, Kangwon National University, Chuncheon 200-701, Korea Synnemata of Cordyceps staphylinidaecola were successfully

produced in artificial condition in brown rice medium. To understand the fruiting characteristics of C. staphylinidaecola, single conidium isolates were used for synnemata production. Some of the single conidium isolates of C. staphylinidaecola produced synnemata, whereas others produced only mycelial growth without any synnemata formation in brown rice medium. Combination of single conidium isolates produced sectors of both synnemata and only mycelial growth. In vitro synnemata were produced continuously from subcultures of the potential isolates. Perithecial stromata were occasionally produced from subcultures of few single conidium isolates. Further researches are required to determine optimum conditions for continuous production fertile stromata of C. staphylinidaecola in artificial condition. Asexual stage of C. staphylinidaecola was observed as Beauveria type.

Distribution of Cordyceps militaris in Korea

Sung-Keun Choi, Won-Ho Lee*, Sang-Kuk Han, Kwang-Yeol Jeong, Bhushan Shrestha, Soo-Yong Lee and Jae-Mo Sung 1


This study reports the distribution pattern of Cordyceps militaris in Korea. A total number of 1454 specimens of C. militaris collected by Entomopathogenic Fungal Culture Collection (EFCC), Kangwon National University, Korea from 1986 to 2004 were observed during the present study. Distribution of C. militaris varied according to regions of Korea. The highest number of 760 specimens were collected from Gangwon-Do, followed by 314 specimens from Jeju-Do, 100 specimens from ChungbukDo, 85 specimens from Jeonbuk-Do, 78 specimens from Chun-

gnam-Do, 59 specimens from Gyeonggi-Do, 51 specimens from Gyeongbuk-do and the least number of 6 specimens from Jeonnam-Do. The collection period of C. militaris ranged from midMay to early October every year. The highest numbers of 755 specimens were collected in August, followed by 550 specimens in July, 115 specimens in September, 21 specimens in June, 7 specimens in May and the least number of 6 specimens in October.

Favorable Condition of Mycelial Growth by Tricholoma

matsutake Won-Ho Lee, In-Yeup Kim, Young-Jin Kim, Young-Hyun Lee, Sang-Kuk Han, Gwang-Reul Jung, Soo-Yong Lee and Jae-Mo Sung 1


The main objectives of this research were to study the cultural and nutritional characteristics of Tricholoma matsutake and to establish its liquid culture system. The optimum growth of T. matsutake was observed in HA and TMM agar media. Similarly highest growth was observed in PDB and TMM liquid media. The optimal temperature for the mycelial growth was 25 C. Most suitable carbon source was dextrin among 12 different carbon sources. Yeast extract and peptone were best nitrogen sources among 17 different sources. The optimum mineral salts were Fe (SO ) H O and KCl among 9 different sources. Shaking culture gave higher mycelial growth compared to stationary culture. Similarly, optimum medium amount for shaking culture was 100 ml per 250 ml flask. Highest mycelial growth was obtained when 5~7 mycelial discs were inoculated in 100 ml of medium and incubated for 8~9 weeks, respectively. Highest proportion of mycelial growth was observed at 40:1 ratio of medium to inoculum volume in 8 l air-lift fermenter. o

2

4 3

2

Major Factors for the Production of Exo- and Endo-polysaccharides in Submerged Culture of Ganoderma applanatum Wi Young Lee*, Youngki Park, Jin Kwon Ahn and So Young Park

Div. Biotechnology, Korea Forest Research Institute, Suwon, 441-350, Korea

Submerged culture of edible fungiobviously have the potential for higher mycelial production or inducing mass production of useful substances in compact space in short time period with easy environmental control. The aim of this investigation was to determine optimal polysaccharide production conditions from G. applanatumin submerged culture. In order to produce the immunostimulating water soluble polysaccharides from the mycelium, effects of several cultivating factors on polysaccharides production were studied. Carbon sources, carbon concentrations, culture temperature and culture period influenced most on the production of the polysaccharides. The effective carbon sources for polysaccharide productions were maltose and glucose. High yield of the exo-polysaccharide required higher temperature (25 C), higher carbon concentrations (60 g/l), and shorter culture period (8~12 days). In contrast, endo-polysaccharide production required lower culture temperature (10~ 15 C), lower level of carbon (20 g/l) and minimal 10 day culture period. G. applanatum accumulated endo-polysaccharide in their bodies at lower temperature condition. Meanwhile more exo-polysaccharides were produced at the moderate temperature and in the stationary growth phase. Under the optimal culture o

o

Abstracts of the 2005 Spring Meeting of the Korean Society of Mycology conditions, the yield of water soluble endo-polysaccharides and exo-polysaccharides reached 4% and 2 g/l, respectively.

The Contents of Ergosta-4,6,8(14), 22-Tetraen-3-one in Fruitbody and Mycelia of Mushrooms

Wi Young Lee*, Youngki Park, Jin Kwon Ahn and So Young Park Div. Biotechnology, Korea Forest Research Institute, Suwon 441-350, Korea

Ergosta-4, 6, 8 (14), 22-tetraen-3-one (erogone) was reported as a diuretic functioning compound from the sclerotia of G. umbellata. We also reported the cytotoxic activities of the erogone against human cancer cell lines of HT-29 (colon cancer), HeLa 229 (cervix cancer), Hep3B (liver cancer) and AGS (stomach cancer). Erogone strongly inhibited all cell lines as dose increased. In the present study, we measured the content of erogone in eight kinds of fruitbody (G. umbellata, Lentinus edodes, Ganoderma applanatum, Tricholoma matsutake, Sarcodon aspratus, Ramaria botrytis, Pleurotus eryngii, and Sparassis crispa) and four kinds of mycelia (G. umbellata, L. edodes, G. applanatum and T. matsutake) using HPLC. Every mushrooms contained the compound. The erogone content of fruitbodies and mycelium were in the range of 4.8~29.0 µg/g and 15.5~38.0 µg/g, respectively. Especially, mycelia contained more amounts of erogone than that of fruitbody. The mycelia of G. umbellata and T. matsutake had high amounts of erogone.

Peronospora oblatospora sp. nov. from Korea is Described

using Morphological and Molecular Data

Young-Joon Choi, Seung-Beom Hong and Hyeon-Dong Shin* 1

Division of Environmental Science and Ecological Engineering, College of Life and Environmental Sciences, Korea University, Seoul 136-701, Korea. Korean Agricultural Culture Collection, National Institute of Agricultural Biotechnology, Rural. Development Administration, Suwon 441-707, Korea 1

Peronospora oblatospora, collected recently from Potentilla paradoxa in Korea, is described as a new undescribed species. It is morphologically distinguished from two known species, P. sparsa and P. potentillae, which cause downy mildew on the Rosaceae. The oblate conidia with the lower length/width ratio represent an important morphological characteristic of the species. The high distances and the larger insertions in ITS rDNA, compared with two latter species, also supported that P. oblatospora is a phylogenetically distinct species.

Taxonomic Re-evaluation of Bremia lactucae, B. microspora, B. ovata, B. saussreae, and B. sonchicola Infecting the Asteraceae Hosts Based on Molecular Data

Young-Joon Choi, Seung-Beom Hong and Hyeon-Dong Shin* 1

Division of Environmental Science and Ecological Engineering, College of Life and Environmental Sciences, Korea University, Seoul 136-701, Korea. Korean Agricultural Culture Collection, National Institute of Agricultural Biotechnology, Rural Development Administration, Suwon 441-707, Korea Bremia lactucae, B. microspora, B. ovata, B. saussreae, and B. sonchicola are closely related downy mildew pathogens of host plants in the family Asteraceae, but only B. lactucae is orig1

inally regarded to infect various hosts of the family. Relationship among these fungi was determined based on molecular data. Phylogenetic analysis of the mitochondrial cytochrome c oxidase subunit II (COX2) gene and nuclear rDNA (28S) sequences were carried out, and all five Bremiaspecies were respectively shown to form independent clades, using Bayesian inference and maximum parsimony, and share a high level of

253

sequence distances. From these results, it is proposed that the names, Bremia lactucae, B. microspore, B. ovata, B. saussreae, and B. sonchicola should be regarded as the independent taxa, which cause downy mildew in the Asteraceae.

Identification of Ophiostomaips, One of Deep Staining Fungi Occurring on Korean Pinewood

Seong Hwan Kim*, Jae-Jin Kim , Colette Breuil and GyuHyeok Kim 1

1

2

Dept. of Wood Science, University of British Columbia. Dept. of Microbiology and Institute of Basic Science, Dankook University*. Dept. of Forest Resources and Environmental Sciences, Korea University 1

2

The Ophiostoma genus includes many fungal species causing wood discoloration that is worldwide problem in forest products industry. In Korean pine, the major pine tree species in Korea, several Ophiostoma fungi have been isolated. In this study, we investigated the morphology and molecular properties of one of those species that cause deep reddish-brownstain. The fungal species was cycloheximide resistant, grew optimally at 30 C, and produced dark perithecia with a neck. Light and scanning electron microscopic observations of its morphology showed that the fungus bears a resemblance to known Ophiostoma ips, one of recalcitrant species for identification. Phylogenetic analyses based on ITS rDNA and -tubulin gene sequences revealed that the fungus is very closely grouped with O. ips. The fungus caused serious stain when it was inoculated on Korean pinewood. Overall the fungus has been identified as O. ips. This is first confirming report of its presence in Korea.

Selection Cell Lines of Pleurotus ostreatus Tolerant to Salinity on PDA and Sawdust Medium

Jong-In Choi*, Tai-Moon Ha, Jeong-Hyun Chi and YoungCheol Ju

Mushroom Research Institute Gyeonggi Province ARES, 464870, Korea

This study was carried out to select cell lines of oyster mushroom tolerant to salinity on PDA and sawdust medium. Among the 64 lines, Kimjae-10ho, Nongki-2-1ho, Myungyul, Byungneutari-1ho, Bupyungsoyae-1ho, Sambok and Chunchu-2ho resulted in higher mycelial growth and density on PDA medium containing NaCl. Increased NaCl concentration on sawdust medium prolonged culture period, days to germination and fruit-body formation, while decreased total quantity. The maxium NaCl concentration possible to fruit body formation was 0.5% NaCl in Myungyul, 1.0% NaCl in Kimjae-10ho and Bupyungsoyae-1ho, 1.5% NaCl in Nongki-2-1ho, Byungneutari1ho, Sambok and Chunchu-2ho, respectively. In the medium composed of sawdust, Maximum NaCl concentration in which production were similar to control varied according to cultivars, e.g., 0.65% in Nongki-2-1ho, 0.35% in Sambok, 0.25% in Chunchu-2ho, and 0.71% in Byungneutari-1ho. NaCl concentration affected product yield in Nongki-2-1ho, showing 162.7g in control, 131.7 g at 0.5%, 90.3 g at 1.0%, 84.0 g at 1.5%, respectively. Higher NaCl concentration in the medium decreased the uptake rate of K O and CaO, whereas increased the NaCl uptake rate up to 0.45% at 1.0% NaCl-containing medium. 2

New Interesting Symbiont Species of Agaricales - Clitocybe alboinfundibulliforme and Volvariella koreana -

Soon-Ja Seok* and Yang-Sup Kim

Applied Microbiology Division, National Institute of Agricultural Sciences and Technology, R.D.A., Suwon 441-707, Korea

254


Clitocybe alboinfundibulliforme and Volvariella koreana are described as new species, respectively. Fruiting bodies of the two taxa sometimes appeared together and were collected at the same place in sookji-san, Suwon in August, 1998 and garden in NIAST, Suwon in August 2001. The detailed description and illustrations are given in this paper. Both of thesespecies seem to be associated with each other and are very uncommon in the Korean peninsula.

A Taxonomical Study of Korean Myxomycota

Sol Yun*, Yang-Sup Kim, Kang-Hyo Lee, Soon-Ja Seok, TaeWan Kim and Kyong-Hee Min 1

2

Department of Applied Microbiology, NIAST, RDA, Suwon 441707, Korea. Department of Plant physiology, Hankyong National University, Ansung 456-749, Korea. Department Biology, Sook Myoung Women University, Seoul 140-742, Korea 1

2

For investigating the species diversity and flora of Korean Myxomycota, a total of 68 specimens collected from nine locations, Mt. Solak-san, etc. from in June, 2004 to April, 2005 have been investigated for the macroscopical and microscopical features of fruiting bodies of Myxomycota. Among them, one genus, Physarella “연밥팡이속”, one species Physarella oblonga “연밥팡이” and two varieties, Arcyria stipata var. imperialis “ 황제전통팡이” and Hemitrichia clavata var. calyculata “와인잔 겉털팡이”, were confirmed as unrecorded genus, species and varieties to Korea, respectively and their korean common names were designated.

Detection of a Novel Single-stranded RNA Mycovirus in Flammulina velutipes Si Jung Ha, Jun-Oh Choi*, Sung-Soon Kim, Hyeon-Su Ro and Hyun-Sook Lee

Devision of Biological Science, College of Natural Science, Gyeongsang National University

A novel mycovirus was isolated from Flammulina velutipes using a purification procedure involving PEG-NaCl precipitation, differential centrifugation, and equilibrium centrifugation in CsCl gradient (1.585 g/ml). The virion encapsidated two singlestranded RNAs of 4 and 1.5 kb by a coat protein of about 60 kDa. The new mycovirus was named Flammulina velutipes Spherical Virus (FvSV). We developed FvSV detection system using ELISA and PCR. For ELISA, three monoclonal antibodies in mouse and polyclonal antibody in rabbit against the FvSV were made. The monoclonal and polyclonal antibodies against FvSV could not cross-react with OMSV, OMIV-I, OMIV-III. For PCR detect-system FvSV-specific primers were made.

Phylogenetic Classification of Edible Mushroom Pleurotus eryngii Cultivated in Korea Hyeon-Su Ro, Sung-Soon Kim*, Jae San Ryu , Tae Su Lee and Hyun-Sook Lee 1

2

Division of Biological Sciences, Gyeongsang National University. GyeongNam Agricultural Research and Extention Services. Department of Biology, Incheon University Edible mushroom Pleurotus eryngii is one of the most culti1

2

vated mushrooms in Korea. Because of variable sources of the mushroom cultivars, it becomes of a great concern to verify original sources of each cultivar for the consistent supply and stable maintenance. We first classified 24 most cultivated P. eryngii mushrooms using a random amplified polymorphic DNA (RAPD) method. The variants of the mushrooms were gathered from the farms in the southern part of Korea. The chromosomes of each mushroom were extracted and RAPD was performed using 18 random primers. Each primer produced more than 5 PCR fragments in agarose gel electrophoresis analysis. The DNA patterns of gels were analyzed using a computer software equpped in a gel documentation system. The result showed that P. eryngii in Korean farm can be classified into 5 subfamilies. The classification data was well-matched with the physiological data such as culture temperature, morphology, height, etc., indicating our classification based on RAPD can be one of the useful method to classify mushrooms in the field.

Fruitbody Type and Mycelium Cultural Character of the Diverse Strains of Hericium erinaceus Kyung-Ju Jung*, Duck-Soo Choi, Hyeung-Kuk Choi, Jung-Sik Park and Ki-Chul Chung 1

2

Crop Research Division, Jeonnam Agricultural Research and Extension Service, Naju 520-715, Korea. Division of Applied Microbiology, NIAST, RDA, Suwon 441-707, Korea. School of Biological Sciences and Technology, Biotechnology Research Institute, Chonnam National University, Gwangju 500-757, Korea For selection of the most potential strain of Hericium erinaceus, 1

2

the optimum culture media for origin mycelium growth, hyphal growth at different temperatures, productivity at different media composition and fruitbody type of 18 strains were studied. Though the hyphal growth was very diverse as medium species and strains of H. erinaceus, Hamada medium was the best for most strains growth. The hypha of H. erinaceus growing quickly at high temperature the range of 17~26 C than low temperature. Mycelium culture periods was very diverse from 15 days to 32 days. 4 strains (MKACC 51863, 51869, 51875, China No.14) was most short to 15 days and 2 strains (MKACC 51865, 51874) was the latest to 32 days. Fruitbody type could divided 3 types to pine type (10 strains), sponge type (2 strains) and coral type (3 strains). The pine type was short the culture period and bitter the fruitbody taste, whereas the coral type was less bitter the fruitbody taste. The optimum media composition for product the H. erinaceus was oak sawdust 80% + rice bran 10% + wheat bran 6% + sugar cane molasse 4%. It could increase 18% of productivity than conventional practices. o