1
Molecular Breeding 11: 1–13, 2003. © 2003 Kluwer Academic Publishers. Printed in the Netherlands.
Accumulation of trehalose within transgenic chloroplasts confers drought tolerance Seung-Bum Lee 1, Hawk-Bin Kwon 2,3, Soo-Jin Kwon 2, Soo-Chul Park 2, Mi-Jeong Jeong 2, Sang-Eun Han 2, Myung-Ok Byun 2 and Henry Daniell 1,* 1 Molecular Biology and Microbiology Department, University of Central Florida, 336 Biomolecular Science (Bldg #20), Orlando, FL 32816-2360, USA; 2Molecular Genetics Division, National Institute of Agricultural Science and Technology, Suwon, 441-707, Korea; 3Current address: Division of Applied Biological Sciences, Sunmoon University, Asan, 336-840, Korea; *Author for correspondence (e-mail:
[email protected]; phone: 407-823-0952; fax: 407-823-0956)
Received 18 July 2001; accepted in revised form 13 November 2001
Key words: Abiotic stress tolerance, Chloroplast genetic engineering, Clean-gene technology, Drought tolerance, Genetically Modified Crops Abstract Yeast trehalose phosphate synthase (TPS1) gene was introduced into the tobacco chloroplast or nuclear genomes to study resultant phenotypes. PCR and Southern blots confirmed stable integration of TPS1 into the chloroplast genomes of T 1, T 2 and T 3 transgenic plants. Northern blot analysis of transgenic plants showed that the chloroplast transformant expressed 169-fold more TPS1 transcript than the best surviving nuclear transgenic plant. Although both the chloroplast and nuclear transgenic plants showed significant TPS1 enzyme activity, no significant trehalose accumulation was observed in T 0/T 1 nuclear transgenic plants whereas chloroplast transgenic plants showed 15–25 fold higher accumulation of trehalose than the best surviving nuclear transgenic plants. Nuclear transgenic plants (T 0) that showed even small amounts of trehalose accumulation showed stunted phenotype, sterility and other pleiotropic effects whereas chloroplast transgenic plants (T 1, T 2, T 3) showed normal growth and no pleiotropic effects. Transgenic chloroplast thylakoid membranes showed high integrity under osmotic stress as evidenced by retention of chlorophyll even when grown in 6% PEG whereas chloroplasts in untransformed plants were bleached. After 7 hr drying, chloroplast transgenic seedlings (T 1, T 3) successfully rehydrated while control plants died. There was no difference between control and transgenic plants in water loss during dehydration but dehydrated leaves from transgenic plants (not watered for 24 days) recovered upon rehydration turning green while control leaves dried out. These observations suggest that trehalose functions by protecting biological membranes rather than regulating water potential. In order to prevent escape of drought tolerance trait to weeds and associated pleiotropic traits to related crops, it may be desirable to engineer crop plants for drought tolerance via the chloroplast genome instead of the nuclear genome. Introduction Water stress due to drought, salinity or freezing is a major limiting factor in plant growth and development. Trehalose is a non-reducing disaccharide of glucose and its synthesis is mediated by the trehalose6-phosphate (T6P) synthase and trehalose-6-phosphate phosphatase complex in Saccharomyces cerevisiae. In S. cerevisiae, this complex consists of at least
three subunits performing either T6P synthase (TPS1), T6P phosphatase (TPS2) or regulatory activities (TPS3 or TSL1, Thevelein and Hohmann (1995) and Singer and Lindquist (1998)). Trehalose is found in diverse organisms including algae, bacteria, insects, yeast, fungi, animal and plants (Elbein 1974). Because of its accumulation under various stress conditions such as freezing, heat, salt or drought, there is general consensus that trehalose protects against dam-
2 ages imposed by these stresses (Mackenzie et al. 1988; De Vigilio et al. 1994; Sharma 1997). Trehalose is also known to accumulate in anhydrobiotic organisms that survive complete dehydration (Crowe et al. 1992), the resurrection plant (Bianchi et al. 1993) and some desiccation tolerant angiosperms (Drennan et al. 1993). Trehalose, even when present in low concentrations, stabilizes proteins and membrane structures under stress (Colaco et al. 1992; Iwahashi et al. 1995) because of the glass transition temperature, greater flexibility and chemical stability (Colaco et al. 1995). There have been several efforts to generate various stress resistant transgenic plants by introducing gene(s) responsible for trehalose biosynthesis, regulation or degradation (Holmstrom et al. 1996; Goddijn et al. 1997; Romero et al. 1997; Serrano et al. 1999; Goddijn and van Dun 1999). When trehalose accumulation was increased in transgenic tobacco plants by over-expression of the yeast TPS1, trehalose accumulation resulted in the loss of apical dominance, stunted growth, lancet shaped leaves and some sterility. Altered phenotype was always correlated with drought tolerance; plants showing severe morphological alterations had the highest tolerance under stress conditions. In order to minimize the pleiotropic effects observed in the nuclear transgenic plants accumulating trehalose, this study attempts to compartmentalize trehalose accumulation within chloroplasts. Several toxic compounds expressed in transgenic plants have been compartmentalized in chloroplasts even through no targeting sequence was provided (During et al. 1990; Daniell and Guda 1997) indicating that this organelle could be used as a repository like the vacuole. Also, osmoprotectants are known to accumulate inside chloroplasts under stress conditions (Nuccio et al. 1999). Inhibition of trehalase activity is known to enhance trehalose accumulation in plants (Goddijn et al. 1997). Therefore, trehalose accumulation in chloroplasts may be protected from trehalase activity in the cytosol, if trehalase was absent in the chloroplast. In addition, chloroplast transformation has several other advantages over nuclear transformation (Bogorad 2000; Daniell 1999a,b,c, 2000; Daniell et al. 2002). A common environmental concern about nuclear transgenic plants is the escape of foreign genes through pollen or seed dispersal, thereby creating super weeds or causing genetic pollution among other crops (Daniell 2002). These are serious environmental concerns, especially when plants are genetically
engineered for drought tolerance, because of the possibility of creating robust drought tolerant weeds and passing on undesired pleiotropic traits to related crops. Chloroplast transformation should also overcome some of the disadvantages of nuclear transformation that result in lower levels of foreign gene expression, such as gene suppression by positional effect or gene silencing (Finnegan and McElroy 1994). Chloroplast genetic engineering has been successfully employed to address aforementioned concerns. For example, chloroplast transgenic plants expressed very high level of insect resistance (McBride et al. 1995), due to expression of 10,000 copies of foreign genes per cell, thereby overcoming the problem of resistant insects observed in nuclear transgenic plants (Kota et al. 1999) or offering protection to non-target insects (De Cosa et al. 2001). Similarly, chloroplast derived herbicide resistance overcomes out-cross problems of nuclear transgenic plants because of maternal inheritance of plastid genomes (Daniell et al. 1998; Scott and Wilkinson 1999). Recently, the chloroplast genome has been engineered with an antimicrobial peptide to confer resistance against phytopathogenic bacteria and fungi (DeGray et al. 2001). Availability of tools to engineer the chloroplast genome without the use of antibiotic selection (Daniell et al. 2001a,b) or excise antibiotic resistance genes after the completion of selection process (Iamtham and Day 2000), provide additional incentives for expression of foreign genes in this cellular compartment. Transgenic chloroplast technology has been used to express pharmaceutical proteins or edible vaccines in plants (Daniell et al. 2001c,d; Fernandez-San Millan et al. 2003). This study has been undertaken to extend the chloroplast genetic engineering technology to study abiotic stress and compare chloroplast/ nuclear expression of TPS1 in transgenic plants. This should shed light on the role of trehalose in stabilizing membranes or conferring osmotolerance within chloroplasts.
Materials and methods Tobacco, A. tumefaciens and E. coli culture For transformation experiments, Nicotiana tabacum var. xanthi and Burley were grown in MS medium in the Magenta culture box (Sigma, USA). For drought tolerance assays of transgenic tobacco plants, the
3 rooted young plants were transferred to pre-swollen Jiffy-7 peat pellets (Jiffy Products, Norway) inside the greenhouse. Plants used for enzyme assays were grown and kept in Magenta culture boxes. Seven or 8 leaf stage plants were used for enzyme assays. Two to three-week old young transgenic tobacco plants were used for stress analyses. Agrobacterium tumefaciens strain LBA4404 was grown in the YEP medium at 29 °C in a shaking incubator. Other E. coli strains were cultured and maintained as described in Sambrook et al. (1989). Plasmid construction and antibody production For hyper-expression of the TPS1 in E. coli for antibody production, the yeast TPS1 gene was cloned into plasmid pQE30 (Qiagen) as a BamHI fragment with N-terminal poly-histidine tag (as an EcoRI-BamHI fragment) and subsequently transformed into E. coli strain M15 [pREP4]. The resulting E. coli transformant was grown at 37 °C to an A 600 of 0.5 ⬃ 0.8 and induced by 2 mM isopropyl--D-thiogalactopyranoside (IPTG) for 1 ⬃ 5 hrs. The induced cells were harvested and homogenized by sonication. SDSPAGE analysis showed the presence of TPS1 protein in crude cell extracts, even with Coomassie Blue stain, indicating high levels of expression. Western blot analysis using TPS1 antibody confirmed the true identity of the expressed protein (data not shown). The recombinant protein was purified using Ni 2+ resin, using the procedures provided by the manufacturer. Affinity column purified recombinant protein was analyzed for purity by SDS-PAGE. Protein concentrations were determined using the Bio-Rad (USA) protein assay kit with BSA as a standard. Polyclonal antibody was generated using the purified TPS1 protein by the Takara Shuzo Co. (Japan). Vector construction for plant transformation The yeast 1.57 kbp TPS1 gene was inserted into the XbaI site of pCt vector generating pCt-TPS1 (Figure 1B). For the nuclear transformation, the yeast TPS1 gene was inserted into the pHGTPS1 vector in which the TPS1 gene is driven by the CaMV 35S promoter. The resulting vector confers hygromycin resistance because of the hygromycin phosphotransferase gene driven by the NOS promoter.
Chloroplast and nuclear transformation For chloroplast transformation, particle bombardment was carried out using a helium driven particle gun, Biolistic PDS-1000He. Briefly, chloroplast vectors, pCt and pCt-TPS1 were delivered to tobacco leaves (Burley) using 0.6 m gold microcarriers (Bio-Rad) at 1,100 psi with a target distance of 9 cm (Daniell 1997). For nuclear transformation, pHGTPS1 was mobilized into the Agrobacterium tumefaciens strain LBA4404 by electroporation using Gene Pulsar (BioRad, USA). The resulting Agrobacterium strain was used in leaf disc transformation of wild type N. tabacum var. xanthi. Chloroplast DNA isolation and PCR Total DNA was extracted from leaves of wild type and transformed plants using CTAB extraction buffer described by Dellaporta et al. (1983). PCR was carried out to confirm spectinomycin resistant chloroplast transformants using Peltier Thermal Cycler PTC-200 (MJ Research, USA). Three primer sets, 2P (5’-GCGCCTGACCCTGAGATGTGGATCAT-3’)2M (5’-TGACTG CCCAACCTGAGAGCG GACA3’), 3P(AAAACCCGTCCTCAGTTCGGATT GC) -3M (CCGCGTTGTTTCATCAAGCCTTACG) and 5P(CTGTAGAAGTCACCATTGTTGTG C)5M(GTCCAAGATAAGCCTGTCTAGCTTC) were used for the PCR. PCR reactions were carried out as described elsewhere (Daniell et al. 1998; Guda et al. 2000). RNA isolation and Northern Blot analysis Total RNA was extracted from transgenic tobacco plants using Tri Reagent (MRC, USA) following manufacturer’s instruction. For northern blots, RNA samples (10 g of total RNA per lane) were electrophoresed on a 1.5% agarose-MOPS gel containing formaldehyde. Uniform loading and integrity of RNAs were confirmed by examining the intensity of ethidium bromide bound ribosomal RNA bands under UV light. RNAs on the gel were transferred onto Hybond-N membrane (Amersham, USA). The membrane was hybridized to radiolabeled TPS1 probe and washed at 65 °C in a solution of 0.2X SSC and 0.1% SDS for 20 min twice. The blot was exposed to an X-ray film at − 70 °C overnight. Transcripts were quantified using the BioID++ program with Vilber Lourmat Image Analyzer (Bioprofil, France).
4
Figure 1. A. Map of the nuclear expression vector pHGTPS1. B. Site of integration of foreign genes into the chloroplast genome and expected fragment sizes in Southern blots. P1 is the 0.81 kbp BamHI-BglII fragment containing chloroplast DNA flanking sequences used for homologous recombination. P2 is the 1.5 kbp XbaI Fragment containing the TPS1 coding sequence. The left flanking sequence is the chloroplast trnI gene (1.2 kbp) and the right flanking sequence is trnA gene (0.9 kbp). Please note that both tRNA genes contain introns. All flanking and regulatory sequences present in the chloroplast vector were derived from the tobacco chloroplast genome. C. Southern blot analysis of control, T 1 and T 3 chloroplast transgenic plants. Total plant DNA digested with BglII was hybridized with probes P1 or P2. Lanes: C, untransformed control; 1, T 1 generation chloroplast transformant; 2, T 3 generation chloroplast transformant.
5 Western blot analysis Tobacco total protein extracts were prepared by modified methods described by Ausubel et al. (1995). The total extracts were fractionated on a 10% one-dimensional SDS-PAGE, transferred to Biotrace PDVF nitrocellulose membrane (Gelman Sciences, USA), and immunostained using Renaissance Western Blot Chemiluminescence Reagent (NEN Life Science Products, USA) according to manufacturer’s instructions. Each lane was loaded with 100 g of total protein. The primary antibody used was anti-TPS1 at a 5000-fold dilution. The secondary antibody was antirabbit IgG HRP conjugate at a 2,000-fold dilution. Drought tolerance and biochemical characterization For analyses of drought tolerance, transgenic tobacco plants or seedlings were used. Seeds of chloroplast and nuclear transformants were germinated on MS plates containing 3% or 6% PEG (MW 8,000, Sigma). TPS1 enzyme assay was performed using the method described by Londesbrough and Vuorio (1991). For quantitative determination of T6P and trehalose, carbohydrates were extracted from aerial parts of transgenic or wild type tobacco plants by treatment in 85% ethanol at 60 °C for 1 hr. The amount of T6P and trehalose were measured by high-performance liquid chromatography (HPLC) on a Waters system equipped with a Waters High Performance Carbohydrate Column (4.6 × 250 mm) and a refractive index detector. The insoluble phase system was 75% acetonitrile-25% H 2O with a flow rate of 1.0 ml/min.
Results Expression of chloroplast vectors in E. coli It is known that the yeast trehalose-6-phosphate synthase gene can be expressed well in nuclear transgenic plants (Holmstrom et al. 1996; Romero et al. 1997). Because chloroplasts are prokaryotic in nature, it would have been ideal to use bacterial genes instead of genes from eukaryotic systems. However, the E.coli otsA gene coding for trehalose phosphate synthase was not available for this investigation. Therefore, the TPS1 gene from yeast was cloned into the E.coli expression vector pQE30 and expressed in a suitable E.coli strain. Western blot analysis using TPS1 antibody confirmed the true identity of the expressed pro-
tein (data not shown). These results also suggested that the codon preference of TPS1 is acceptable for expression in a prokaryotic compartment. Also, because of the high similarity in the transcription and translation systems between E. coli and chloroplasts (Brixey et al. 1997), expression vectors are routinely tested in E. coli before proceeding with chloroplast transformation of higher plants (Kota et al. 1999; Daniell et al. 1998; Guda et al. 2000). However, this will not shed light on post-translational events, including proteolytic degradation that may be different between E.coli and chloroplasts. Chloroplast and nuclear expression vectors Having confirmed suitability for prokaryotic expression, the yeast TPS1 gene was inserted into the universal chloroplast expression vector pCt-TPS1 (Figure 1B). This vector can be used to transform chloroplast genomes of several plant species because the flanking sequences are highly conserved among higher plants (Daniell et al. 1998; Guda et al. 2000). This vector contains the 16SrRNA promoter (Prrn) from the tobacco chloroplast genome driving the aadA (aminoglycoside 3⬙- adenylyl transferase) and TPS1 genes with the psbA 3’ region (the terminator from a gene coding for photosystem II reaction center component) from the tobacco chloroplast genome. It is known that the 16SrRNA promoter is one of the strong chloroplast promoters and the psbA 3’ region stabilizes transcripts. In order to avoid hyper-expression of TPS1 and associated pleiotropic effects, the optimal chloroplast ribosome binding site (GGAGG) was not engineered upstream of the start codon. This construct integrates both genes into the spacer region between the chloroplast transfer RNA genes coding for alanine and isoleucine within the inverted repeat (IR) region of the tobacco chloroplast genome by homologous recombination. For nuclear expression, the yeast TPS1 gene was inserted into the binary vector pHGTPS1 (Figure 1A), in which the TPS1 gene is driven by the CaMV 35S promoter and the hph gene is driven by the nopaline synthase promoter. The expression cassette is flanked by both the left and right T-DNA border sequences. The binary vector pHGTPS1 was mobilized into the Agrobacterium tumafaciens strain LBA 4404 by electroporation. Transformed Agrobacterium strain was introduced into Nicotiana tabacum var. xanthi using the leaf disc transformation method. Ninety two independent TPS1 nuclear transgenic lines were ob-
6 tained on hygromycin selection. Seventeen confirmed nuclear transformants were analyzed by northern blots. Among transformants showing various levels of transcripts, five transformants with strong, moderate, weak, very weak and absence of transcripts were chosen for further characterization. For chloroplast transformation, green leaves of N. tabacum var. Burley were transformed with the chloroplast integration and expression vector by the biolistic process (Daniell 1997). Bombarded leaf segments were selected on spectinomycin/streptomycin selection medium. Integration of foreign gene into the chloroplast genome was determined by PCR screening of chloroplast transformants (data not shown). Primers were designed to eliminate mutants, nuclear integration and to determine whether the integration of foreign genes had occurred in the chloroplast genome at the directed site by homologous recombination. Primers 5P/5M land within the aadA gene and should generate a 0.4 kbp fragment if the aadA gene was present in transgenic plants and eliminates the possibility of mutation that could otherwise confer streptomycin/spectinomycin resistance. The presence of 0.4 kbp PCR product in plants transformed with the universal vector alone (pCt) or the universal vector containing the TPS1 gene (pCt-TPS1), but not in control untransformed plants (data not shown), confirmed that these were transgenic plants and not mutants. The strategy to distinguish between nuclear and chloroplast transgenic plants was to land one primer (3P) on the native chloroplast genome adjacent to the point of integration and the second primer (3M) on the aadA gene. This primer set generated 1.6 kbp PCR product in chloroplast transformants obtained with the universal vector (pCt) and the universal vector containing the TPS1 gene (pCt-TPS1). Because this product can not be obtained in nuclear transgenic plants, the possibility of nuclear integration can be eliminated. Another primer set was designed to test integration of the entire gene cassette. Primer 5P lands on the aadA gene and 2M lands on the trnA gene flanking the insert. This primer should generate 3.1 kbp PCR product in the transgenic chloroplast genome if the entire gene cassette was integrated. The presence of the expected size (3.1 kbp) PCR product using 5P/2M primers from transgenic chloroplast genomes confirmed that the entire gene cassette has been integrated and that there were no deletions during integration via homologous recombination.
Determination of chloroplast integration, homoplasmy and copy number Since there are no significant differences in the level of foreign gene expression among different chloroplast transgenic lines, one line was chosen to generate subsequent generations (T 1, T 2, T 3). Southern blot analysis was performed using total DNA isolated from transgenic and wild type tobacco leaves. Total DNA was digested with a suitable restriction enzyme. Presence of a BglII at the 3’ end of the flanking 16SrRNA gene and the trnA intron allowed excision of predicted size fragments in the chloroplast transformants and untransformed plants. To confirm foreign gene integration and homoplasmy, individual blots were probed with the chloroplast DNA flanking sequence (probe P1, Figure 1B). In the case of the TPS1 integrated plastid transformants (T 1,T 3), the border sequence hybridized with 6.13 and 1.17 kbp fragments while it hybridized with a native 4.47 kbp fragment in the untransformed plants (Figure 1C). The copy number of the integrated TPS1 gene was also determined by establishing homoplasmy in transgenic plants. Tobacco chloroplasts contain about 10,000 copies of chloroplast genomes per cell. If only a fraction of the genomes was transformed, the copy number should be less than 10,000. By confirming that the TPS1 integrated genome is the only one present in transgenic plants, one could establish that the TPS1 gene copy number could be as many as 10,000 per cell. DNA gel blots were also probed with the TPS1 gene coding sequence (probe P2) to confirm integration into the chloroplast genomes. In chloroplast transgenic plants (T 1,T 3), the TPS1 gene coding sequence hybridized with 6.13 and 1.17 kbp fragments which also hybridized with the border sequence in plastid transgenic lines (Figure 1C). This confirms that the tobacco transformants indeed integrated the intact gene expression cassette into the chloroplast genome and that there has been no internal deletions or loop out during integration via homologous recombination. Analysis of transcript level in nuclear and chloroplast transformants For comparison of introduced gene expression between chloroplast and nuclear transformants, northern blot analysis of transgenic tobacco at similar developmental stages was performed in T 0, T 1 and T 2
7 plants. As shown in Figure 2, quantification of transcription level showed that the chloroplast transformant (T 2) expressed 169-fold (Figure 2E, lane 5) more TPS1 transcript than the best surviving nuclear (T 1) transformant (Figure 2E, lanes 2, 3). Similar results were obtained when T 1 chloroplast (Figure 2B, lane 7) and T 0 nuclear transgenic plants (Figure 2B, lanes 2–5) were compared. This large difference in TPS1 expression between nuclear and chloroplast transgenic plants should be due to the presence of thousands of TPS1 gene copies in each cell of transgenic tobacco. Figure (2C, 2F) shows ethidium bromide stained RNA gels before blotting; this confirms that equal amount of RNA (10 g) was loaded in all lanes. It is remarkable that the 16SrRNA promoter is driving both genes very efficiently, eliminating the need for inserting additional promoters upstream of the gene of interest. Figure 2E shows a full length autoradiogram in which monocistron, dicistron and polycistrons of TPS1 are observed from transgenic chloroplast genomes. Two 16SrRNA promoters drive transcription resulting in dicistrons and polycistrons (Figure 2B, 2E, 2G). Nuclear TPS1 monocistron (1,750 nt) is slightly longer than chloroplast TPS1 monocistron (1,600 nt), because of the addition of poly A at 3’ end. Presence of TPS1 monocistron in transgenic chloroplast (Figure 2B, 2E, 2G) demonstrates RNA processing between aadA and TPS1, even though no specific intergenic sequences or 3’ processing signals were engineered downstream of the aadA gene. We routinely observe monocistrons in transgenic chloroplasts without such engineered sequences (Guda et al. 2000; DeGray et al. 2001). This is in contrast to specific DNA sequence or secondary srtucture requirements for transcript processing reported in the literature (Monde et al. 2000; Liere and Link 1997). However, the predominant transcripts are dicistrons and polycistrons which are efficiently translated without any need for processing in transgenic chloroplasts. This is again in contrast to previous in vitro studies in which processing was an absolute requirement for translation of chloroplast genes (Barkan et al. 1994; Hirose and Sugiura 1996; Barkan and Goldschmidt-Clermont 2000). Western blot analysis of nuclear and chloroplast transformants Polyclonal antibodies raised against the TPS1 protein overexpressed and purified from E. coli (see experi-
mental protocol) was used for immunoblotting (Figure 2A, 2D). A 56 kDa TPS1 polypeptide was detected in the T 0 nuclear (Figure 2A, lanes 2, 3, 5), T 1 nuclear (Figure 2D lanes 2, 3) and T 1 plastid (Figure 2A, lane 7) and T 2 plastid (Figure 2D, lane 5) transformants. However, no TPS1 was detected in the untransformed control (Figure 2A, lanes 1, 6; 2D 1, 4)) and transgenic plants which showed no TPS1 transcript (Figure 2A, lane 4). As anticipated, western blots showed only a five or ten fold increase in TPS1 protein in chloroplast over the best surviving nuclear transgenic plants. This is because of the fact that the chloroplast vector pCt-TPS1 was designed to lower translation by not engineering an optimal chloroplast RBS (GGAGG) 5 nucleotides upstream of ATG, so that transgenic plants are not affected by hyper-expression of TPS1. AAG is a sub-optimal RBS (one among the three RBS predicted for the psbA gene, Eibl et al. (1999)). However, this is at position -13 instead of the optimal distance of -5 from AUG. As anticipated, this level of expression was adequate to compare trehalose accumulation in cytosolic and chloroplast compartments and study resultant phenotypic/physiological changes. It should be noted that T 1 nuclear and T 2 chloroplast transgenic plants had higher levels of TPS1 protein; this may be due to homozygous TPS1 alleles or homoplasmy. Quantification of trehalose-6-phosphate and trehalose in transformants Trehalose formation is a two step process, involving trehalose-6-phosphate synthase and trehalose 6-phosphate phosphatase. Trehalose-6-phosphate was not detected in all tested chloroplast and nuclear transformants even though the TPS2, trehalose-6-phosphate phosphatase that converts T6P to trehalose, was not introduced (Table 1). Conversion of T6P to trehalose should have been accomplished by endogenous tobacco trehalose phosphatase or by any non-specific endogenous phosphatase. Simultaneous expression of both enzymes in transgenic plants resulted only in marginal increase of trehalose accumulation in previous studies (Goddijn et al. 1997), confirming that it is adequate to express only TPS1. Leaf extracts from both nuclear and chloroplast transgenic plants catalyzed the synthesis of trehalose 6-phosphate from glucose-6-phosphate and UDP-glucose whereas untransformed tobacco had very low activity. T 0 chloroplast and nuclear transgenic plants showed a 7–10 fold higher TPS1 activity than untransformed control
8
Figure 2. Northern and western blot analyses of control, nuclear and chloroplast transgenic plants. A, D: Western blots detected through chemiluminescence (100 g total protein per lane). B, E: Northern blots detected using 32P TPS1 probe. C, F: Ethidium bromide stained RNA gel before blotting (10 g total RNA loaded per lane). Panel A, B, C: T 0 nuclear and T 1 chloroplast transgenic plants. Lanes: 1. N. t. xanthi control; 2 ⬃ 5: T 0 nuclear transgenic plants. 2, X-113; 3. X-119; 4. X-121; 5. X-224; 6: N.t. Burley control; 7: chloroplast transgenic plant (T 1). Panel D, E, F: T 1 nuclear and T 2 chloroplast transgenic plants. Lanes: 1. N. t xanthi control; 2, 3: T 1 nuclear transgenic plants 2, X-113; 3.X-119; 4: N.t. Burley control; 5: chloroplast transgenic plant (T 2). Panel G: expected transcript sizes of chloroplast transformants.
9 Table 1. Analysis of T6P and trehalose, and TPS1 activity in control, nuclear and chloroplast transgenic tobacco plant s. Transformant
T 0 Generation Ct-TPS1(B) Nu-TPS1(x-119) Nu-TPS1(x-113) Control T 1 Generation Ct-TPS1 (B) Nu-TPS1(x-119) Nu-TPS1(x-113) Control
T6P (g/g fresh weight)
Trehalose (g/g fresh weight)
0.00 0.00 0.00 0.00
361.7 23.3 15.0 17.1
0.00 0.00 0.00 0.00
444.2 17.6 16.3 21.6
TPS1 activity (U*/mg protein)
5.0 4.4 3.5 0.5 nd nd nd nd
*Unit: The amount of enzyme producing 1 mole product per min in the respective standard assay is 1 U. nd, not determined
plants. The amount of trehalose present in untransformed control plants and T 0 nuclear transgenic plants were similar whereas chloroplast transgenic plants accumulated a 17–25 fold more trehalose than the best surviving nuclear transgenic plants (Table 1). T 1 nuclear transgenic plants accumulated less trehalose than control untransformed plants whereas T 1 chloroplast transgenic plants continued to accumulate high levels of trehalose (Table 1). Observation of comparable TPS1 activity in both nuclear and chloroplast transgenic plants but lack of trehalose accumulation in nuclear transgenic plants indicates that trehalose may be degraded in the cytosol by trehalase but not in the chloroplast compartment. Our observation is consistent with a previous study on inhibition of trehalase activity that resulted in trehalose accumulation in the cytosol (Goddijn et al. 1997). However, alternate explanations, including conditions favorable for trehalose biosynthesis are under investigation. Drought tolerance and pleiotropic effects Chloroplast and nuclear transformants were examined for drought tolerance and pleiotropic effects. After six weeks of growth in vitro, rooted shoots were transferred to pots and grown in the greenhouse. TPS1 nuclear transformants showed moderate to severe growth retardation, lancet-shaped leaves and infertility (Figure 3). The chloroplast transformants (T 0) showed slightly decreased growth rate and delayed flowering (given the limitations of comparing in vitro
growth on antibiotics with potted control plants) but all subsequent generations (T 1,T 2,T 3) showed similar growth rates and fertility as controls (Figure 3). The nuclear transgenic lines of stunted phenotype showed delayed flowering and produced fewer seeds (often non-viable) compared to wild type or did not flower. The nuclear transgenic line showing severe growth retardation did not flower. This result is consistent with prior observations which demonstrated that E. coli otsA (TPS1, Goddijn et al. (1997)) and S. cerevisiae TPS1 (Romero et al. 1997) transgenic plants exhibited stunted plant growth and other pleiotropic effects. T 1 nuclear transgenic plants that survived showed no growth retardation and trehalose accumulation. Therefore, these plants could not be used for appropriate comparison with chloroplast transgenic plants for drought tolerance studies. When wild type and transgenic seeds were germinated on MS medium containing spectinomycin, all chloroplast transgenic progeny (T 1, T 2, T 3) were spectinomycin resistant while wild type seedlings were sensitive to spectinomycin (data not shown). Because TPS1 chloroplast transgenic lines showed significant accumulation of trehalose, they were tested for drought tolerance characteristics and understanding the role of trehalose within transgenic chloroplasts. Seeds of chloroplast transgenic plants were germinated on the MS medium containing polyethylene glycol. As shown in Figure 4A, chloroplast transgenic seedlings grew in medium containing 3% and 6% PEG, whereas control seedlings exhibited severe dehydration, loss of chlorophyll and growth retardation, ultimately resulting in death. Loss of chlorophyll in untransformed control plants confirms breakdown of thylakoid membranes within chloroplasts due to osmotic stress induced by PEG. Trehalose is known to protect membranes under severe stress, even when present in small quantities (Colaco et al. 1992; Iwahashi et al. 1995). Presence of chlorophyll in transgenic chloroplasts confirms integrity of thylakoid membranes, even in the presence of high concentrations of PEG (Figure 4A), strikingly demonstrating the advantage of trehalose accumulation within transgenic chloroplasts. Dehydration and subsequent rehydration of threeweek-old seedlings were done exactly as described by Holmstrom et al. (1996). When seedlings were dried for 7 hours at room temperature in 50% relative humidity, they were all affected by dehydration. However, when dehydrated seedlings were rehydrated for 48 hours in MS medium, all chloroplast transgenic
10
Figure 3. Nuclear and chloroplast transgenic plants to illustrate pleiotropic effects. 1. N. t xanthi control; 2 ⬃ 5: T 0 nuclear transgenic plants 2, X-113; 3.X-121; 4. X-119; 5. X-224; 6, T 1 chloroplast transgenic plant; 7, N. t. Burley control.
Figure 4. Assays for drought tolerance. Four week old seedlings on MS medium containing 3% (A, B) or 6% (C, D) polyethylene glycol (MW 8,000). A, C: Control untransformed N.t. Burley. B, D: T 1 Chloroplast transgenic plants. E, F. Dehydration/rehydration assay. Threeweek old seedlings germinated on agarose in the absence (control) or presence of spectinomycin (transgenic, 500 g/ml) were air-dried at room temperature in 50% relative humidity. After 7 hrs drying, seedlings were rehydrated for 48 hrs by placing roots in MS medium. C, untransformed; T 1 and T 2 chloroplast transgenic lines.
lines recovered while all control seedlings were bleached (Figure 4B). Even the couple of control seedlings that partly survived (because of uneven drying of seedlings on filter papers) eventually died. These results suggest that trehalose accumulation within transgenic chloroplasts protects them from lysis during dehydration and enables their subsequent recovery. This is consistent with existing understanding that trehalose functions by protecting biological membranes rather than regulating water potential (Iwahashi et al. 1995). Mature leaves from fully-grown plants were tested for their ability to regulate water loss under drought
conditions. When detached leaves were air dried, control and chloroplast transgenic plants lost water to the same extent (data not shown). Control and chloroplast transgenic potted plants were not watered for 24 days. Again, both showed dehydration to the same extent (Figure 5A, 5B). However, upon rehydration, fully dehydrated leaves (indicated by arrows, Figure 5C, 5D) recovered in chloroplast transgenic plants but not in controls. Again, these experiments confirm the ability of trehalose to protect transgenic chloroplasts. Unfortunately, these experiments could not be done in fully grown plants because trehalose accumulation varied based on leaf age, development and senes-
11
Figure 5. Dehydration and rehydration of potted plants. Potted plants were not watered for 24 days and rehydrated for 24 hours. Arrows indicate fully dried leaves that either recovered or did not recover from dehydration. A, C: Control untransformed; B, D: chloroplast transgenic plants.
cence, due to significant difference in chloroplast genome copy number. Such variation in levels of foreign proteins within transgenic chloroplasts (100fold) has been reported previously (Daniell et al. 2001a; De Cosa et al. 2001; Daniell et al. 2001d; Sidorov et al. 1999). Other physiological variations within transgenic plants complicated the experimental outcome and interpretation. While it is evident that each of the methodologies (used in prior studies to asses drought tolerance), has positive aspects and drawbacks, collectively they establish the ability of trehalose to protect transgenic chloroplasts from drought stress without causing any harm to the plant.
Discussion This study attempted to investigate the effect of trehalose accumulation within chloroplasts and cytosol, conferred by the yeast TPS1 engineered via the chloroplast or nuclear genomes. An alternate approach would have been to target the trehalose phosphate synthase enzyme from the cytosol into chloroplasts, as a nuclear gene product. This approach was not pursued because it was not known whether trehalose phosphate synthase was catalytically active when the transit peptide was present, as several other enzymes targeted to chloroplasts (e.g. the EPSP synthase, Daniell et al. (1998)). This would have made the interpretation of observed results more difficult, in addition to complications of the position effect and gene silencing frequently observed in the nuclear transgenic plants and the presence of trehalase in the cytosol. This study shows that accumulation of smaller quantities of trehalose may be adequate to protect chloroplasts from drought stress. Larger quantities of trehalose accumulation may be needed for commer-
cial applications of trehalose. For example, trehalose is added during dehydration of fruits and herbs to preserve color and aroma (Roser and Colaco 1993). However, such commercial application of trehalose is severely limited because of its cost (about $300/kg). Therefore, trehalose is primarily used now in the pharmaceutical industry. Currently, trehalose is produced in yeast where accumulation is severely limited by trehalase (Goddijn et al. 1997). Investigations should be done to enhance trehalose accumulation within transgenic chloroplasts, because of its non-toxicity in this compartment. For such studies, it may be necessary to engineer the bacterial two gene operon, including the trehalose 6-phosphate phosphatase with UTRs for optimal expression and maximal accumulation of trehalose within chloroplasts. Expression of bacterial operons within transgenic chloroplasts is now possible (De Cosa et al. 2001; Daniell and Dhingra 2002). Characterization of such transgenic plants should shed light on the mechanism of stress tolerance. It is quite evident from this study that trehalose accumulation within chloroplasts did not confer osmotic stress tolerance. Several lines of evidence point out that trehalose confers membrane protection, especially for thylakoid membranes. Control and transgenic plants lost water to the same extent, demonstrating that trehalose is unable to regulate water potential (loss) and therefore does not act as an osmoprotectant. Instead, trehalose enables dehydrated leaves to recover by protecting membranes. Protection of membranes offered by trehalose need not be limited to thylakoids within chloroplasts. Protection of plasma membrane or other cellular components to prevent cell collapse may be entirely possible by lysis of transgenic chloroplasts during dehydration to release trehalose into the cytosol. Indeed, such release of high concentrations of an antimicrobial peptide
12 from transgenic chloroplasts into the cytosol resulted in preventing subsequent spread of bacterial or fungal pathogens (DeGray et al. 2001). Previous studies have also shown that the mechanism of improved performance of trehalose synthesizing plants in drought tolerance may not be due to regulation of water potential (Goddijn and van Dun 1999). Dramatic effect on growth, even with very low levels of trehalose accumulation suggests a greater role in cellular metabolism and regulation. It is possible to alleviate most of the pleiotropic effects (such as sterility, stunted growth etc.) by engineering via the chloroplast genome. This study opens the door to engineer drought tolerant plants via the chloroplast genome, using other genes, especially those that code for osmoprotectants. Additionally, biological containment of introduced genes may be vital to prevent the generation of drought resistant weeds and transfer of associated undesirable pleiotropic traits to related crops (Daniell 2002).
References Ausubel F., Brent R., Kingston R.E., Moore D.D., Sediman J.G., Smith J.A. et al. 1995. Short Protocols in Molecular Biology. Wiley and Sons, Inc., USA. Barkan A. and Goldschmidt-Clermont M. 2000. Nuclear participation in chloroplast expression. Biochimie. 82: 559–572. Barkan A., Walker M., Nolasco M. and Johnson D. 1994. A nuclear mutation in maize blocks the processing and translation of several chloroplast mRNAs and provides evidence for differential translation of alternative mRNA forms. EMBO J. 13: 3170– 3181. Bianchi G., Gamba A. and Limiroli R. 1993. The unusual sugar composition in leaves of the resurrection plant Myrothamnus flabellifolia. Physiol Plantarum 87: 223–226. Bogorad L. 2000. Engineering chloroplasts: an alternative site for foreign genes, proteins, reactions and products. Trends in Biotechnology 18: 257–263. Brixey P.J., Guda C. and Daniell H. 1997. The chloroplast psbA promoter is more efficient in E.coli than the T7 promoter for hyper-expression of a foreign protein. Biotechnology letters 19: 395–399. Colaco C., Sen S., Thangavelu M., Pinder S. and Roser B. 1992. Extraordinary stability of enzymes dried in trehalose: simplified molecular biology. Bio/technology 10: 1007–1011. Colaco K., Kampinga J. and Roser B. 1995. Amorphous stability and trehalose. Science 268: 788–789. Crowe J.H., Hoekstra F.A. and Crowe L.M. 1992. Anhydrobiosys. Annu. Rev. Physiol. 54: 579–599. Daniell H. 1997. Transformation and foreign gene expression in plants mediated by microprojectile bombardment. Meth. Mol. Biol. 62: 453–488.
Daniell H. 1999a. New tools for chloroplast genetic engineering. Nature Biotechnol. 17: 855–856. Daniell H. 1999b. GM crops: Public perception and scientific solutions. Trends in Plant Science 4: 467–469. Daniell H. 1999c. Environmentally friendly approaches to genetic engineering. In vitro Cellular and Developmental Biology-Plant 35: 361–368. Daniell H. 2000. Genetically modified food crops: current concerns and solutions for the next generation crops. Biotechnology and Genetic Engineering Reviews 17: 327–352. Daniell H. 2002. Molecular strategies for gene containment in transgenic crops. Nature Biotechnol. 20: 581–586. Daniell H. and Dhingra A. 2002. Multiple gene engineering: dawn of an exciting new era in biotechnology. Current Opinion in Biotechnology 13: 136–141. Daniell H. and Guda C. 1997. Biopolymer production in microorganisms and plants. Chemistry and Industry 14: 555–560. Daniell H., Data R., Varma S., Gray S. and Lee S.B. 1998. Containment of herbicide resistance through genetic engineering of the chloroplast genome. Nature Biotechnol. 16: 345–348. Daniell H., Muthukumar B. and Lee S.B. 2001a. Marker free transgenic plants: engineering the chloroplast genome without the use of antibiotic selection. Current Genetics 39: 109–116. Daniell H., Wiebe P.O. and Fernandez-San Millan A. 2001b. Antibiotic free chloroplast genetic engineering – an environmentally friendly approach. Trends in Plant Science 6: 237–239. Daniell H., Streafield S.J. and Wycoff K. 2001c. Medical molecular farming: production of antibodies, biopharmaceuticals and edible vaccines in plants. Trends Plant Science 6: 219–226. Daniell H., Lee S.B., Panchal T. and Wiebe P.O. 2001d. Expression of cholera toxin B subunit oligomers in transgenic tobacco chloroplasts. Journal of Molecular Biology 311: 1001–1009. Daniell H., Khan M.S. and Allison L. 2002. Milestones in chloroplast genetic engineering: an environmentally friendly era in biotechnology. Trends in Plant Science 7: 84–91. De Cosa B., Moar W., Lee S.B., Miller M. and Daniell H. 2001. Hyper-expression of Bt Cry2Aa2 operon in chloroplast leads to formation of insecticidal crystals. Nature Biotechnol. 19: 71– 74. De Vigilio C., Hottinger T., Dominguez J., Boller T. and Wiekman A. 1994. The role of trehalose synthesis for the acquisition of thermotolerance in yeast I. Genetic evidence that trehalose is a thermoprotectant. Eur. J. Biochem. 219: 179–186. DeGray G., Smith F., Sanford J., Rajasekaran K. and Daniell H. 2001. Expression of an antimicrobial peptide via the chloroplast genome to control phytopathogenic bacteria. Plant Physiol. 127: 852–862. Dellaporta S.L., Wood J. and Hicks J.B. 1983. A plant DNA minipreparation: Version II. Plant Mol. Biol. Rep. 1: 19. Drennan P.M., Smith M.T., Goldsworthy D. and Van Staden J. 1993. The occurrence of trehalose in the leaves of the desiccation-tolerant angiosperm Myrothamnus flabellifolius Welw. J. Plant Physiol. 142: 493–496. During K., Hippe S., Kreuzaler F. and Schell J. 1990. Synthesis and self-assembly of a functional monoclonal antibody in transgenic Nicotiana tabacum. Plant Molecular Biology 15: 281– 293. Eibl C., Zou Z., Beck A., Kim M., Mullet J. and Koop U.H. 1999. In vivo analysis of psbA rbcL and rpl32 UTR elements by
13 chloroplast transformation: tobacco plastid gene expression is controlled by modulation of transcript levels and translation efficiency. Plant J. 19: 333–345. Elbein A.D. 1974. The metabolism of, -trehalose. Adv. Carbohyd. Chem. Biochem. 30: 227–256. Finnegan J. and McElroy D. 1994. Transgene Inactivation: Plants fight back. Biotechnology 12: 883–888. Fernandez-San Millan A., Mingeo-Castel A., Miller M. and Daniell H. 2003. A chloroplast transgenic approach to hyper-express and purify Human Serum Albumin, a protein highly susceptible to proteolytic degradation. Plant Biotechnology Journal (in press). Goddijn O.J.M. and van Dun K. 1999. Trehalose metabolism in plants. Trends in Plant Science 4: 315–319. Goddijn O.J.M., Verwoerd T.C., Voogd E., Krutwagen W.H.H., de Graff P.T.H.M., Poels J. et al. 1997. Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants. Plant Physiol 113: 181–190. Guda G., Lee S.B. and Daniell H. 2000. Stable expression of a biodegradable protein-based polymer in tobacco chloroplasts. Plant Cell Reports 18: 257–262. Hirose T. and Sugiura M. 1996. Cis acting elements and trans acting factors for accurate translation of chloroplast psbA mRNAs: development of an in vitro translation system from tobacco chloroplasts. EMBO J. 15: 1687–1695. Holmstrom K.O., Mantyla M., Wekin B., Mandal A., Palva E.T., Tunnela O.E. et al. 1996. Drought tolerance in tobacco. Nature 379: 683–684. Iamtham S. and Day A. 2000. Removal of antibiotic resistance genes from transgenic tobacco plastids. Nature Biotechnol. 18: 1172–1176. Iwahashi H., Obuchi K., Fujii S. and Komatsu Y. 1995. The correlative evidence suggesting that trehalose stabilizes membrane-structure in the yeast Saccharomyces cerevisiae. Cell Mol. Biol. 41: 763–769. Kota M., Daniell H., Varma S., Garcynski F., Gould F. and Moar W.J. 1999. Overexpression of Bacillus thuringiensis Cry2A protein in chloroplasts confers resistance to plants against susceptible and Bt resistant insects. Proc. Natl. Acad. Sci. USA 96: 1840–1845. Liere K. and Link G. 1997. Chloroplast endoribonuclease p54 involved in RNA 3’ end processing is regulated by phosphorylation and redox state. Nucleic Acid Research 12: 2403–2408. Londesbrough J. and Vuorio O. 1991. Trehalose-6-phosphate synthase/phosphatase complex from baker’s yeast: purification of a protelytically activated form. J. Gen. Microbiology 137: 323– 330.
Mackenzie K.F., Singh K.K. and Brown A.D. 1988. Water stress plating hypersensitivity of yeast: protective role of trehalose in Saccharomyces cerevisiae. J. Gen. Microbiology 134: 1661– 1666. McBride K.E., Svab Z., Schaaf D.J., Hogen P.S., Stalker D.M. and Maliga P. 1995. Amplication of a chimeric Bacillus gene in chloroplasts leads to extraodinary level of an insecticidal protein in tobacco. Bio/technology 13: 362–365. Monde R.A., Schuster G. and Stern D.B. 2000. Processing and degradation of chloroplast mRNA. Biochimie. 82: 573–582. Nuccio M.L., Rhodes D., McNeil S.D. and Hanson A.D. 1999. Metabolic engineering of plants for osmotic stress resistance. Current Opinion in Plant Biology 2: 128–134. Romero C., Belles J.M., Vaya J.L., Serrano R. and Culianez-Macia F.A. 1997. Expression of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleiotropic phenotypes include drought tolerance. Planta. 201: 293–297. Roser B. and Colaco C. 1993. A sweeter way to fresher food. New Scientist 138: 24–28. Sambrook J., Maniatis T. and Fritsch E.J. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, USA. Scott S.E. and Wilkinson M.J. 1999. Low probability of chloroplast movement from oilseed rape (Brassica napus) into wild Brassica rapa. Nature Biotechnol. 17: 390–392. Serrano R., Culianez-Macia F.A. and Moreno V. 1999. Genetic engineering of salt and drought tolerance with yeast regulatory genes. Scientia Horticulture 78: 261–269. Sharma S.C. 1997. A possible role of trehalose in osmotolerance and ethanol tolerance in Saccharomyces cerevisiae. FEMS Microbiology Letters 152: 11–15. Sidorov V.A., Kasten D., Pang S.Z., Hajdukiewicz P.T., Staub J.M. and Nehra N.S. 1999. Potato plastid transformation: high expression of green fluorescent protein in chloroplasts. Plant J. 19: 209–216. Singer M.A. and Lindquist S. 1998. Thermotolerance in Saccharomyces cerevisiae: the Yin and Yang of trehalose. Trends in Biotech. 16: 460–468. Thevelein J.M. and Hohmann S. 1995. Trehalose synthase: guard to the gate of glycolysis in yeast? Trends in Bioscience 20: 3–10.
