Activation of Adenosine 2A Receptors Preserves ... - Semantic Scholar

BASIC RESEARCH

www.jasn.org

Activation of Adenosine 2A Receptors Preserves Structure and Function of Podocytes Alaa S. Awad,*† Michael Rouse,* Lixia Liu,* Amy L. Vergis,* Diane L. Rosin,‡ Joel Linden,*† John R. Sedor,§ and Mark D. Okusa*† Departments of *Medicine and ‡Pharmacology and †the Cardiovascular Research Center, University of Virginia, Charlottesville, Virginia; and §Department of Medicine, Case Western Reserve University, and Rammelkamp Center for Research and Education, MetroHealth System Campus, Cleveland, Ohio

ABSTRACT Adenosine 2A receptor (A2AR) activation was recently shown to be renoprotective in diabetic nephropathy. A2AR are found in glomeruli and have been shown to associate with the podocyte cytoskeletal protein ␣-actinin-4, but the effect of their activation on podocyte structure and function is unknown. Podocyte injury was induced in C57BL/6 mice with puromycin aminonucleoside, and the selective A2AR agonist ATL313 was found to attenuate the resulting albuminuria and foot process fusion. The selective A2AR antagonist ZM241385 reversed the effects of ATL313. In vitro, A2AR mRNA and protein were expressed in a conditionally immortalized podocyte cell line, and A2AR-like immunoreactivity co-localized with the actin cytoskeleton. Treatment with ATL313 also blocked the increased podocyte permeability to albumin and disruption of the actin cytoskeleton that accompanied puromycin aminonucleoside– induced injury in vitro. ATL313 was ineffective, however, in the presence of the A2AR antagonist and in A2AR-deficient podocytes. It was concluded that A2AR activation reduces glomerular proteinuria, at least in part, by preserving the normal structure of podocyte foot processes, slit diaphragms, and actin cytoskeleton. J Am Soc Nephrol 19: 59 –68, 2008. doi: 10.1681/ASN.2007030276

Glomerular disorders are the major causes of endstage renal disease (ESRD) in humans. Podocyte loss, effacement, and dysfunction along with alterations of the podocyte-specific structural proteins and cytoskeleton are key factors that lead to glomerulosclerosis.1–5 Podocytes are highly specialized, terminally differentiated epithelial cells that serve as an important constituent of the glomerular filtration barrier.6 They are anchored to the glomerular basement membrane (GBM) and the capillary tufts and thought to play a pivotal role in pathophysiology of many forms of human and experimental glomerular disease, including minimal-change disease, IgA nephropathy, focal and segmental glomerulosclerosis (FSGS), and diabetic nephropathy (DN). Both nephrin and podocin are complex proteins that contribute to the assembly and reinforcement of the slit diaphragm by binding to the actin cytoskeleton via CD2-associated protein.7,8 MutaJ Am Soc Nephrol 19: 59 –68, 2008

tions in nephrin and podocin mRNA and protein expression lead to human glomerular disease.9 Moreover, reduced ␣3␤1 integrin, the major integrin anchoring podocytes to the GBM structures,10,11 collagen IV, fibronectin, and laminin7,12 support the central role of podocytes in glomerular disease. Adenosine has diverse physiologic and pathophysiologic effects that depend on its interaction with the receptor subtypes A1, A2A, and A2B, and A3.13,14 ReReceived March 6, 2007. Accepted July 18, 2007. Published online ahead of print. Publication date available at www.jasn.org. Correspondence: Dr. Mark D. Okusa, Division of Nephrology, Box 133, University of Virginia Health System, Charlottesville, VA 22908. Phone: 434-924-2187; Fax: 434-924-5848; E-mail: [email protected] Copyright © 2008 by the American Society of Nephrology ISSN : 1046-6673/1901-59

59

BASIC RESEARCH

www.jasn.org

cently, we reported a renoprotective effect of adenosine 2A receptor (A2AR) activation in DN.15 Streptozotocin (STZ)-induced diabetes in rodents led to marked proteinuria and decreased renal function that was attenuated with continuous subcutaneous administration of A2AR agonists.15 It is interesting that, in these studies, diabetic kidney disease was associated with reduced podocin and nephrin mRNA expression, but their expression was restored in animals treated with A2AR agonists.15 A2AR are found in glomeruli,16 and recently A2AR were found to associate with ␣-actinin-4, a cytoskeletal protein,17 which when mutated is thought to lead to FSGS.9,18 These results raise the possibility that A2AR agonists may have a direct effect on podocytes; therefore, we sought to determine whether A2AR agonists had direct effects on podocytes to preserve glomerular filtration barrier function. We describe here the first characterization of A2AR expression in the kidney podocyte as well as the functional analysis of podocyte A2AR both in vivo and in vitro. We used puromycin aminonucleoside (PAN) to induce proteinuria and effacement of podocyte foot processes, as demonstrated by electron microscopy (EM), effects that were attenuated with A2AR agonists. Podocytes grown in culture expressed A2AR and when exposed to PAN showed cytoskeletal disorganization and increased albumin permeability, effects that were attenuated by A2AR agonists. These results suggest that A2AR expressed on podocytes may serve as an important target to preserve podocyte function in glomerular disease.

RESULTS Effect of A2AR Agonists on Urinary Albumin Excretion Rate in PAN-Induced Proteinuria

In a preliminary study, PAN (50, 75, and 100 mg/kg) was injected into the tail vein of C57BL/6 mice, and urine was collected for 24 h at 0, 3, 6, and 10 d after PAN injection (n ⫽ 2 per group). We found that proteinuria was maximal on day 6 after a dosage of 100 mg/kg (367% of control; Figure 1A). Next, we determined the effect of continuous administration of ATL313 (1 ng/kg per min) in vivo on PAN-induced proteinuria. As shown in Figure 1B, PAN injection (100 mg/kg) significantly increased urinary albumin excretion (UAE; 259% of control; P ⬍ 0.01) after 6 d, an effect completely blocked by ATL313 treatment (107% of control; P ⬍ 0.01 to PAN treatment). The effect of ATL313 was reversed with the selective A2AR antagonist ZM241385 (5 ng/kg per min; 212% of control; P ⬍ 0.05 to ATL313 group). PAN injection was associated with a significant reduction in podocin and zonula occludens-1 (ZO-1) mRNA expression compared with control mice (35 and 73% of control), respectively. ATL313 administration reversed this reduction (185 and 131% of control), respectively; however, there was no significant difference in nephrin mRNA expression among all groups (control 100 ⫾ 10%; PAN 120 ⫾ 25% [P ⬍ 0.7 of control]; PAN⫹ATL313 64 ⫾ 9% [P ⬍ 0.3 of control and P ⬍ 0.08 of PAN]). 60

Journal of the American Society of Nephrology

Figure 1. Effect of ATL313 on UAE in PAN-induced nephrosis. Urine was collected during a 24-h period for measurement of UAE by ELISA after PAN injection. (A) Dosage and time (days after PAN injection) response curve of PAN injection (n ⫽ 2 per symbol). (B) Effect of continuous 6-d infusion of vehicle (PAN), ATL313 (PAN⫹ATL313), or ATL313 ⫹ ZM241385 (PAN⫹ATL313⫹ ZM241385) on UAE in PAN-induced glomerular injury (100 mg/ kg, intravenously, day 0) on day 6 after PAN injection. Data are means ⫾ SEM. *P ⬍ 0.05, **P ⬍ 0.01 versus untreated control; ⫹P ⬍ 0.05, ⫹⫹P ⬍ 0.01 versus PAN ⫹ ATL313 group.

ATL313 Reverses Morphologic Changes Associated with PAN-Induced Injury

PAN-induced proteinuria is associated with podocyte foot process effacement; therefore, we sought to determine whether the reduction of PAN-induced proteinuria was reversed with A2AR agonists. In comparison with the control group (Figure 2, A and B), the foot processes in the PAN group (Figure 2, C and D) were effaced, retracted, widened, and shortened. The effect of PAN on podocyte foot process ultrastructure was attenuated with ATL313 (Figure 2, E and F); ZM241385 (Figure 2, G and H) reversed the protective effect of ATL313 on podocyte foot process. The number of opened slit diaphragm per micrometer of GBM length was reduced in PAN (0.26 ⫾ 0.1) in comparison with control (1.47 ⫾ 0.3; P ⬍ 0.05) or with ATL313 (2.03 ⫾ 0.2; P ⬍ J Am Soc Nephrol 19: 59 –68, 2008

www.jasn.org

BASIC RESEARCH

Figure 3. Effect of ATL313 on the number of opened slit diaphragms in PAN-induced nephrosis. Scoring system for the number of opened foot process/GBM length (n ⫽ 3 each group with four different fields per group). Data are means ⫾ SEM. *P ⬍ 0.05 versus control; ⫹P ⬍ 0.01, ⫹⫹P ⬍ 0.005 versus ATL313 group.

0.005). ZM241385 significantly reversed the effect of ATL313 (0.66 ⫾ 0.3; P ⬍ 0.01 compared with ATL313; Figure 3). These results suggest that the reduction of PANinduced proteinuria by ATL313 is associated with preservation of podocyte foot process ultrastructure and raises the possibility of a direct effect of A2AR activation on podocytes. In contrast to EM results, light microscopic analysis of hematoxylin and eosin staining of the renal cortex and medulla revealed no histologic changes among all groups (data not shown). A2AR Are Present in Murine Podocytes

We used cultured podocytes to determine whether they express A2AR and to determine the functional effects of podocyte A2AR activation in vitro. We detected A2AR mRNA in immortalized podocytes by reverse transcription–PCR (RT-PCR; n ⫽ 6; Figure 4A). We also found that the band identified by PCR is indeed an amplified product of A2AR mRNA by using a direct sequencing. We also used a well-characterized mAb to A2AR19 and showed labeling of A2AR-like immunoreactivity in podocytes with particular concentration in “spindle-like” extensions that resemble foot processes (Figure 4B, arrows). All batches of podocytes in these studies expressed both the Wilms’ tumor gene (WT-1) and synaptopodin (Figure 4, C and D, respectively). Validation of A2AR Expression in Murine Podocytes Figure 2. Effect of ATL313 on glomerular ultrastructure in PANinduced nephrosis. Representative electron micrographs of the glomerulus in control (A and B), PAN (with vehicle treatment; C and D), PAN⫹ATL313 (E and F), and PAN⫹ATL313⫹ZM241385 (G and H); tissue was prepared on day 6 after a single PAN injection and 6 d of continuous infusion of vehicle or ATL313 with or without ZM241385. Arrows indicate foot processes. Bar shown in H ⫽ 1000 nm in A, C, E, and G and 400 nm in B, D, F, and H. J Am Soc Nephrol 19: 59 –68, 2008

To confirm the specificity of the A2AR mAb, we used both a specific (antigenic A2AR peptide; Figure 5A) and an irrelevant (Figure 5B) peptide in competition experiments. Only the antigenic peptide blocked labeling, indicating that the A2AR mAb specifically recognizes an epitope of the A2AR used in generating the antibody. We also used the small interfering RNA (siRNA) technique to knock down A2AR in podocytes as another apPodocyte Adenosine 2A Receptors

61

BASIC RESEARCH

www.jasn.org

Figure 4. A2AR expression in podocytes. (A) cDNA generated from differentiated murine podocytes was subjected to RT-PCR using primers for A2AR, and PCR products were separated by gel electrophoresis (n ⫽ 6 different samples). GAPDH, glyceraldehyde-3-phosphate dehydrogenase. (B through D) Confocal images of differentiated murine podocytes. Co-localization of actin (green in B through D) with A2AR (red, B), WT-1 (red, C), and synaptopodin (red, D). Yellow in merged images depicts colocalization. Nuclei are depicted by DAPI labeling (blue, D). Arrows in B show labeling of A2AR in podocytes with particular concentration in “spindle-like” extensions that resemble foot processes. Bar ⫽ 40 ␮m.

proach. With three of four different A2AR siRNA oligonucleotides (siRNA 1, 2, and 4), we were able to demonstrate knockdown of A2AR mRNA and protein in differentiated podocytes by using RT-PCR (Figure 5C) and immunohistochemistry (Figure 5D), respectively. One construct (siRNA 3) failed to decrease mRNA or protein expression (data not shown). There was no effect of A2AR siRNA oligonucleotides on the control gene (cyclophilin) expression of podocytes (Figure 5C) ATL313 increases Podocyte cAMP Levels In Vitro

A2AR are known to be coupled through stimulatory G proteins to increase cAMP upon activation.20 We tested whether A2AR activation in podocytes by ATL313 regulated cAMP accumulation. ATL313 (50 nM) increased intracellular cAMP production from a baseline of 55 ⫾ 4 to 91 ⫾ 14 pmol/ml (P ⬍ 0.05), an effect completely blocked by ZM241385 (150 nM; 34 ⫾ 3 pmol/ml; P ⬍ 0.01 to ATL313). These results provide a functional measure of A2AR activation in podocytes. 62


Figure 5. A2AR mAb specifically detects A2AR in immortalized differentiated podocytes. Immunofluorescent labeling of A2AR (red) in differentiated murine podocytes is eliminated when the A2AR mAb is preadsorbed with the immunogenic peptide (A; 15–amino acid sequence of A2AR third intracellular loop) but not with an irrelevant peptide (B; 13–amino acid sequence of human secretory carrier membrane protein). siRNA constructs were generated to knockdown A2AR in differentiated murine podocytes (C and D). Podocytes were transfected with irrelevant (I) or specific siRNA constructs (1, 2, and 4), cells were harvested and cDNA was synthesized, and water (W) was used as a negative control. RTPCR was performed using primers for the A2AR or for cyclophilin, and PCR products were separated by gel electrophoresis (C). Immunofluorescent labeling of A2AR (red) and DAPI labeling of nuclei (blue) in podocytes transfected with scrambled or siRNA construct 1, 2, or 4 (D). Bar ⫽ 20 ␮m in A and B and 40 ␮m in D.

J Am Soc Nephrol 19: 59 –68, 2008

www.jasn.org

BASIC RESEARCH

ATL313 Attenuates PAN-Induced Increase in Podocyte Permeability In Vitro

We determined the functional effects of ATL313 on podocyte permeability by measuring the transepithelial passage of BSA across differentiated podocytes grown on Transwell chambers as described previously.21 As shown in Figure 6, differentiated podocytes treated with PAN significantly increased albumin passage through podocytes (P ⬍ 0.05 to control). ATL313 treatment completely blocked the effect of PAN on podocyte permeability to albumin, an effect reversed with ZM241385 treatment. These data further demonstrate that functional A2AR are expressed in podocytes and that activation of podocyte A2AR directly reduces their permeability to albumin. ATL313 Attenuates PAN-Induced Disruption of the Podocyte Actin Cytoskeleton In Vitro

Reversal by ATL313 of the observed alterations in podocyte albumin permeability in response to PAN may be due to the ability of A2AR agonists to preserve the podocyte structural integrity. To examine this possibility, differentiated podocytes were injured using PAN 100 ␮g/ml alone, and the protective effect of ATL313 (50 nM) with and without ZM241385 (150 nM) was determined. As shown in Figure 7A, the specific activation of A2AR by ATL313 (which was blocked by ZM241385) prevented the marked disruption of the organization of the actin cytoskeleton produced by

Figure 6. Effect of ATL313 on podocyte permeability in vitro. Transepithelial permeability of differentiated podocytes to BSA was measured as described in the Concise Methods section. After 14 d of culture on Transwell filter chambers (3-␮m pore) at 37°C, podocytes were pretreated with vehicle or ATL313 (50 nM) with or without ZM241385 (150 nM) for 1 h and then exposed to PAN (100 ␮g/ml) for 24 h. The lower chambers were then filled with BSA-containing medium, and the upper chambers were sampled at 1, 3, and 6 h (n ⫽ 3 different experiments). Data are means ⫾ SEM. *P ⬍ 0.0001 versus untreated podocytes (normal); ⫹P ⬍ 0.0001 versus PAN ⫹ ATL313 group. J Am Soc Nephrol 19: 59 –68, 2008

Figure 7. Effect of ATL313 on the podocyte actin cytoskeleton after injury with puromycin treatment in vitro. Differentiated murine podocytes were transfected with a scrambled oligonucleotide (A) or specific siRNA oligonucleotide to knockdown A2AR (B). The actin cytoskeleton (green) and nuclei (DAPI, blue) were labeled in untreated cells (control) or in cells after incubation with PAN (100 ␮g/ml), PAN ⫹ ATL313 (50 nM), or PAN ⫹ ATL313 ⫹ ZM243185 (150 nM). Bar ⫽ 40 ␮m.

treatment of podocytes with PAN. To confirm that the protective effect of ATL313 was indeed mediated by podocyte A2AR, we demonstrated that the effect of ATL313 was lost in PAN-treated cells in which the A2AR had been deleted by siRNA (Figure 7B). These results confirmed that the effect of AT313 to preserve the actin cytoskeletal organization after PAN exposure was due to activation of podocyte A2AR. Podocyte Adenosine 2A Receptors

63

BASIC RESEARCH

www.jasn.org

DISCUSSION

Podocytes contribute to the maintenance of the glomerular filtration barrier, and abnormalities of podocyte structure and function lead to a number of glomerular diseases; therefore, treatments that preserve podocyte structure may lead to a reduction of proteinuria and preservation of glomerular and kidney functions. Here we demonstrate that PAN-induced nephrosis, a model of human minimal-change disease,22 was associated with proteinuria and characteristic foot process effacement. An agonist of A2AR, ATL313, reversed this effect. By RT-PCR, immunohistochemistry, and functional assessment, we established that podocytes grown in culture expressed A2AR. When exposed to PAN, the actin cytoskeleton becomes disorganized, leading to an increase in permeability to albumin. ATL313 restores normal actin cytoskeletal arrangement and normal albumin permeability; therefore, activation of A2AR expressed on podocytes may serve as a therapeutic strategy in diseases that lead to podocyte dysfunction. Previously, in an STZ-induced model of DN, we demonstrated that an A2AR agonist, ATL146e, led to marked reversal of injury.15 The induction of proteinuria with STZ was markedly reduced by ATL146e, an effect that was associated with preservation of estimated GFR and glomerular structure. Both nephrin and podocin mRNA levels were reduced after STZinduced diabetes, an effect completely restored with A2AR agonist treatment.15 Because the expression of nephrin and podocin is limited to podocytes, we questioned whether the protective effect of A2AR agonists in reducing proteinuria may in part be due to direct effects on podocytes. In this study, we subjected mice to PAN to examine the in vivo and in vitro effects of A2AR agonists on the maintenance of podocyte integrity. In this study, we demonstrated by RT-PCR and immunohistochemical localization that differentiated murine podocytes express A2AR mRNA and protein, respectively. Confocal microscopy revealed A2AR-like immunoreactivity both intracellularly and along the periphery of the podocyte. The specificity of immunohistochemical labeling with the A2AR mAb is well characterized in brain19 but has not previously been examined in podocytes. The specificity of the labeling using the A2AR mAb was confirmed by preadsorption experiments with the competing immunizing peptide and in A2AR siRNA “knockdown” experiments; labeling was absent or markedly attenuated in both cases. Furthermore, our data provide the first demonstration of the expression of functional A2AR in podocytes and coupling to cAMP production. Given the marked tissue-protective effect of A2AR in other tissues,23,24 it was of interest to understand the biologic significance of A2AR expression in podocytes and whether their activation could reverse podocyte injury. Advances in podocyte biology have led to insights into the pathogenesis of glomerular disease. Podocytes play a key role in the maintenance of the glomerular filtration barrier,6 and normal podocyte function is intimately linked to its complex 64


cytoskeletal architecture. The podocyte backbone is mainly formed by abundantly rich actin cytoskeleton25 and ␣-actinin4,18 which enable podocytes to alter continually their shape and surround the glomerular capillaries to form a filtration slit diaphragm. In vivo, podocyte differentiation is required for normal filtration barrier function. Podocyte injury leads to alterations of the foot process/slit diaphragm complex and a reduction in podocyte number with loss of glomerular permselectivity that result in proteinuria26,27 and that trigger a progressive state of glomerulosclerosis. A number of slit diaphragm proteins have been reported, including nephrin, podocin, ZO-1, CD2AP, P-cadherin, and densin-180.28 –30 Previous studies showed a reduction in nephrin mRNA and protein expression in human31 and animal models15,32 of glomerular diseases. In our study, we investigated the effect of A2AR activation in vivo after PAN-induced nephrosis. Although mice are more resistant to PAN than rats,33 we used a different approach and demonstrated a dosage and time course of proteinuria in male mice that were administered an intravenous injection of puromycin to ensure an optimal effect. We used male mice because female mice are relatively resistant. Previous studies successfully induced PAN nephrosis in mice after a high dosage (500 mg/kg subcutaneously),34 after a high-cholesterol diet,35 or with multiple doses (20 mg/kg subcutaneously or 90 mg/kg intraperitoneally).36,37 We found that PAN led to an increase in UAE associated with foot process effacement and a reduction in podocin and ZO-1 mRNA expression. A2AR agonist treatment significantly reduced UAE in PAN-induced proteinuria and reversed the podocyte effacement observed by EM. Foot process effacement depends on disruption of the actin cytoskeletal network.38 Previous reports showed that mRNA expression and immunostaining for nephrin declined immediately after PAN injection in rats and before the incidence of proteinuria.39 Although we found a significant reduction in podocin and ZO-1 mRNA expression after PAN injection compared with control mice, there was no significant difference in nephrin mRNA expression among all groups. We believe that mice may be different from rats regarding nephrin expression with PAN nephrosis. It is also unlikely that the reduction of proteinuria in this model of PAN-induced nephrosis is due to effects of A2AR agonists on systemic BP. We previously showed that continuous administration of ATL313 (1 ng/kg per min) via osmotic minipumps had no effect on systolic BP in diabetic rats or mice treated up to 6 wk.15 In addition, a nearly identical prototypical compound, ATL146e (4 ng/kg per min), with a shorter half-life had no effect on systolic BP when infused continuously via osmotic minipumps for 24 to 28 h in rats subjected to ischemia-reperfusion injury.40 Thus, when used in the dosage range of 1 to 10 ng/kg per min via continuous infusion, it is unlikely that effect of A2AR agonists to reduce proteinuria in PAN-induced nephrosis is mediated through alterations in systemic hemodynamics. In vitro, we showed that PAN disrupts the highly organized J Am Soc Nephrol 19: 59 –68, 2008

www.jasn.org

actin cytoskeleton. Treatment of podocytes in vitro with ATL313 restored the architecture of the podocyte cytoskeleton, suggesting that the observed effect of ATL313 in vivo to restore normal podocyte structure may be due to direct effects on podocytes. The mechanisms by which this effect occurs are not known; however, there is evidence that the C-terminal domain of the A2AR interact with ␣-actinin, a major F-actin– cross-linking protein through co-localization, co-immunoprecipitation, and pull-down experiments.17 Previous observation demonstrated a transient dysregulation of ␣-actinin in podocytes just before the development of foot process effacement18 and a concomitant redistribution of ␣-actinin and actin associated with PAN-induced nephrosis.41 In addition, ␣-actinin has been shown to bind ␤1 integrin subunit and strengthen the podocyte–GBM interaction, thereby stabilizing glomerular architecture.42,43 Taken together, these observations lead us to speculate that ␣-actinin may mediate A2AR agonist’s effect on podocyte actin cytoskeleton. Additional experiments will be needed to explore this mechanism. In our study, A2AR activation led to an increase in cAMP release from differentiated podocytes. This finding is consistent with the known coupling of A2AR to stimulatory G proteins whereupon activation leads to an increase in cAMP levels.13 cAMP may be another mechanism by which A2AR agonists protect podocytes from injury. Previous reports showed that treatment of crescentic glomerulonephritis in rats with a PDE4 inhibitor to prevent the degradation of cAMP effectively reduced albuminuria and crescent formation.44 It is possible that cAMP accumulation resulting from activation of protein kinase A regulates actin filament assembly by phosphorylation of myosin light-chain kinase.45,46 In addition, increased cAMP levels in isolated glomeruli via inhibition of PDE4 may suppress the phorbol ester–induced formation of reactive oxygen metabolites.47 Furthermore, podocytes are vulnerable to many forms of both immune- and non–immune-mediated injury. PAN nephrosis has been shown to be associated with interstitial infiltration of monocytes and macrophages.48 –50 In addition, exposure to PAN increased both mRNA expression and protein production of fibronectin and monocyte chemoattractant protein 1.50 Moreover, podocytes were demonstrated to express a variety of vasoactive and immune substances that may regulate podocyte function. Given the known effect of A2A agonists to block inflammation through immune regulation of hematopoietic cells51–53 along with our finding of their anti-inflammatory effect to reduce inflammation and restore podocyte-specific gene transcripts in DN,15 it is possible that ATL313 mediates its effect in PAN nephrosis in a similar manner as it does in DN. Our in vitro and in vivo data demonstrate that podocytes express A2AR and signal through cAMP. Administration of ATL313 to mice subjected to PAN-induced proteinuria led to reduction in proteinuria and foot process effacement. We believe that the reduction of proteinuria after PAN is due to a direct effect of ATL313 on podocytes. Podocytes express A2AR, J Am Soc Nephrol 19: 59 –68, 2008

BASIC RESEARCH

and activation of A2AR expressed in podocytes grown in culture after exposure to PAN attenuated actin cytoskeletal disruption and albumin permeability. On the basis of these data, we suggest that after injury with PAN, direct activation of A2AR on podocytes restores normal function. These findings raise the possibility that podocyte A2AR might serve as a novel target for diseases that affect podocyte function.

CONCISE METHODS Puromycin-Induced Proteinuria Experiments were conducted in C57BL/6 mice (6 to 8 wk of age; Charles River Laboratories, Wilmington, MA) and were approved by the University of Virginia Animal Research Committee. Preliminary studies were conducted to determine the optimal dosage of PAN (Sigma Chemical Co., St. Louis, MO) to induce and time point to assess for proteinuria. PAN (50, 75, or 100 mg/kg) was administered by a single intravenous injection in the mouse tail vein, and urine was collected for 24 h under water-equilibrated oil at baseline and 3, 6, and 10 d to determine the rate of UAE. After determination of the optimal dosage and time for PAN treatment, mice were treated with saline or with ATL313 (1 ng/kg per min), a selective A2AR agonist, with or without the selective A2AR antagonist ZM241385 (5 ng/kg per min) via osmotic minipumps inserted at the time of injury (n ⫽ 6 per group). Urine was collected for 24 h at day 6 to determine UAE, mice were killed, and kidneys were removed for various analyses.

Transmission EM Kidneys of C57BL/6 mice were perfused through the heart with 4% (wt/vol) paraformaldehyde and 2.5% (wt/vol) glutaraldehyde in 0.1 M phosphate buffer. Renal cortices were cut (1 to 2 mm3) and fixed overnight (4°C), postfixed (24°C) in 1.0% OsO4, dehydrated, and embedded in epoxy resin according to routine procedures. Sections (approximately 70-nm thickness) were contrast stained with uranyl acetate and examined in a JEOL 1230 transmission electron microscope. Digital images were acquired using an SIA L3-C digital camera (Scientific Instruments and Applications, Duluth, GA). Sections (n ⫽ 3 per group, four different fields per section) were analyzed for density of open slit diaphragms (NIH Image J software version 1.37). Data were expressed as the number of opened slit diaphragms per micrometer of GBM length.

Cell Line and Culture Conditions A conditionally immortalized mouse podocyte cell line was cultured as described previously.54 All podocytes used in these studies expressed WT-1, and podocyte differentiation was confirmed by synaptopodin.

Induction of Podocyte Injury by PAN Treatment In Vitro All experiments were done on differentiated podocytes (1 ⫻ 105 cells/ well) in six-well culture dishes cultured for 10 d on collagen-coated coverslips before treatment. Four hours before each experiment, we added adenosine deaminase (1 U/ml; Sigma) to the culture medium to exclude any effect of endogenous adenosine. Differentiated podoPodocyte Adenosine 2A Receptors

65

BASIC RESEARCH

www.jasn.org

cytes were then exposed to 100 ␮g/ml PAN (Sigma) or vehicle for 24 h at 37°C. Podocytes were incubated in medium containing vehicle or ATL313 (50 nM) with or without ZM 241385 (150 nM) for 1 h before PAN treatment, and cells were analyzed using confocal microscopy.

Immunofluorescence and Confocal Microscopy Differentiated podocytes grown on collagen-coated glass coverslips were fixed with 3% formaldehyde, permeabilized in PIPES-buffered PBS with 0.05% saponin, and incubated in quenching buffer; blocking solution and cells were then incubated with the primary antibodies. The following primary antibodies were used: (1) Antibodies reacting with podocyte-specific antigens: rabbit anti–WT-1 protein (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-synaptopodin mAb (Research Diagnostics, Concord, MA); (2) FITC-conjugated phalloidin (Sigma); and (3) mouse anti-A2AR (clone 7F6-G5-A2).19 All specimens’ fields were selected randomly and examined using a Zeiss LSM 510-UV confocal microscope. For antibody competition studies, we used a peptide (KQMESQPLPGERARS, molecular weight 1650) corresponding to a portion of the human A2AR19 and an irrelevant peptide (LTRGYHARVQSRC, molecular weight 1660) of human secretory carrier membrane protein (a gift of Dr. David Castle, University of Virginia). The A2AR antibody was preadsorbed with immunogenic or irrelevant peptide. After incubating for 2 h at room temperature, the solution was centrifuged and the supernatant was diluted with blocking buffer to produce the desired working concentration of antibody for immunofluorescent labeling of differentiated podocytes as described previously.

Podocyte BSA Filter Assay Collagen-coated Transwell-Col PTFE filters (3 ␮m pore; Corning, New York, NY) were seeded with 1 ⫻ 104 podocytes per filter and cultured under differentiating conditions for 10 d. Cells were then incubated in the presence of adenosine deaminase (1 U/ml) with vehicle or ATL313 (50 nM) with or without ZM 241385 (150 nM) for 1 h followed by 100 ␮g/ml PAN treatment for 24 h at 37°C. Cells were washed twice with PBS supplemented with 1 mM MgCl2 and 1 mM CaCl2 to preserve the cadherin-based junctions. The upper compartment was then refilled with 0.5 ml of RPMI 1640 and the lower compartment with 1 ml of BSA medium (RPMI 1640 supplemented with 40 mg/ml BSA). Total protein concentration in the upper compart-

ment was determined at 1, 3, and 6 h using a Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA) as described previously.21

siRNA Technique Four ready-to-use validated double-stranded 21-nucleotide siRNA for A2AR (GeneBank accession no. NM_009630) were synthesized and purified (Dharmacon, LaFayette, CO; Table 1). A scrambled or irrelevant siRNA (Ambion, Austin, TX) was used as a negative control. Differentiated podocyte were maintained in RPMI 1640 medium for 10 d at 37°C in a collagen-coated plate at 70 to 80% confluence. Transfection of siRNA and controls were carried out using Oligofectamine (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol.

RT-PCR Total RNA was extracted, and single-stranded cDNA was synthesized as described previously.55 Gene-specific primers were designed using Beacon Designer Software (Premier Biosoft Int., Palo Alto, CA); the sense primer for A2AR was TGGCTTGGTGACGGGTATG, whereas the antisense primer was CGCAGGTCTTTGTGGAGTTC. Amplification products were verified by melting curves, agarose gel electrophoresis, and direct sequencing. RT-PCR was performed on the cDNA using the ThermoScript RT-PCR System with Platinum Taq DNA polymerase as described previously,55 and samples were normalized to glyceraldehyde-3-phophate dehydrogenase. For siRNA validation experiments, we designed primers for A2AR specific for the different types of siRNA positions (Table 1) and cyclophilin as control gene as described previously. The following PCR protocol was used: Initial denaturation (95°C for 3 min); denaturation, annealing, and elongation program repeated 35 times (95°C for 45 s, 56°C for 60 s, and 72°C for 60 s); final elongation (72°C for 7 min); and finally a holding step at 4°C as described previously.55

ELISA UAE was measured by ELISA using Albuwell M kit (Exocell, Philadelphia, PA).15 cAMP was measured to assess the efficacy of A2AR agonist in differentiated podocytes (Cayman Chemical, Ann Arbor, MI) in the presence of adenosine deaminase (1 U/ml) to exclude any effect of endogenous adenosine and rolipram (300 nM), a type IV phosphodiesterase inhibitor, to minimize cAMP degradation.

Table 1. siRNA oligonucleotides and their corresponding primer pairs for A2ARa siRNA Oligos

Position

Primers

Position

Length (bp)

F: GAACGUCACAAACUUCUUCUU R: GAAGAAGUUUGUGACGUUCUU

105 to 123

F:CGTGTGGATCAACAGCAAC R:TGATGGTGATGGCGAATGG

81 to 190

110

F: GAAUUCCACUCCGGUACAAUU R: UUGUACCGGAGUGGAAUUCUU

311 to 329

F: TGGCGGCGGCTGACATCG R: TTCATACCCGTCACCAAGC

134 to 350

217

F: GGACGUAGUACCCAUGAAUUU R: AUUCAUGGGUACUACGUCCUU

492 to 510

F: CAGACAGATGAGAACTCC R: AATCCTTAGGTAGATGGC

433 to 585

153

F: CUAUUGCCAUCGACAGAUAUU R: UAUCUGUCGAUGGCAAUAGUU

281 to 299

F: TGGCGGCGGCTGACATCG R: TTCATACCCGTCACCAAGC

134 to 350

217

1

2

3

4

a

F, forward; R, reverse.

66


J Am Soc Nephrol 19: 59 –68, 2008

www.jasn.org

Statistical Analyses Comparisons between groups were examined by one-way ANOVA using SPSS 14.0 software for Windows (SPSS, Chicago, IL). Multiple comparisons of individual pairs of effect means were conducted by using the least squares methods of pooled variance. Data are expressed as means ⫾ SEM. Statistical significance was identified at P ⬍ 0.05.

11. 12.

13.

ACKNOWLEDGMENTS This work was supported by National Institutes of Health grants DK56223, DK58413, DK62324, and HL37942 and Juvenile Diabetes Research Foundation grant 1-2005-1075. We gratefully acknowledge Drs. Timothy Macdonald (Department of Chemistry, University of Virginia) and Jayson Rieger (Adenosine Therapeutics, LLC, Charlottesville, VA) for the generous gift of ATL313, Jan Redick for assistance in the Center for Advanced microscopy (University of Virginia), Dr. Leslie Bruggeman (Case Western Reserve University) for generously providing immortalized podocytes, Mark Hoofnagle (University of Virginia) for assistance with the siRNA technique, and members of the Okusa lab for helpful discussions.

14.

15.

16.

17.

18.

19.

DISCLOSURES M.D.O. and J.L. own equity in Adenosine Therapeutics, which provided ATL313 for this study. All other authors have no financial conflict of interest.

REFERENCES 1. Kriz W, Gretz N, Lemley KV: Progression of glomerular diseases: Is the podocyte the culprit? Kidney Int 54: 687– 697, 1998 2. Kriz W: Podocyte is the major culprit accounting for the progression of chronic renal disease. Microsc Res Tech 57: 189 –195, 2002 3. Laurens WE, Vanrenterghem YF, Steels PS, Van Damme BJ: A new single nephron model of focal and segmental glomerulosclerosis in the Munich-Wistar rat. Kidney Int 45: 143–149, 1994 4. Kim YH, Goyal M, Kurnit D, Wharram B, Wiggins J, Holzman L, Kershaw D, Wiggins R: Podocyte depletion and glomerulosclerosis have a direct relationship in the PAN-treated rat. Kidney Int 60: 957–968, 2001 5. Schiffer M, Bitzer M, Roberts IS, Kopp JB, ten Dijke P, Mundel P, Bottinger EP: Apoptosis in podocytes induced by TGF-beta and Smad7. J Clin Invest 108: 807– 816, 2001 6. Shankland SJ: The podocyte’s response to injury: Role in proteinuria and glomerulosclerosis. Kidney Int 69: 2131–2147, 2006 7. Dedhar S, Jewell K, Rojiani M, Gray V: The receptor for the basement membrane glycoprotein entactin is the integrin alpha 3/beta 1. J Biol Chem 267: 18908 –18914, 1992 8. Schwarz K, Simons M, Reiser J, Saleem MA, Faul C, Kriz W, Shaw AS, Holzman LB, Mundel P: Podocin, a raft-associated component of the glomerular slit diaphragm, interacts with CD2AP and nephrin. J Clin Invest 108: 1621–1629, 2001 9. Luimula P, Sandstrom N, Novikov D, Holthofer H: Podocyte-associated molecules in puromycin aminonucleoside nephrosis of the rat. Lab Invest 82: 713–718, 2002 10. Raats CJ, van den Born J, Bakker MA, Oppers-Walgreen B, Pisa BJ, Dijkman HB, Assmann KJ, Berden JH: Expression of agrin, dystrogly-

J Am Soc Nephrol 19: 59 –68, 2008

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

BASIC RESEARCH

can, and utrophin in normal renal tissue and in experimental glomerulopathies. Am J Pathol 156: 1749 –1765, 2000 Smoyer WE, Mundel P: Regulation of podocyte structure during the development of nephrotic syndrome. J Mol Med 76: 172–183, 1998 Elices MJ, Urry LA, Hemler ME: Receptor functions for the integrin VLA-3: fibronectin, collagen, and laminin binding are differentially influenced by Arg-Gly-Asp peptide and by divalent cations. J Cell Biol 112: 169 –181, 1991 Linden J: Molecular approach to adenosine receptors: Receptor mediated mechanisms of tissue protection. Annu Rev Pharmacol Toxicol 41: 775–787, 2001 Olah ME, Stiles GL: Adenosine receptor subtypes: Characterization and therapeutic regulation. Ann Rev Pharmacol Toxicol 35: 581– 606, 1995 Awad AS, Huang L, Ye H, Duong ET, Bolton WK, Linden J, Okusa MD: Adenosine A2A receptor activation attenuates inflammation and injury in diabetic nephropathy. Am J Physiol Renal Physiol 290: F828 –F837, 2006 Vitzthum H, Weiss B, Bachleitner W, Kramer BK, Kurtz A: Gene expression of adenosine receptors along the nephron. Kidney Int 65: 1180 –1190, 2004 Burgueno J, Blake DJ, Benson MA, Tinsley CL, Esapa CT, Canela EI, Penela P, Mallol J, Mayor F Jr, Lluis C, Franco R, Ciruela F: The adenosine A2A receptor interacts with the actin-binding protein alpha-actinin. J Biol Chem 278: 37545–37552, 2003 Smoyer WE, Mundel P, Gupta A, Welsh MJ: Podocyte alpha-actinin induction precedes foot process effacement in experimental nephrotic syndrome. Am J Physiol 273: F150 –F157, 1997 Rosin DL, Robeva A, Woodard R, Guyenet P, Linden J: Immunohistochemical localization of adenosine A2A receptors in the rat central nervous system. J Comp Neurol 401: 163–186, 1998 Okusa MD, Linden J, Huang L, Rosin DL, Smith DF, Sullivan G: Enhanced protection from renal ischemia-reperfusion [correction of ischemia:reperfusion] injury with A(2A)-adenosine receptor activation and PDE 4 inhibition. Kidney Int 59: 2114 –2125, 2001 Rico M, Mukherjee A, Konieczkowski M, Bruggeman LA, Miller RT, Khan S, Schelling JR, Sedor JR: WT1-interacting protein and ZO-1 translocate into podocyte nuclei after puromycin aminonucleoside treatment. Am J Physiol Renal Physiol 289: F431–F441, 2005 Caulfield JP, Reid JJ, Farquhar MG: Alterations of the glomerular epithelium in acute aminonucleoside nephrosis: Evidence for formation of occluding junctions and epithelial cell detachment. Lab Invest 34: 43–59, 1976 Li L, Okusa MD: Blocking the immune response in ischemic acute kidney injury: The role of adenosine 2A agonists. Nat Clin Pract Nephrol 2: 432– 444, 2006 Lappas CM, Sullivan GW, Linden J: Adenosine A2A agonists in development for the treatment of inflammation. Expert Opin Investig Drugs 14: 797– 806, 2005 Mundel P, Reiser J, Zuniga Mejia Borja A, Pavenstadt H, Davidson GR, Kriz W, Zeller R: Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp Cell Res 236: 248 –258, 1997 Drumond MC, Kristal B, Myers BD, Deen WM: Structural basis for reduced glomerular filtration capacity in nephrotic humans. J Clin Invest 94: 1187–1195, 1994 Barisoni L, Mokrzycki M, Sablay L, Nagata M, Yamase H, Mundel P: Podocyte cell cycle regulation and proliferation in collapsing glomerulopathies. Kidney Int 58: 137–143, 2000 Shih NY, Li J, Cotran R, Mundel P, Miner JH, Shaw AS: CD2AP localizes to the slit diaphragm and binds to nephrin via a novel C-terminal domain. Am J Pathol 159: 2303–2308, 2001 Ahola H, Heikkila E, Astrom E, Inagaki M, Izawa I, Pavenstadt H, Kerjaschki D, Holthofer H: A novel protein, densin, expressed by glomerular podocytes. J Am Soc Nephrol 14: 1731–1737, 2003

Podocyte Adenosine 2A Receptors

67

BASIC RESEARCH

www.jasn.org

30. Reiser J, Kriz W, Kretzler M, Mundel P: The glomerular slit diaphragm is a modified adherens junction. J Am Soc Nephrol 11: 1– 8, 2000 31. Benigni A, Gagliardini E, Tomasoni S, Abbate M, Ruggenenti P, Kalluri R, Remuzzi G: Selective impairment of gene expression and assembly of nephrin in human diabetic nephropathy. Kidney Int 65: 2193–2200, 2004 32. Bonnet F, Cooper ME, Kawachi H, Allen TJ, Boner G, Cao Z: Irbesartan normalises the deficiency in glomerular nephrin expression in a model of diabetes and hypertension. Diabetologia 44: 874 – 877, 2001 33. Nosaka K, Takahashi T, Nishi T, Imaki H, Suzuki T, Suzuki K, Kurokawa K, Endou H: An adenosine deaminase inhibitor prevents puromycin aminonucleoside nephrotoxicity. Free Radic Biol Med 22: 597–605, 1997 34. Wang L, Fields TA, Pazmino K, Dai Q, Burchette JL, Howell DN, Coffman TM, Spurney RF: Activation of Galpha q-coupled signaling pathways in glomerular podocytes promotes renal injury. J Am Soc Nephrol 16: 3611–3622, 2005 35. Cheng ZZ, Patari A, Aalto-Setala K, Novikov D, Schlondorff D, Holthofer H: Hypercholesterolemia is a prerequisite for puromycin inducible damage in mouse kidney. Kidney Int 63: 107–112, 2003 36. Kanwar YS, Manaligod JR, Krakower CA: Aminonucleoside nephrosis in PRO/Re mice. Proc Soc Exp Biol Med 155: 339 –345, 1977 37. Pierce GB, Nakane PK: Basement membranes: Synthesis and deposition in response to cellular injury. Lab Invest 21: 27– 41, 1969 38. Benzing T: Signaling at the slit diaphragm. J Am Soc Nephrol 15: 1382–1391, 2004 39. Kawachi H, Koike H, Kurihara H, Yaoita E, Orikasa M, Shia MA, Sakai T, Yamamoto T, Salant DJ, Shimizu F: Cloning of rat nephrin: Expression in developing glomeruli and in proteinuric states. Kidney Int 57: 1949 –1961, 2000 40. Okusa MD, Linden J, Macdonald T, Huang L: Selective A2A-adenosine receptor activation during reperfusion reduces ischemia-reperfusion injury in rat kidney. Am J Physiol 277: F404 –F412, 1999 41. Lachapelle M, Bendayan M: Contractile proteins in podocytes: Immunocytochemical localization of actin and alpha-actinin in normal and nephrotic rat kidneys. Virchows Arch B Cell Pathol Incl Mol Pathol 60: 105–111, 1991 42. Otey CA, Vasquez GB, Burridge K, Erickson BW: Mapping of the alpha-actinin binding site within the beta 1 integrin cytoplasmic domain. J Biol Chem 268: 21193–21197, 1993 43. Dandapani SV, Sugimoto H, Matthews BD, Kolb RJ, Sinha S, Gerszten RE, Zhou J, Ingber DE, Kalluri R, Pollak MR: Alpha-actinin-4 is required for normal podocyte adhesion. J Biol Chem 282: 467– 477, 2007 44. Tam FW, Smith J, Agarwal S, Karkar AM, Morel D, Thompson EM, Pusey CD: Type IV phosphodiesterase inhibitor is effective in prevention and treatment of experimental crescentic glomerulonephritis.

68


Nephron 84: 58 – 66, 2000 45. Lamb NJ, Fernandez A, Conti MA, Adelstein R, Glass DB, Welch WJ, Feramisco JR: Regulation of actin microfilament integrity in living nonmuscle cells by the cAMP-dependent protein kinase and the myosin light chain kinase. J Cell Biol 106: 1955–1971, 1988 46. Somlyo AP, Wu X, Walker LA, Somlyo AV: Pharmacomechanical coupling: The role of calcium, G-proteins, kinases and phosphatases. Rev Physiol Biochem Pharmacol 134: 201–234, 1999 47. Chini CC, Chini EN, Williams JM, Matousovic K, Dousa TP: Formation of reactive oxygen metabolites in glomeruli is suppressed by inhibition of cAMP phosphodiesterase isozyme type IV. Kidney Int 46: 28 –36, 1994 48. Eddy AA, McCulloch L, Liu E, Adams J: A relationship between proteinuria and acute tubulointerstitial disease in rats with experimental nephrotic syndrome. Am J Pathol 138: 1111–1123, 1991 49. Eddy AA, Michael AF: Acute tubulointerstitial nephritis associated with aminonucleoside nephrosis. Kidney Int 33: 14 –23, 1988 50. Moreno-Manzano V, Mampaso F, Sepulveda-Munoz JC, Alique M, Chen S, Ziyadeh FN, Iglesias-de la Cruz MC, Rodriguez J, Nieto E, Orellana JM, Reyes P, Arribas I, Xu Q, Kitamura M, Lucio Cazana FJ: Retinoids as a potential treatment for experimental puromycin-induced nephrosis. Br J Pharmacol 139: 823– 831, 2003 51. Day YJ, Huang L, McDuffie MJ, Rosin DL, Ye H, Chen JF, Schwarzschild MA, Fink JS, Linden J, Okusa MD: Renal protection from ischemia mediated by A2A adenosine receptors on bone marrow-derived cells. J Clin Invest 112: 883– 891, 2003 52. Okusa MD, Linden J, Huang L, Rieger JM, Macdonald TL, Huynh LP: A2a-Adenosine receptor mediated inhibition of renal injury and neutrophil adhesion. Am J Physiol 279: F809 –F818, 2000 53. Ohta A, Sitkovsky M: Role of G-protein-coupled adenosine receptors in downregulation of inflammation and protection from tissue damage. Nature 414: 916 –920, 2001 54. Schwartz EJ, Cara A, Snoeck H, Ross MD, Sunamoto M, Reiser J, Mundel P, Klotman PE: Human immunodeficiency virus-1 induces loss of contact inhibition in podocytes. J Am Soc Nephrol 12: 1677–1684, 2001 55. Awad AS, Ye H, Huang L, Li L, Foss FW Jr, Macdonald TL, Lynch KR, Okusa MD: Selective sphingosine 1-phosphate 1 receptor activation reduces ischemia-reperfusion injury in mouse kidney. Am J Physiol Renal Physiol 290: F1516 –F1524, 2006

Supplemental information for this article is available online at http://www. jasn.org/.

J Am Soc Nephrol 19: 59 –68, 2008