Eur J Nutr DOI 10.1007/s00394-013-0594-7
ORIGINAL CONTRIBUTION
Adiponectin receptor 1 enhances fatty acid metabolism and cell survival in palmitate-treated HepG2 cells through the PI3 K/AKT pathway I-Pin Chou • Yuan Yu Lin • Shih-Torng Ding Ching-Yi Chen
•
Received: 20 June 2013 / Accepted: 2 October 2013 Ó Springer-Verlag Berlin Heidelberg 2013
Abstract Purposes Hepatic lipid overloading induces lipotoxicity which can cause hepatocyte damage, fibrosis, and eventually progress to cirrhosis, which is associated with nonalcoholic fatty liver disease. Adiponectin receptors play important roles in regulating lipid metabolism. In this study, we used a lentivirus system to overexpress the adiponectin receptor 1 (AdipoR1) in HepG2 cells to define the role of adiponectin and its receptor 1 in the development of fatty liver syndrome. Methods and results Exposure of human hepatocytes, HepG2 cells, to palmitate (0.2 or 0.4 mM) for 16 h resulted in elevated apoptosis, whereas AdipoR1 decreased the palmitate-induced apoptosis. Transgene AdipoR1 increased the expression of FATP2, acyl-coA oxidase, and carnitine palmitoyltransferase I in palmitate-treated HepG2 cells. The transcript level of acetyl-CoA carboxylase and fatty acid synthase was upregulated by palmitate treatment, while AdipoR1 reversed the effect induced by palmitate. AdipoR1 increased the gene expression of cytochrome C oxidase, peroxisome proliferator-activated receptor a, and decreased the gene expression of PGC1a and AMPKa in HepG2 cells under palmitate treatment. Palmitate suppressed ATP production, while transgene AdipoR1 reversed the decreased
I.-P. Chou Y. Y. Lin S.-T. Ding C.-Y. Chen (&) Department of Animal Science and Technology, National Taiwan University, 50, Lane 155, Sec 3, Keelung Rd, Taipei 112, Taiwan e-mail:
[email protected] S.-T. Ding Institute of Biotechnology, National Taiwan University, No. 50, Lane 155, Sec 3 Keelung Rd, Taipei, Taiwan
ATP production by palmitate. Transgene AdipoR1 enhanced AKT phosphorylation in HepG2 cells both with and without palmitate treatment. When PI3 kinase inhibitor was applied, the protective effect of AdipoR1 was absent, such that palmitate again decreased ATP production while also reducing cell viability. Conclusion AdipoR1 enhances fatty acid metabolism and cell viability in palmitate-treated HepG2 cells partially by activating AKT signaling. Therefore, AdipoR1 has therapeutic potential in the treatment of nonalcoholic fatty liver disease. Keywords Adiponectin receptor 1 HepG2 Apoptosis Lipid metabolism PI3K/AKT
Introduction Adiponectin, secreted mainly from white adipose tissue, regulates fatty acid and glucose metabolism, which contributes to anti-obesity, anti-diabetes, and anti-inflammation [1]. These physiological benefits act through its multiple receptors, including adiponectin receptor 1 (AdipoR1), AdipoR2, and T-cadherin [2–4]. While AdipoR 1 is ubiquitously expressed, it is most abundantly expressed in skeletal muscle. In human and rodent studies, AdipoR1 expression is decreased in type II diabetic and obese subjects [4, 5]. Mouse knockout AdipoR1 genes increase adiposity and decrease glucose tolerance [6]. The mechanisms by which AdipoR1 regulates cell functions have not been clarified completely, although some pathways have been suggested. AdipoR1 has been reported to act through activation of the 5-adenosine monophosphate-activated protein kinase (AMPK) pathway [7, 8], which in turn stimulates glucose uptake and decreases fat accumulation.
123
Eur J Nutr
In other studies, however, AdipoR1 was mediated by peroxisome proliferator-activated receptors (PPARs) in human macrophages [9], and the induction of AdipoR1 has been correlated with an increase in the expression of PPARa in adipose tissue [10]. The major fate of palmitate in the cell is to supply energy and compose cell membrane. Nevertheless, excess palmitate has been reported to have many health disadvantages and constitutes lipotoxicity. This can cause cellular dysfunction, cell death, and eventual organ dysfunction [11–14]. Several mechanisms of palmitateinduced apoptosis have been proposed. In cardiomyocytes, palmitate induces cell apoptosis via activation of the apoptotic mitochondrial pathway [11, 12]. Additionally, palmitate decreases synthesis of cardiolipin, a mitochondrial membrane phospholipid, increases ceramide synthesis, promotes reactive oxygen species (ROS) generation, and, therefore, induces apoptosis [12, 15]. In numerous studies, de novo ceramide synthesis has been connected to the induction of apoptosis. Ceramide-related pathways were originally considered the most likely mechanism for palmitate-induced cell death [11, 12]. Adiponectin is reported to inhibit palmitate-induced apoptosis by blocking palmitate-induced phosphorylation of c-Jun NH2 terminal kinase (JNK) in HepG2 cells [13]. Because phosphatidylinositol 3 (PI3)-kinase has the ability to suppress JNK, its inhibitors abolish the effects of adiponectin in palmitate-induced apoptosis [13]. Another study suggests that adiponectin inhibited palmitateinduced apoptosis through suppression of reactive oxygen species (ROS) [14]. Treatment with antioxidants and adiponectin inhibited palmitate-induced ROS generation and apoptosis, and the inhibitory effects of adiponectin on ROS generation and apoptosis were reversed by the AMPK inhibitor or protein kinase A (PKA) inhibitor [14]. The results demonstrate that adiponectin inhibits palmitate-induced apoptosis by suppression of ROS generation via both the cAMP/PKA and AMPK pathways. These two studies showed adiponectin amelioration of palmitateinduced cell apoptosis, but there were actually two different kinds of adiponectin used in the studies. In the first study, full-length adiponectin was used, while in the second study, globular adiponectin was used. In addition, there are more than these two forms of adiponectin circulating in plasma, and the protein structure of adiponectin modulates its physiological functions [16]. In order to simplify the complexities involved in adiponectin signaling, we chose an approach more effective and closer to physiological circumstances. We investigated the effect of AdipoR1 through genetic manipulation on fatty acid metabolism and further on cell apoptosis in palmitatetreated HepG2 cells.
123
Materials and methods Materials All chemicals and reagents were purchased from SigmaAldrich (Sigma-Aldrich, St. Louis, MO, USA) unless otherwise indicated. Fetal bovine serum (FBS) and Dulbecco’s modified Eagle’s medium (DMEM) were purchased from Gibco (Gibco, Grand Island, NY). Palmitic acid and LY294002 were purchased from Cayman Chemical (Ann Arbor, MI, USA). Cell culture and palmitate treatment Studies were performed in the human hepatoblastoma cell line HepG2, purchased from the Bioresource Collection and Research Center (BCRC, Hsinchu, Taiwan). Cells were cultured in DMEM with 10 % FBS, penicillin (100 units/ml), streptomycin (0.1 mg/ml), and amphotericin B (0.00025 mg/ml) (Biological industries, Ireland). The cells were cultured at 37 °C in a humidified atmosphere containing 5 % CO2, with medium changes three times a week. All studies were conducted using 80–90 % confluent cells, which were treated with the indicated concentrations of palmitate with palmitate-to-fatty acid free bovine serum albumin (BSA) (US Biological, Texas, USA) in the molar ratio of 3:1. Palmitic acid was dissolved in dimethyl sulfoxide (DMSO) as a stock. Adequate PBS was used to dissolve fatty acid free BSA at 37 °C and then added to the palmitate with vortexing. Culture medium was mixed with palmitate solution and then sonicated for at least 30 min. Then, the palmitate medium was substituted for culture medium. Transfection To setup a porcine AdipoR1 transgene system, 70 % confluent 293T cells in a 10-cm dish were used to produce lentivirus. A mixture of the plasmids pMD-G (6 lg), pCMV4R8.2 (9 lg), and pSIN-MCS vector (12 lg) was constructed with FLAG-tag and with or without porcine AdipoR1 transgene according to the manufacturer’s instructions (Qiagen). Next, 70–80 % confluent HepG2 cells were transfected by lentivirus produced from the 293T cells. Virus solution (0.5 mL), FBS-free medium (0.5 mL), and polybrene (1 lL) were mixed and added to HepG2 cells twice. Then, the cells were incubated in 10 % FBS DMEM for 2 days. The transfected cells were trypsinized, and the protein expression of FLAG-tag constructed with porcine AdipoR1 transgene was examined. The sequence of the transgene porcine AdipoR1 is listed in Table 1.
Eur J Nutr
Cell viability and MTT assay The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay, an index of cell viability and cell growth, is based on the ability of viable cells to reduce MTT from a yellow water-soluble dye to a dark blue insoluble formazan product. HepG2 cells were grown in a 24-well plate with a density of 104 cells per well for 10 h. They were treated with various concentrations of palmitate and/or other agents. After the appropriate time, 1 mL medium with 0.1 % volume MTT dye substituted the medium containing palmitate and the hepatocytes were continually incubated at 37 °C for 1.5 h. Then, DMSO was added to solubilize the formazan salt, which was measured spectrophotometrically at 562 nm (Epoch, BioTek, USA). The data, calculated relative to the mock, represent the mean from 6 independent experiments. A value where P \ 0.05 was considered significant. Apoptosis detection and flow cytometry The assay for apoptosis was performed according to the manufacturer’s instructions (PE Annexin V Apoptosis Detection Kit I, BD PharMingen, NJ, USA). In brief, HepG2 cells, mock, and AdipoR1 cells, at 24 h of culture, were cultured without or with palmitate for 16 h. The reaction was stopped by the removal of media, followed by brief exposure to trypsin (Gibco) to suspend the adherent cells. Trypsinization was stopped by dilution with DMEM media containing 10 % FBS. The suspended hepatocytes were gently spun down and washed twice with cold PBS, then were resuspended in binding buffer, and stained with PE annexin V and 5 ll 7-AAD staining buffer for 15 min at 25 °C in the dark. The residual binding buffer was added as indicating in manufacturer’s instructions and then analyzed by flow cytometry within 1 h. Inhibition of PI3-kinase pathways To elucidate the upstream pathway involved in AdipooR1 against palmitate-induced damage, a PI3 kinase inhibitor, LY294002, was applied. HepG2 cells were incubated with DMEM supplemented with 10 % FBS for 24 h. The cells
were exposed to inhibitors LY294002 for 60 min prior to and for the duration of the palmitate treatment. The cells were harvested 1 h (for protein expression) and 16 h (for ATP and MTT assay) after the addition of palmitate. Real-time polymerase chain reaction (PCR) Total RNA were extracted from HepG2 cells using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The RNA samples were digested with DNase I (Ambion, Austin, TX, USA) at 37 °C for 30 min to remove the genomic DNA and then were reverse transcribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). The cDNA for various genes was amplified using the DyNAmo Flash SYBR Green Kit (Finnzymes, Espoo, Finland). They were performed on CFX96 Real-Time PCR Detection System (Bio-Rad, Richmond, CA, USA), and the conditions of real-time PCR were initially denatured at 95 °C for 7 min, denatured at 95 °C for 10 s, and annealed/extended at 60 °C for 30 s, for 39 cycles. The primer sequences for the genes measured are listed in Table 2. Primers were designed based on human gene sequence using Primer3 software [17]. The b-actin mRNA was also determined and served as the internal control. The mRNA expression of each gene was normalized to its b-actin mRNA expression. Threshold cycle (Ct) values were obtained, and relative gene expression was calculated using the formula (1/2)Ct (target gene)-Ct (b-actin). Oil red O staining Mock and AdipoR1 cells supplemented without or with palmitate for 16 h were washed twice with PBS and then fixed with 10 % formalin for at least 10 min. Formalin was removed, and cells were rinsed with water three times and then incubated in 100 % propylene glycol for 2 min. After propylene glycol was discarded, oil red O solution was added to each well for at least 20 min. Finally, cells were washed with 60 % propylene glycol for 1 min and rinsed with water for 5 min. The images of cells were recorded on a microscope.
Table 1 The sequence of porcine adiponectin receptor 1 we used as transgene (50 ? 30 ) gaattcgcccttgccaccatgtcttctcacaaaggacctgtgggagcccagggcaatggggctccagctggcagcagggaggccgacaccgtggagctggcagaactgggccccctgctagaggagaaggg cacgcggggcaccaccaacccacccaaagctgaagaagagcaggcatgcccagtgcctcaggaagaagaggaggaggtgcgggtgctgacgctccccctgcaagcccaccatgccatggagaagatg gaggagtttgtgtataaggtctgggaaggtcgctggagggtcatcccgtacgacgtgctccctgactggctgaaggacaacgactacctgctgcacggccacaggccgcccatgccctccttccgggcgtgct tcaagagcatcttccgcatccacacagagactggcaacatctggacccacctgcttggttttgtgctgtttctctttttgggaatcttgaccatgctcagaccaaatatgtatttcatggccccccttcaggagaaggt ggtgtttgggatgttcttcttgggtgccgtgctctgcctcagcttctcctggctcttccacaccgtctattgtcattcagagaaagtctctcggactttttccaaactggattattcagggattgccctcctgatcatgggg agcttcgtcccctggctctattactcgttctactgctccccgcagccacggctcatctacctctccatcgtctgtgtcctgggcatttctgccatcattgtggcgcagtgggaccggtttgccactcctaagcaccggc agacaagagcaggggtgttcctggggcttggcctgagtggcgttgtgcccaccatgcactttacgatcgcggagggtttcgtcaaggccaccaccgtgggccagatgggctggttcttcctcatggctgtgat gtacatcaccggagccggcctttatgctgcgcgcattcctgagcgcttcttccctggaaaattcgacatatggttccagtctcatcagatcttccacgtcctggtggtggcagcagcctttgtccacttctatggggtc tccaaccttcaggagttccgctacggcctggaaggcggctgcaccgacgactccctcctcggc
123
Eur J Nutr Table 2 The following are the primers used for real-time PCR analysis Gene
Sense (50 ? 30 )
Antisense (30 ? 50 )
Annealing temperature (oC)
AMPKa
CCAGGATCCTTTGGCAGTTGCC
AGGGTATGGCGTGCCCTTGGT
60
FATP2
TGGAACCACAGGTGCTACTCT TGC
GCCATTTCCCAGTGCCAGTCTCAC
60
AdipoR1
TCGGACTTTTTCCAAACTGG
CACAATGATGGCAGAAATGC
60
ACO
CAGGAA AGTTGGTGTGTGGC
AAT CTGGCTGCACGGAGTTT
60
CPT1
GATCATGCACTGTTGACCAC
TACATTTGAAACATTTAAAACCTGA
60
ACC
GCCATTTCCCAGTGCCAGTCTCAC
ACCGAGTGAACACCATCCTC
60
FAS Cytochrome C oxidase
ACAGGGACAACCTGGAGTTCT GGGCAGTGGCGGCAGAATGT
CTGTGGTCCCACTTGATGAGT CATGGGCCACCTCCGGCAAG
60 60
PGC1a
CACTCCTCCTCATAAAGCCAAC
GGACTTGCTGAGTTGTGCATAC
60
PPARa
GCAGAAACCCAGAACTCAGC
ATGGCCCAGTGTAAGAAACG
60
SPTLC
TGGATTTGCCACCATAGCCAGTGC
TCGCTCGAGGTCAGCCATGTCA
60
Caspase 3
GGCGGTTGTAGAAGAGTTTCGTGAG
TGAGAATGGGGGAAGAGGCAGGTG
60
FATP2 fatty acid transport protein 2, ACO acyl-CoA oxidase, CPT1 carnitine palmitoyltransferase 1, ACC acetyl-CoA carboxylase, FAS fatty acid synthase, SPTLC serine palmitoyltransferase
Protein expression and Western blotting Whole-cell lysates/FBS were prepared, and Western blotting was performed as described in previous studies [18]. Antibodies specific for adiponectin (Biovision CA, USA), AKT, p-AKT, (Cell signaling), and cyclophilin A (Genetex, Irvine, CA, USA) and b-actin (Santa Cruz Biotechnology, Santa cruz, CA, USA) were used to detect the corresponding proteins. Signals were visualized and quantified using QUANTITY ONE software (Amersham Biosciences). Data analysis Data were expressed as mean ± SD. Statistical significances among different experimental groups were determined by one-way analysis of variance (ANOVA). Duncan’s test was used to evaluate differences among treatments. Values where P B 0.05 were considered significant.
Results Overexpression of porcine adiponectin receptor 1 in HepG2 cells In a previous study, we cloned porcine AdipoR1, which is highly homologous to human AdipoR1, and found that the transgene prevented diet-induced obesity and fatty liver disease in mice [19]. In the present study, we used the lentivirus system to overexpress this transgene in HepG2 cells to study its role in palmitate-induced lipotoxicity. The mRNA expression of AdipoR1 was significantly increased
123
in the transgenic cells (Fig. 1a), and the flag proteins, which were constructed at the AdipoR1 vectors, were 5-folds higher than in the mock cells (Fig. 1b). Forms of adiponectin oligomer in fetal bovine serum The multimer forms of adiponectin oligomers in FBS were detected by using Native PAGE (Fig. 1c). There are three forms of adiponectin oligomers observed in FBS. High molecular weight (HMW) form is the majority, counts 54 % of total adiponectin. Medium molecular weight (MMW) and low molecular weight (LMW) count 19 and 27 % of total adiponectin, respectively. The amount of adiponectin in FBS is 1.5 lg/mL (quantitated by the recombinant protein). Adiponectin receptor 1 ameliorated palmitate-induced cell death Compared to untreated cells, palmitate treatment (0.2 or 0.4 mM) reduced cell viability. The cell viability of palmitate-treated mock cells was about 60 % after palmitate treatment for 16 h (Fig. 2a), while AdipoR1 increased it to about 90 % (Fig. 2b). The apoptosis assay using annexin V and PI staining was conducted to distinguish the apoptotic cells from the necrosis cells in cell death (Fig. 2c). Palmitate induced apoptosis of mock cells, while AdipoR1 suppressed palmitate-induced apoptosis. Meanwhile, AdipoR1 inhibited the expression of both caspase 3 (Fig. 3a) and serine palmitoyltransferase (SPTLC, a key regulator of de novo ceramide synthesis) (Fig. 3b) in cells under palmitate treatment, suggesting that these two genes may partially participate in AdipoR1-ameliorated cell death under palmitate treatment.
Eur J Nutr
Fig. 1 a Adiponectin receptor 1 gene expression in the wild-type HepG2 cells, mock cells and AdipoR1-transfected cells. The mRNA levels were measured by the real-time PCR, normalized to b-actin, and expressed relative to the wild-type cells. b Protein expression (FLAG-tag) of adiponectin receptor 1 in the mock cells and AdipoR1transfected cells. Relative protein levels were quantified and normalized to cyclophilin A, and data were shown in comparison with the mock cells. Values are mean ± SD (n = 5). *P \ 0.05 and **P \ 0.01 vs mock cells. c Protein expression of adiponectin in the fetal bovine serum. Fetal bovine serum was subjected to Native PAGE, and multimer forms of adiponectin were detected by using adiponectin antibody (Biovision, CA, USA). HMW high molecular weight, MMW medium molecular weight, LMW low molecular weight
Effects of adiponectin receptor 1 on lipid metabolism AdipoR1 transgene significantly increased the gene expression of fatty acid transport protein 2 (FATP2) (Fig. 4a), acyl-CoA oxidase (ACO) (Fig. 4b), and carnitine
Fig. 2 a Time-dependent effects of palmitate on mock cell viability. Effects of palmitate on cell viability b and apoptosis c in the mock cells and AdipoR1-transfected cells after palmitate treatment for 16 h. The data were expressed relative to the mock cells without treatment. Values are mean ± SD (n = 5). *P \ 0.05 versus the mock without treatment at hour 0. P \ 0.05 significantly different from the 0.2 mM of palmitate treatment at the same time point. Bars with different letters are significantly different (P \ 0.05)
palmitoyltransferase 1 (CPT1) (Fig. 4c) in cells under high concentration of palmitate treatment, while it reduced the mRNA expression of acetyl-CoA carboxylase (ACC) (Fig. 4d) and fatty acid synthase (FAS) (Fig. 4e) under palmitate treatment. In addition, the lipid accumulation in AdipoR1 was significantly decreased compared to that in mock cells after palmitate treatment for 16 h (Fig. 4f). These results indicate that AdipoR1 facilitates fatty acid
123
Eur J Nutr
Fig. 3 Effects of palmitate on gene expression of a caspase 3 and b serine palmitoyltransferase in the mock cells and AdipoR1transfected cells after palmitate treatment for 1 h. All the mRNA levels were measured by the real-time PCR and normalized to b actin
and expressed relative to the mock without treatment. Values are mean ± SD (n = 5). Left panel *P \ 0.05. Right panel bars with different letters are significantly different (P \ 0.05)
catabolism and represses fatty acid synthesis, thereby decreasing the lipid accumulation under high concentration of palmitate treatment. In addition, we analyzed energy production-related gene cytochrome C oxidase (Fig. 5a) and other regulators that facilitate fatty acid oxidation, peroxisome proliferator-activated receptor-coactivator 1-a (PGC1a) (Fig. 5b), peroxisome proliferator-activated receptor-a (PPARa) (Fig. 5c), and 5-AMP-activated protein kinase-a (AMPKa) (Fig. 5d). With AdipoR1 overexpression, cytochrome C oxidase and PPARa gene expressions were significantly increased under palmitate treatment, suggesting these genes may participate in AdipoR1-regulating pathways. However, PGC1a gene expression was significantly decreased in AdipoR1 cells under palmitate treatment. Interestingly, gene expressions of FATP2, CPT1, ACC, cytochrome C oxidase, and PGC1a in AdipoR1 cells presented with significant differences than in mock cell even without palmitate treatment, suggesting the effects of AdipoR1 itself.
resulted in increasing lipid accumulation and decreasing ATP production. With palmitate treatment, AdipoR1 elevated the palmitate-reduced ATP levels, while it decreased the lipid accumulation. Taken together, AdipoR1 may increase fatty acid catabolism and provide more energy for HepG2 cells.
Adiponectin receptor 1 increased ATP production In mock cells, palmitate treatment reduced ATP levels (Fig. 6a), while increasing lipid droplets (Fig 4f). Although palmitate treatment increased both fatty acid catabolism and synthesis-related gene expression, excess palmitate
123
Adiponectin receptor 1 activated phosphorylation of AKT and further affected cell functions Considering that the PI3K/AKT pathway is associated with cell survival [20] and is impaired in high-fat fed rat livers [21], we investigated whether AdipoR1 would protect cells from palmitate-induced dysfunction and death through this pathway. AdipoR1 significantly increased AKT phosphorylation both with and without palmitate treatment (Fig. 6b), and this increased phosphorylation was diminished by addition of PI3 K inhibitor, LY294002. In addition, the increased ATP level in AdipoR1 under palmitate treatment was reduced by LY294002 (Fig. 6a), demonstrating that the effects of AdipR1 on increasing ATP production stem partially from activating PI3K/AKT pathways. Moreover, when LY294002 was input, the rescue effect of AdipoR1 on cell viability under palmitate treatment was no longer active (Fig. 6c). Taken together, PI3K/AKT pathways
Eur J Nutr
Fig. 4 Effects of palmitate on the gene expression related to lipid metabolism in the mock cells and AdipoR1-transfected cells after 1-h treatment. a fatty acid transport protein 2, b acyl-CoA oxidase, c carnitine palmitoyltransferase 1, d acetyl-CoA carboxylase, and e fatty acid synthase. f Oil red O staining of the mock-/AdipoR1transfected cells after 16-h treatment with palmitate (910). All the
mRNA levels were measured by the real-time PCR and normalized to b actin and expressed relative to the mock without palmitate treatment. Values are mean ± SD (n = 5). Left panel *P \ 0.05. Right panel bars with different letters are significantly different (P \ 0.05)
participate in AdipoR1-increased cell survival under palmitate treatment.
Our results were consistent with findings of other studies. In addition, we found that excess palmitate was involved in ceramide-dependent apoptosis, and AdipoR1 might reduce ceramide-dependent apoptosis by decreasing the expression of genes involved in de novo ceramide synthesis (Fig. 3b). The mechanism by which palmitate induces cell apoptosis is controversial. One of the explanations is that palmitate increases de novo synthesis of ceramide, a species of pro-apoptotic lipids. In Chinese hamster ovary cells [25] and cardiomyocytes [26], treatment with palmitate increased ceramide levels. Inhibition of ceramide synthesis reduced cell apoptosis, but not completely. Another explanation has been proposed that palmitate results in ROS overproduction, an important regulator of apoptosis in many systems. Antioxidant N-acetyl-L-cysteine reduces palmitate-induced ROS production and cell apoptosis in endothelial cells [14], whereas in cardiomyocytes, other antioxidants, including N-acetyl-L-cysteine, do not reduce palmitate-induced apoptosis [26, 27].
Discussion Fatty liver occurs frequently in obesity and is the first stage of nonalcoholic fatty liver disease (NAFLD), a chronic disease syndrome that can lead to nonalcoholic steatohepatitis and end-stage liver disease [22, 23]. In one study, mice fed with two different diets were used to mimic the spectrum of human NAFLD. One group was fed a high-fat diet and the other a methionine and choline deficient diet. Both groups developed hepatic steatosis, and the most abundant saturated fatty acid in livers of both animal models was palmitate [24]. Excess palmitate has been linked to lipotoxicity and shown to induce cell apoptosis in many cell types, including hepatocytes [11–14]. Apoptotic cells undergo a loss of cell membrane asymmetry, which was examined by annexin V staining in our study (Fig. 2).
123
Eur J Nutr Fig. 5 Effects of palmitate on gene expression of a cytochrome C oxidase b PGC1a c PPAR a and d AMPK a in the mock cells and AdipoR1-transfected cells after 1-h treatment. All the mRNA levels were measured by the real-time PCR and normalized to b actin and expressed relative to the mock without palmitate treatment. Values are mean ± SD (n = 5). Left panel *P \ 0.05. Right panel bars with different letters are significantly different (P \ 0.05)
These discrepancies may be due to different treatment durations, palmitate concentrations, or cell types. In fact, both ceramide and ROS and other factors related to palmitate-induced apoptosis, including endoplasmic reticulum stress and triglyceride accumulation, were all investigated in livers [28]. Apparently lipotoxicity is a comprehensive result which is associated with many mechanisms.
123
The adipokine adiponectin is claimed to have many health benefits including anti-obesity, anti-diabetic, and anti-oxidative stress [1]. Additionally, full-length adiponectin was previously found to have a protective role in palmitate-treated hepatocytes [13]. However, there is more than one form of adiponectin in human plasma and they all have different binding affinities to adiponectin receptors. In fact, there are two main types of membrane proteins that
Eur J Nutr
Fig. 6 Effect of palmitate, adiponectin receptor 1, and PI3 K inhibitor, LY294002, on a ATP production b AKT phosphorylation, and c cell viability. Mock- and AdipoR1-transfected cells were treated with or without palmitate (0.4 mM)/LY294002 (10 lM). Values are mean ± SD (n = 5). P \ 0.05 versus the mock without palmitate and LY294002 treatment. *P \ 0.05 versus AdipoR1 transfected cells with palmitate, and without LY294002 treatment
serve as receptors for adiponectin–AdipoR1 and AdipoR2. Obesity decreases expression levels of both AdipoR1 and 2 [29]. Previous research has found that with exercise,
AdipoR1 expression in mice livers was significantly increased, whereas AdipoR2 was initially increased and then decreased [30]. Increased AdipoR1 compensating for the decreased expression of AdipoR2 could explain this result [31]. In addition, AdipoR1 but not AdipoR2 was reported to be involved in lipid metabolism [3, 4]. It is for this reason that we chose to investigate the effects of AdipoR1 instead. Also, no one has ever studied the role of AdipoR1 in palmitate-treated hepatocytes. Our findings show that AdipoR1 improves fatty acid metabolism and attenuates palmitate lipotoxicity and even reverses decreased ATP levels and cell apoptosis. Expression or suppression of AdipoR1 reveals that it serves as receptor for different forms of adiponectin and mediates fatty acid oxidation [32]. In our previous work [19], we cloned porcine AdipoR1 and found the transgene prevented mice from developing diet-induced obesity and fatty liver disease. In the present in vitro study, overexpression of AdipoR1 in HepG2 cells with palmitate treatment resulted in increasing fatty acid oxidation-related gene expression and ATP production, meanwhile reducing fatty acid synthesis-related gene expression and lipid accumulation, which conforms to previous in vivo data. Overexpression of AdipoR1 attenuates palmitateinduced apoptosis in HepG2 cells. Other research groups have investigated the effects of adiponectin in cells with palmitate treatment [13]. The addition of either wortmannin or compound c in the presence of full-length adiponectin prevented the effects of adiponectin, which implies that full-length adiponectin inhibits apoptotic cell death via AMPK and PI3 kinase activation. It did not inhibit elevated endoplasmic reticulum stress suggesting the protection involves a pathway independent of endoplasmic reticulum stress [13]. This study also indicated that Bcl-2 and the inhibitor of apoptosis protein family were not involved in adiponectin-mediated protective effects. The present study agrees with these findings. We observed that AdipoR1 ameliorates palmitate-induced cell death and PI3 K/AKT is involved as a signal pathway (Fig. 6). Combining these data, the protective effects of adiponectin by PI3 kinase are partially through AdipoR1. It should be noted that in present study, we did not culture cells with exogenous adiponectin, but it existed in the FBS we used (Fig. 1c), so whether the effects in our study come from AdipoR1 itself, the adiponectin in FBS, or even other factors in cells or in medium is un-clarified. In any case, according to the circulating adiponectin and tissue, mRNAs were decreased in our AdipoR1 transgenic mice [19], and AdipoR1 itself indeed plays a role to a certain extent. The PI3K/AKT pathway is impaired in high-fat fed rat livers [21], and in vitro studies reveal that palmitate decreases AKT phosphorylation [33]. This was proved in our study as well (Fig. 6), and furthermore, the
123
Eur J Nutr
overexpression of AdipoR1 elevated AKT phosphorylation. Many studies indicate that adiponectin increases phosphorylation of AKT and thus affects cell physiology [34, 35]. In our study, AdipoR1 displayed its functions partially through PI3 K/AKT pathways, including increasing ATP levels and cell viability reduced by palmitate. To conclude, the present study demonstrates that AdipoR1 ameliorates palmitate-induced apoptosis, in which PI3K/AKT pathways may be involved, indicating the potential for therapeutic use of AdipoR1 in the treatment of nonalcoholic fatty liver disease. Acknowledgments The authors would like to express our gratitude to the laboratory members for their help and input during the study. This study was supported in part by a Grant (102R7615-3) from National Taiwan University and Grants (NSC 99-2313-B-002-031 and NSC 101-2313-B-002-030-MY3) from the National Science Council in Taiwan. Conflict of interest of interest.
The authors declare that they have no conflict
References 1. Okamoto Y, Kihara S, Funahashi T, Matsuzawa Y, Libby P (2006) Adiponectin: a key adipocytokine in metabolic syndrome. Clin Sci (Lond) 110(3):267–278 2. Hug C, Wang J, Ahmad NS, Bogan JS, Tsao TS, Lodish HF (2004) T-cadherin is a receptor for hexameric and high-molecular-weight forms of Acrp30/adiponectin. Proc Natl Acad Sci USA 101(28):10308–10313 3. Staiger H, Kaltenbach S, Staiger K, Stefan N, Fritsche A, Guirguis A, Peterfi C, Weisser M, Machicao F, Stumvoll M, Haring HU (2004) Expression of adiponectin receptor mRNA in human skeletal muscle cells is related to in vivo parameters of glucose and lipid metabolism. Diabetes 53(9):2195–2201 4. Wang H, Zhang H, Jia Y, Zhang Z, Craig R, Wang X, Elbein SC (2004) Adiponectin receptor 1 gene (ADIPOR1) as a candidate for type 2 diabetes and insulin resistance. Diabetes 53(8): 2132–2136 5. Bauer S, Weigert J, Neumeier M, Wanninger J, Schaffler A, Luchner A, Schnitzbauer AA, Aslanidis C, Buechler C (2010) Low-abundant adiponectin receptors in visceral adipose tissue of humans and rats are further reduced in diabetic animals. Arch Med Res 41(2):75–82 6. Bjursell M, Ahnmark A, Bohlooly YM, William-Olsson L, Rhedin M, Peng XR, Ploj K, Gerdin AK, Arnerup G, Elmgren A, Berg AL, Oscarsson J, Linden D (2007) Opposing effects of adiponectin receptors 1 and 2 on energy metabolism. Diabetes 56(3):583–593 7. Kola B, Boscaro M, Rutter GA, Grossman AB, Korbonits M (2006) Expanding role of AMPK in endocrinology. Trends Endocrinol Metab 17(5):205–215 8. Kubota N, Yano W, Kubota T, Yamauchi T, Itoh S, Kumagai H, Kozono H, Takamoto I, Okamoto S, Shiuchi T, Suzuki R, Satoh H, Tsuchida A, Moroi M, Sugi K, Noda T, Ebinuma H, Ueta Y, Kondo T, Araki E, Ezaki O, Nagai R, Tobe K, Terauchi Y, Ueki K, Minokoshi Y, Kadowaki T (2007) Adiponectin stimulates AMP-activated protein kinase in the hypothalamus and increases food intake. Cell Metab 6(1):55–68
123
9. Chinetti G, Zawadski C, Fruchart JC, Staels B (2004) Expression of adiponectin receptors in human macrophages and regulation by agonists of the nuclear receptors PPARalpha, PPARgamma, and LXR. Biochem Biophys Res Commun 314(1):151–158 10. Karbowska J, Kochan Z (2005) Effect of DHEA on endocrine functions of adipose tissue, the involvement of PPAR gamma. Biochem Pharmacol 70(2):249–257 11. Sparagna GC, Hickson-Bick DL, Buja LM, McMillin JB (2000) A metabolic role for mitochondria in palmitate-induced cardiac myocyte apoptosis. Am J Physiol Heart Circ Physiol 279(5): H2124–H2132 12. Dyntar D, Eppenberger-Eberhardt M, Maedler K, Pruschy M, Eppenberger HM, Spinas GA, Donath MY (2001) Glucose and palmitic acid induce degeneration of myofibrils and modulate apoptosis in rat adult cardiomyocytes. Diabetes 50(9):2105–2113 13. Jung TW, Lee YJ, Lee MW, Kim SM, Jung TW (2009) Fulllength adiponectin protects hepatocytes from palmitate-induced apoptosis via inhibition of c-Jun NH2 terminal kinase. FEBS J 276(8):2278–2284 14. Kim JE, Song SE, Kim YW, Kim JY, Park SC, Park YK, Baek SH, Lee IK, Park SY (2010) Adiponectin inhibits palmitateinduced apoptosis through suppression of reactive oxygen species in endothelial cells: involvement of cAMP/protein kinase A and AMP-activated protein kinase. J Endocrinol 207(1):35–44 15. Ostrander DB, Sparagna GC, Amoscato AA, McMillin JB, Dowhan W (2001) Decreased cardiolipin synthesis corresponds with cytochrome c release in palmitate-induced cardiomyocyte apoptosis. J Biol Chem 276(41):38061–38067 16. Yadav A, Kataria MA, Saini V (2013) Role of leptin and adiponectin in insulin resistance. Clin Chim Acta 417:80–84 17. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365–386 18. Chen CY, Hsu HC, Lee AS, Tang D, Chow LP, Yang CY, Chen H, Lee YT, Chen CH (2012) The most negatively charged lowdensity lipoprotein L5 induces stress pathways in vascular endothelial cells. J Vasc Res 49(4):329–341 19. Liu B-H (2009) Exploring the function and regulatory mechanisms of adiponectin and its receptors in pigs dissertation. National Taiwan University, Taipei 20. Dhanasekaran A, Gruenloh SK, Buonaccorsi JN, Zhang R, Gross GJ, Falck JR, Patel PK, Jacobs ER, Medhora M (2008) Multiple antiapoptotic targets of the PI3K/Akt survival pathway are activated by epoxyeicosatrienoic acids to protect cardiomyocytes from hypoxia/anoxia. Am J Physiol Heart Circ Physiol 294(2): H724–H735 21. Han JW, Zhan XR, Li XY, Xia B, Wang YY, Zhang J, Li BX (2010) Impaired PI3K/Akt signal pathway and hepatocellular injury in high-fat fed rats. World J Gastroenterol 16(48): 6111–6118 22. Younossi ZM (1999) Nonalcoholic fatty liver disease. Curr Gastroenterol Rep 1(1):57–62 23. Abrass CK, Berfield AK, Ryan MC, Carter WG, Hansen KM (2006) Abnormal development of glomerular endothelial and mesangial cells in mice with targeted disruption of the lama3 gene. Kidney Int 70(6):1062–1071 24. Li ZZ, Berk M, McIntyre TM, Feldstein AE (2009) Hepatic lipid partitioning and liver damage in nonalcoholic fatty liver disease: role of stearoyl-CoA desaturase. J Biol Chem 284(9):5637–5644 25. Listenberger LL, Ory DS, Schaffer JE (2001) Palmitate-induced apoptosis can occur through a ceramide-independent pathway. J Biol Chem 276(18):14890–14895 26. Sparagna GC, Hickson-Bick DL, Buja LM, McMillin JB (2001) Fatty acid-induced apoptosis in neonatal cardiomyocytes: redox signaling. Antioxid Redox Signal 3(1):71–79
Eur J Nutr 27. Hickson-Bick DL, Sparagna GC, Buja LM, McMillin JB (2002) Palmitate-induced apoptosis in neonatal cardiomyocytes is not dependent on the generation of ROS. Am J Physiol Heart Circ Physiol 282(2):H656–H664 28. Trauner M, Arrese M, Wagner M (2010) Fatty liver and lipotoxicity. Biochim Biophys Acta 3:299–310 29. Kadowaki T, Yamauchi T (2005) Adiponectin and adiponectin receptors. Endocr Rev 26(3):439–451 30. Miyazaki S, Izawa T, Ogasawara JE, Sakurai T, Nomura S, Kizaki T, Ohno H, Komabayashi T (2010) Effect of exercise training on adipocyte-size-dependent expression of leptin and adiponectin. Life Sci 86(17–18):691–698 31. Yamauchi T, Nio Y, Maki T, Kobayashi M, Takazawa T, Iwabu M, Okada-Iwabu M, Kawamoto S, Kubota N, Kubota T, Ito Y, Kamon J, Tsuchida A, Kumagai K, Kozono H, Hada Y, Ogata H, Tokuyama K, Tsunoda M, Ide T, Murakami K, Awazawa M, Takamoto I, Froguel P, Hara K, Tobe K, Nagai R, Ueki K, Kadowaki T (2007) Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat Med 13(3):332–339 32. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K,
Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T (2003) Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423(6941):762–769 33. Xiao-Yun X, Zhuo-Xiong C, Min-Xiang L, Xingxuan H, Schuchman EH, Feng L, Han-Song X, An-Hua L (2009) Ceramide mediates inhibition of the AKT/eNOS signaling pathway by palmitate in human vascular endothelial cells. Med Sci Monit 15(9):BR254–BR261 34. Ouchi N, Kobayashi H, Kihara S, Kumada M, Sato K, Inoue T, Funahashi T, Walsh K (2004) Adiponectin stimulates angiogenesis by promoting cross-talk between AMP-activated protein kinase and Akt signaling in endothelial cells. J Biol Chem 279(2):1304–1309 35. Wijesekara N, Krishnamurthy M, Bhattacharjee A, Suhail A, Sweeney G, Wheeler MB (2010) Adiponectin-induced ERK and Akt phosphorylation protects against pancreatic beta cell apoptosis and increases insulin gene expression and secretion. J Biol Chem 285(44):33623–33631
123
