ANDROLOGY
ISSN: 2047-2919
ORIGINAL ARTICLE
Correspondence: Wayne J. Hellstrom, Department of Urology, Tulane University School of Medicine, 1430 Tulane Ave. SL-42 New Orleans, LA 70112, USA. E-mail:
[email protected]
Keywords: erectile function, fibrosis, Peyronie’s disease, stem cells, tunica albuginea
Adipose tissue–derived stem cell therapy for prevention and treatment of erectile dysfunction in a rat model of Peyronie’s disease 1
Received: 30-Jul-2013 Revised: 27-Nov-2013 Accepted: 16-Dec-2013
A. Gokce, 1Z. Y. Abd Elmageed, 2G. F. Lasker, 3M. Bouljihad, 1H. Kim, 1 L. W. Trost, 2P. J. Kadowitz, 1A. B. Abdel-Mageed, 1S. C. Sikka, and 1W. J. Hellstrom
1
doi: 10.1111/j.2047-2927.2013.00181.x
3
Department of Urology, 2Department of Pharmacology, Tulane University School of Medicine, and Tulane National Primate Research Center, New Orleans, LA, USA
SUMMARY Peyronie’s disease (PD) is a localized connective tissue disorder that involves the tunica albuginea (TA) of the penis. While surgical correction remains the gold standard, the search for an effective and less invasive therapy continues. The objective of this study was to evaluate the effects of intratunical injection of adipose tissue–derived stem cells (ADSCs) for the prevention and treatment of erectile dysfunction in a rat model of PD. Twenty-four male Sprague–Dawley rats (300–350 g) were randomly divided into four groups: sham, PD, PD + ADSC (prevention) and PD + ADSC (treatment). All rats underwent penile injections into the TA with 50 lL vehicle (sham) or 0.5 lg transforming growth factor (TGF)-b1 (remaining groups). The ADSC groups received intratunical injections with 0.5 million rat-labelled ADSCs on day 0 (prevention) or day 30 (treatment). Forty-five days following TGF-b1 injection, rats underwent cavernous nerve stimulation (CNS) with total intracavernous-to-mean arterial pressure ratio (ICP/MAP) and total ICP recorded to measure response to therapy. Tissues were evaluated histologically and for mRNA expression of tissue inhibitors of metalloproteinases (TIMPs), matrix metalloproteinases (MMPs) and zymographic activity of MMPs. Statistical analysis was performed by analysis of variance followed by the Tukey test for post hoc comparisons. In both prevention and treatment groups, intratunical injection of ADSCs resulted in significantly higher ICP/MAP and total ICP in response to CNS compared with the PD group. Local injection of ADSCs prevented and/or reduced Peyronie’s-like changes by decreasing the expression of TIMPs, and stimulating expression and activity of MMPs. This study documents the preventive and therapeutic benefits of ADSC on penile fibrosis and erectile function in an animal model of PD.
INTRODUCTION Peyronie’s disease (PD) is a penile condition characterized by plaque formation in the tunica albuginea (TA) (Taylor & Levine, 2007). Additional signs and symptoms associated with PD include penile curvature, painful erections and/or erectile dysfunction (ED), which in some cases precludes sexual function and reduces overall quality of life (Rosen et al., 2008). Epidemiologic reports suggest that PD occurs in about 3–9% of men between 40 and 60 years of age (Muller & Mulhall, 2009). Although there are many theories as to the aetiology of PD, most authorities postulate that PD results from repetitive minor trauma to the penis during intercourse with subsequent abnormal wound healing and scar formation (Usta et al., 2004). Current treatment options for PD include various oral agents, topical therapies, intralesional injections or surgery (Bella et al., 2007). 244
Andrology, 2014, 2, 244–251
Stem cells have the ability to self-regenerate and differentiate into various cell types, which has applications in cell therapeutics, regenerative medicine and tissue engineering. The use of embryonic stem cell therapy for clinical application has been limited as a result of potential tumorigenicity and ethical opposition (Taha & Hedayati, 2010). However, adult mesenchymal stem cells (MSCs) have aroused significant interest, as they exhibit multi-potentiality and can differentiate into specific cell types, with the possibility of lifelong organ regeneration (Chae et al., 2012). Bone marrow–derived MSCs have been shown to prevent pulmonary and renal fibrosis, permit recovery of related organ function and ameliorate changes in liver function tests in experimental fibrosis models (Ortiz et al., 2003; Sakaida et al., 2004; Alfarano et al., 2012). Although the population of MSCs in bone marrow is relatively small, alternative sources such as adipose tissue provide a plentiful and easily accessible source for © 2014 American Society of Andrology and European Academy of Andrology
ADSC AND PEYRONIE’S DISEASE IN RAT
retrieval. Adipose-derived stem cells (ADSCs) exhibit several desirable therapeutic characteristics, including multi-potentiality, the ability to differentiate and immunosuppressive activity (Deans & Moseley, 2000). In addition, as the beneficial results of MSCs have been documented in other fibrotic diseases, MSC therapy may represent a promising option for the treatment of PD. In this regard, we investigated the effects of intratunical injection of ADSCs for both the prevention and possible treatment of PD and PD-associated ED in a rat model.
MATERIALS AND METHODS Study design All experiments were performed according to the American Guidelines for the Ethical Care of Animals and were approved by Tulane University Health Sciences Center Animal Care and Use Committee. Male Sprague–Dawley rats (300–350 g) were purchased from Harlan Laboratories (Indianapolis, IN, USA) and were housed in a regulated environment with a 12 h light/dark cycle in a standard experimental laboratory of the Animal Experimentation Service of Tulane University. The animals had free access to food and water. A total of 24 rats were randomly divided into four groups: (i) sham (saline vehicle injected into the TA); (ii) PD (transforming growth factor (TGF)-b1 (50 lg/ rats) injected into the TA); (iii) PD plus ADSCs prevention group (5 9 105 ADSCs injected into TA on the same day as TGF-b1 injection) and (iv) PD plus ADSCs treatment group (5 9 105 ADSCs injected into TA 30 days after TGF-b1 injection). Fortyfive days following TGF-b1 injection, all rats underwent electrophysiologic testing of erectile function, and the penile tissues were harvested and stored at 80 °C for further analysis. Adipose tissue-derived stem cell isolation and culture Adipose-derived stem cells were harvested from inguinal fat tissue of adult male Sprague–Dawley rats (350–450 g). A lower midline abdominal skin incision was made, and fat pads around the spermatic cord were excised, finely minced and washed three times with PBS-containing penicillin (100 units per mL) and streptomycin (100 lg/mL). After centrifugation (500 g; 5 min), tissues samples were digested with 0.2% collagenase type 1 (Invitrogen, Carlsbad, CA, USA) by agitation at 37 °C for 90 min. After filtration through a 60-lm nylon mesh (Millipore, Billerica, MA, USA), ADSCs were resuspended and cultured at a density of 1 9 105 cells in DMEM-F12 medium supplemented with 10% FBS, antifungal agent and penicillin–streptomycin (Gibco-BRL, Carlsbad, CA, USA). Non-adherent cells were removed 2 days after culture, and the medium was changed every 3 days until 85–95% confluence was attained. Before harvesting, cells were labelled with bromodeoxyuridine (BrdU; Sigma-Aldrich, St. Louis, MO, USA) in vitro as previously described (Ma et al., 2012) and cells were fixed and evaluated using a fluorescence microscope. Flow cytometry The ADSCs (at ≥ passage 4) were evaluated for viability and stained for flow cytometric analysis (Donnenberg et al., 2010). Briefly, 2 9 105 cells suspended in PBS-containing 0.2% FCS were incubated with anti-rat monoclonal antibodies for CD29, CD45, CD90, CD105 or anti-human CD90 or anti-human CD105 conjugated with either phycoerythrin (PE) or fluorescein © 2014 American Society of Andrology and European Academy of Andrology
ANDROLOGY isothiocyanate (FITC; BD Biosciences, Franklin Lakes, NJ, USA) in 50 lL of PBS for 30 min in the dark at 4 °C. After washing thrice, cells were analysed on a fluorescence-activated cell sorter (FACS) (FACSCalibur; BD Biosciences). Data acquisition and analysis were performed using Cell Quest software (Becton Dickinson, Franklin Lakes, NJ, USA). Intratunical injection Each rat was anesthetized with 100/10 mg/kg ketamine/xylazine intraperitoneally. Using a 2-mm midline incision at the left lateral midshaft of the penis, the tunical sheath was opened up and the TA exposed. The intratunical space was then injected with either 50 lL of 0.9% saline vehicle or 50 lL of TGF-b1 suspended in the same vehicle, followed by ADSCs, based on experimental groupings. After injection, the sheath was closed with a simple surgical knot using a 5-0 Vicryl suture. Measurement of erectile function Intracavernous pressure (ICP) response to electrical cavernous nerve stimulation (CNS) was used to evaluate erectile function. Briefly, rats were anaesthetized with thiobutabarbital 100 mg/kg intraperitoneally. Supplemental doses of thiobutabarbital were administered as needed to maintain a uniform level of anaesthesia. Body temperature was maintained with a heating lamp. The trachea was cannulated with a short segment of PE-240 tubing to maintain a patent airway, and the left carotid artery was catheterized with PE-50 tubing for measurement of systemic arterial pressure. ICP was measured with a 25-gauge needle inserted into the left crura of the penis connected to PE-50 tubing filled with heparin. Systemic arterial pressure and ICP were measured with Namic Perceptor DT pressure transducers and a data acquisition system (Biopac MP 100A-CE, Santa Barbara, CA, USA). ICP, systemic arterial pressure and mean arterial pressure (MAP) obtained by electronic averaging were continuously recorded and were displayed and stored on PC. The ratio between the maximal ICP and MAP obtained at the peak of erectile response after CNS was determined to control for variations in MAP. The area under the curve of the increase in ICP was measured to characterize the total erectile response. CNS was carried out with a Grass Instruments SD9 Stimulator (Grass Instruments Co., Quincy, MA, USA) as previously described (Bivalacqua et al., 2003). A rest period of at least 5 min was allowed between CNS trials. Histology Haematoxylin and Eosin (H&E) and Masson’s trichrome (MT) stained penile cross sections (4–6 lm thick) were examined by light microscopy (Leica model DM 2500; Leica Microsystems CMS, Weltzar, Germany) and evaluated by a pathologist who was blinded to the experimental design. Real-time PCR analysis The isolation of TA was performed as previously described (Castiglione et al., 2013). The expression of mRNA in TA was analysed by q-PCR. Briefly, snap frozen tissues were homogenized and RNA was extracted using the TRIzol method according to the manufacturer’s instructions (Life Technologies, Carlsbad, CA, USA). Extracted RNA was measured and evaluated for purity and integrity using Nanodrop (Thermo scientific, Waltham, MA, USA) and by running the samples on 1% agarose gel. cDNA was synthesized from 1 lg RNA using M-MuLV Reverse Andrology, 2014, 2, 244–251
245
ANDROLOGY
A. Gokce et al.
Transcriptase and oligo dT according to standard protocol (New England Biolabs, Inc., Ipswich, MA, USA). Gene expression analysis was performed with SYBR Green reagents (Bio-Rad, Hercules, CA, USA) and the C1000 Touch Thermal Cycler (BioRad). The sequences of primer sets used in q-PCR analysis are listed in Table 1. The results were normalized to b-actin and expressed as a fold change SEM from at least three independent experiments. Heparin-enhanced zymography Zymography assays were carried out as described previously (Yu & Woessner, 2001). For MMP9 or MMP2 detection in Ready Gel 10% Zymogram (Bio-Rad), and MMP1 detection in Ready Gel 12% Zymogram, a final concentration of 0.3 mg/ml porcine intestinal heparin (Sigma-Aldrich) was included in the ready-toload samples. Briefly, 50 lg of protein extract from tissue was diluted in Zymogram Sample Buffer. The samples were loaded into the wells of 10% precast polyacrylamide gel with gelatin. Electrophoresis was carried out in a Bio-Rad apparatus at 90 V for 2 h, until the bromophenol blue reached the bottom of the
Table 1 List of primer sets used in real-time PCR analysis rMMP1 rMMP2 rMMP3 rMMP9 rTIMP1 rTIMP2 rTIMP3 rb-Actin
gel. The gel was then washed at room temperature for 30 min with Zymogram Renaturation Buffer containing 2.5% Triton X100 and subsequently incubated at 37 °C for 48 h in a Zymogram Development Buffer containing 50 mM Tris-HCl, pH 7.5, 200 mM NaCl, 5 mM CaCl2. The staining was performed for 2 h with 0.5% Coomassie Blue R-250, and destaining was conducted in 30% methanol and 10% acetic acid until clear bands over a dark background were observed. Staining and destaining were performed at room temperature on a rotatory shaker. The gels were photographed, and the intensity of gelatinolytic action (clear bands) was analysed in the GelDoc XR (Bio-Rad) imaging system. Statistical analysis Statistical analysis was performed with Prism 5.0 (GraphPad Software, San Diego, CA, USA). All data were expressed as mean SEM. Differences between multiple groups were compared by one-way analysis of variance, followed by the Tukey multiple comparisons test. p < 0.05 was considered statistically significant.
Forward
Reverse
GAGGTGAAAAGGCTCAGTGC CATCGCTGCACCATCGCCCATCATC CCGTTTCCATCTCTCTCAAGATGA GAAGACTTGCCGCGAGACCTGATCGATG GGGCTACCAGAGCGATCACTT ACATCTCCTCCCCGGATGA TACCCTGGCTATCAGTCCAAACA GCTACAGCTTCACCACCACA
ATGAGGCGGGGATAGTCTTT CCCAGGGTCCACAGCTCATCATCATCAAAG CAGAGAGTTAGATTTGGTGGGTACCA GCACCAGCGATAACCATCCGAGCGAC AAGGTATTGCCAGGTGCACAA GGTGCCCATTGATGCTCTTC GCTGCAGTAGCCACCCTTCT ATCGTACTCCTGCTTGCTGA
Figure 1 Characterization of adipose tissue–derived stem cells (ADSCs) and bromodeoxyuridine (BrdU) labelling. Flow cytometric analysis of early passage rat ADSCs depicting positive expression for CD29 (97.98%) (A), CD90 (90.02%) (B), CD105 (22.4%) (C) and negative expression for CD45 (1.69%) (D). The rat ADSCs were negative for anti-human CD90 (2.16%) (E) and anti-human CD105 (2.66%) (F), further verifying the specificity of the anti-rat antibodies. (G) The unstained ADSC isotypes are shown. (H) Immunofluorescence of ADSCs incubated with BrdU at 20 lmol/L for 48 h. ADSCs were successfully stained with BrdU and the nuclei of ADSCs showed green fluorescence. (Scale bar: 100 lm).
(A)
(B)
(C)
(D)
(E)
(F)
(G)
(H)
246
Andrology, 2014, 2, 244–251
© 2014 American Society of Andrology and European Academy of Andrology
ADSC AND PEYRONIE’S DISEASE IN RAT Figure 2 Measurement of erectile function. Bar graphs depicting the voltage-dependent erectile response as measured by intracavernous pressure (ICP)/mean arterial pressure (MAP) ratio and total ICP (area under the erectile curve) in response to cavernous nerve stimulation for 1 min at day 45. Sham group, rats injected with TGF-b1 (PD group), TGF-b1 injected rats treated with intratunical injection of adipose tissue–derived stem cells (ADSCs) at day 30 (treatment group) and TGF-b1 injected rats treated with intratunical injection of ADSCs on day 0 following TGF-b1 injection (prevention group). *Indicates significant difference vs. sham group (p < 0.05), Φ Indicates significant difference vs. PD group (p < 0.05).
ANDROLOGY and total ICP (area under the erectile curve), were significantly reduced at 2.5, 5.0 and 7.5 V when compared with sham animals (ICP/MAP: 0.20 0.01 mmHg in PD vs. 0.46 0.05 in sham at 2.5 V; 0.43 0.03 in PD vs. 0.63 0.06 in sham at 5.0 V; 0.70 0.03 in PD vs. 0.80 0.03 in sham at 7.5 V) (Fig. 2). Intratunical injection of ADSC on day 30 after injection of TGF-b1 (treatment group) resulted in significantly greater changes in ICP in response to CNS when compared with erectile responses in the PD group at voltages of 2.5 and 5.0 (ICP/MAP: 0.20 0.01 in PD vs. 0.44 0.08 in treatment group at 2.5 V; 0.43 0.03 in PD vs. 0.67 0.05 in treatment group at 5.0 V). The treatment of TGF-b1 injected animals with ADSCs on day 0 (prevention group) resulted in increases in ICP/MAP and total ICP in response to CNS at 2.5, 5.0 and 7.5 V that were significantly greater than responses in the PD group (ICP/MAP: 0.20 0.01 in PD vs. 0.72 0.05 in prevention group at 2.5 V; 0.43 0.03 in PD vs. 0.78 0.04 in prevention group at 5.0 V; 0.70 0.03 in PD vs. 0.85 0.02 in prevention group at 7.5 V). Histology Comparative microscopic evaluation of representative H&E and MT stained penile cross sections revealed no changes in the corpus cavernosum (CC) or TA of sham and prevention groups. In contrast, there was multifocal, mild-to-moderate fibrosis and minimal-to-mild fibrosis and in the CC of PD and treatment groups respectively. More severe attenuation (narrowing) of cavernous spaces was noted among PD rats compared with other groups (Fig. 3). Similarly, PD rats demonstrated markedly thickened TA with dense, disorganized CT and scattered fibrosis compared with minimal fibrosis in the treatment group. Mild reactivity was noted and very rare BrdU labelled ADSCs were detectable in the CC or tunica of the ADSCs injected rats. (Fig. 4).
RESULTS Adipose tissue–derived stem cell culture and characterization The ADSC isolates attached and proliferated within 2–3 days and were passaged when 80% confluence was reached. To ascertain the purity of ADSCs, flow cytometric analysis demonstrated that rat ADSCs were positive for mesenchymal stem cell surface markers CD29 (97.98%), CD90 (90.02%), CD105 (22.4%), but were negative to CD45 (1.69%), which is a recognized haematopoietic stem cell marker (Fig. 1A–D). In addition, the rat ADSCs were negative for anti-human CD90 (2.16%) and anti-human CD105 (2.66%) (Fig. 1E,F), verifying the specificity of the anti-rat antibodies. The unstained ADSC isotypes are shown (Fig. 1G). The ADSCs were successfully stained with BrdU (Fig. 1H). Measurement of erectile responses Forty-five days following intratunical injection with TGF-b1 (PD group) erectile responses to CNS, as measured by ICP/MAP © 2014 American Society of Andrology and European Academy of Andrology
Expression of tissue inhibitors of metalloproteinases (TIMPs) and matrix metalloproteinases (MMPs) genes in the TA Compared with the sham group, the mRNA levels of TIMP-1, TIMP-2 and TIMP-3 were increased in the TA of the PD group (p < 0.0001) (Fig. 5). The expressions of all TIMPs were decreased after ADSC injection, but the decrease in levels of TIMP-1, TIMP-2 and TIMP-3 was only statistically significant in the prevention group (p < 0.01, p < 0.001, p < 0.001 respectively). Compared with the sham group, mRNA levels of MMP-1, MMP-2, MMP-3 and MMP-9 were increased in the PD animals. In the prevention group, the results showed a significant increase in the expression level of MMP-1 (p < 0.01), MMP-3 (p < 0.0001) and MMP-9 (p < 0.0001) compared with the PD group. In the treatment group, there was a significant increase in the mRNA levels of MMP-1 (p < 0.0001), MMP-2 (p < 0.05) and MMP-9 (p < 0.0001) compared with the PD group. No statistical differences were noted among any groups with regards to expression of TIMP-4, MMP-8 and MMP-13 (data not shown). Zymography of MMP activity The activities of MMP-9, MMP-2 and MMP-1 were significantly increased in the PD group compared with sham animals (p < 0.001 for each) (Fig. 6). The densitometric analysis showed that the activity of the MMP-9, using a gelatin zymogram, increased in the prevention and treatment groups by 430 and 230%, respectively, compared with the PD group (p < 0.001). Andrology, 2014, 2, 244–251
247
ANDROLOGY
A. Gokce et al.
Figure 3 Histological assessment of penile tissue cross sections. (A) Sham (H&E, MT. 9100) – representative microscopic structure in penile cross section from sham rats. Note dorsal part of the corpus cavernosum (CC), with its normally dilated cavernous spaces (CS) lined by endothelium and surrounded by varied proportions of smooth muscle (SM) and fibroelastic (FE) connective tissue (CT), enclosed by well-organized CT trabecula of the tunica albuginea (TA). (B) PD (H&E, MT. 9100) – representative microscopic changes involving both CC and TA in penile cross section from PD rats. Note the presence within the CC of multifocal areas of minimal–to-mild fibrosis (FB) and attenuated (narrow) CS, and markedly thickened TA with disorganized CT trabeculae, that are multifocally interspersed by minimal fibrosis (FB). (C) PD & ADSC prevention (H&E, MT. 9100) – representative microscopic features in penile cross section from PD plus ADSC-prevention rats. Note normally widened (dilated) CS lined by endothelium and surrounded by fragments of SM and fibroelastic (FE) CT, tunical albuginea (TA) with normal thickness and well-organized CT trabecula. (D) PD and ADSC treatment (H&E, MT. 9100) – representative microscopic changes in penile cross section of PD plus ADSC-treatment rats. Note the presence in the CC of multifocal areas of mild-to-moderate fibrosis (FB) along with minimally to mildly narrow CS. The tunica albuginea (TA) appeared to have fairly organized CT trabecula.
(A)
(B)
(C)
(D)
Figure 4 Cross sections of penile tissue (prevention and treatment groups) demonstrating fluorescent signal from bromodeoxyuridine (BrdU)-labelled adipose tissue–derived stem cells (ADSCs) (red arrows).
Similarly there was a significant increase in MMP-2 activities in the prevention (370%) and treatment (240%) groups when compared with the PD group (p < 0.001). In the casein zymogram there were 260 and 130% increase in MMP-1 activity in the prevention and treatment groups, respectively, compared with the PD group (p < 0.001).
DISCUSSION The TA of the penis plays an important role in the physiology of erection because of its influence on penile elasticity, rigidity and veno-occlusion (Aboseif & Lue, 1988). Any morphological or functional impairment from injury to the TA can affect compliance of the penile fibroelastic framework and have profound effects on the haemodynamic and erectile function of the penis (Leungwattanakij et al., 2003). PD is a localized CT disorder that involves the TA and thereby may have dramatic effects on erectile function (Gelbard et al., 1990). In our previous study involving a rat model of bilateral incision of the TA, we demonstrated that seeding syngeneic ADSCs onto porcine small intestinal 248
Andrology, 2014, 2, 244–251
submucosa grafts resulted in significant cavernosal tissue preservation and maintenance of erectile responses (Ma et al., 2012). These findings further documented the concept of replacement and/or regeneration of irreversibly damaged TA. The objective of this study was to understand the underlying mechanisms and further examine if ADSCs can prevent and/or abrogate PDrelated fibrosis and its’ subsequent effects on erectile function. Our study showed that local injection of ADSCs prevented (prevention group) and reduced (treatment group) Peyronie’s-like changes. In addition, impaired erectile function resulting from these histological changes was improved in both the prevention and treatment groups. The underlying mechanisms for development of fibrotic plaque appear to be related to conditions pertaining to an imbalance between profibrotic and antifibrotic processes. Profibrotic substances, including TGF-b1, fibrin, plasminogen activator inhibitor-1 and TIMPs, are increased or aberrantly expressed (El-Sakka et al., 1997). Antifibrotic substances include MMPs, which are a class of molecules responsible for collagen © 2014 American Society of Andrology and European Academy of Andrology
ADSC AND PEYRONIE’S DISEASE IN RAT
ANDROLOGY
Figure 5 Expression of tissue inhibitors of metalloproteinase (TIMPs) and matrix metalloproteinases (MMPs) genes. The expression of TIMP-1, TIMP-2 and TIMP-3 in the tunica albuginea of sham animals was strikingly low, whereas their expression in PD group was significantly higher than the sham group. The expressions of all these TIMPs were decreased after adipose tissue–derived stem cells (ADSCs) injections, but the results were statistically significant in only the prevention group. Compared with sham group, the mRNA levels of MMP-1, MMP-2, MMP-3 and MMP-9 were increased in the Peyronie’s disease (PD) group. Intratunical injection of ADSCs on day 0 following TGF-b1 injection (prevention group) resulted in higher expression levels of MMP-1, MMP-3 and MMP-9 compared with PD group. In the treatment group (PD plus ADSC after 30 days) there was significant increase in the mRNA levels of MMP-1, MMP2 and MMP-9 compared with the PD group. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
degradation (Del Carlo et al., 2008). The presence of ADSCs labelled with BrdU within the tissue sections suggests a direct and/or indirect role of stem cells in ameliorating the fibrotic response over an extended period of time, as previously reported (Ma et al., 2012; Castiglione et al., 2013) The increase in MMP-9, MMP-2 and MMP-1 activity after injection of ASDCs implies a mechanistic role in achieving the beneficial effect of ADSCs in PD treatment. The wound-healing cascade begins with exposure of platelets to collagen and the release of chemoattractant molecules such as TGF-b1, platelet-derived growth factor, tumour necrosis factor alpha, interleukin-1 and fibrin, which act as a matrix for the repair process (El-Sakka et al., 1997). Inhibition of the fibrinolytic system or an inability to degrade the intravasated fibrin © 2014 American Society of Andrology and European Academy of Andrology
leads to its persistence in the tunica with the continued expression of proinflammatory cytokines. This response ultimately leads to the formation of a palpable plaque, secondary to the excessive deposition of collagen and extracellular matrix with disorganization of collagen fibres and the loss of elastic fibres (Gonzalez-Cadavid & Rajfer, 2010). Based on gene expression levels of TIMPs, our results demonstrate higher gene expression levels of TIMPs in severe penile fibrosis. The increased expression of TIMPs inhibits MMP activity, thus reducing degradation of collagen and promoting extracellular matrix deposition. The increased deposition of collagen fibres in the TA ultimately results in fibrosis. In this study, intratunical injection of ADSCs increased the degradation of collagen by decreasing the expression of TIMPs and stimulating the Andrology, 2014, 2, 244–251
249
ANDROLOGY
A. Gokce et al.
Figure 6 Zymography of matrix metalloproteinase (MMP) activities. MMP-9 and MMP-2 activities were examined by gelatin zymography (A, B). MMP-1 activity was examined by casein zymography (C). Intensity of the band was quantified and presented in bar graphs as mean SEM of three separate experiments. **p < 0.01, ***p < 0.001.
(A)
(C)
(B)
activity of MMPs. Moreover, a recent study has shown that MSCs can secrete high numbers of MMPs and other matrix-modulating enzymes, suggesting that direct interaction of ADSCs with the extracellular matrix may be an additional mechanism of action (Huang et al., 2012). In addition to improving the imbalance between profibrotic and antifibrotic substances, ADSCs may further achieve their beneficial effects through immunomodulatory, immunosuppressive and antioxidant pathways. A number of pre-clinical studies infer a beneficial immunomodulatory role of ADSC therapy through inhibition of the excessive host response to injury and prevention of fibrosis (Chamberlain et al., 2007). In our previous study, we demonstrated that SIS grafting induced transcriptional up-regulation of inducible nitric oxide synthase (iNOS) and down-regulation of endothelial NOS, neuronal NOS and vascular endothelial growth factor, an effect that was restored by seeding ADSCs on the SIS graft (Ma et al., 2012). Several investigators have reported that MSC transplantation significantly decreased fibrosis in the heart, lung, kidney and liver (Mias et al., 2009; Moodley et al., 2009; Alfarano et al., 2012; Zhao et al., 2012). In a recent study, Castiglione et al. (2013) evaluated intratunical injection of human ADSCs for treatment of PD and PD-associated ED in a rat model. They concluded that injection of human ADSCs into the affected area prevents fibrosis and elastosis in the tunica and CC in the acute/ inflammatory phase of PD. This study further expands upon these findings and our understanding of the mechanisms using different methodologies. First, this study utilizes rat ADSCs, eliminating potentially immunogenic confounding factors associated with xenogenic 250
Andrology, 2014, 2, 244–251
transplantation. Second, as human PD patients clinically present in the chronic phase, this investigation evaluated and confirmed the benefits of ADSC administration as both a preventative and treatment modality. In addition, this study is the first to demonstrate the antifibrotic mechanism of ADSCs in a PD animal model. This study is potentially limited by the nature of the animal model used. Although the TGF-b1 rat model has previously been utilized in several publications as a surrogate for human PD, given the unexplained nature of the human condition, including a likely genetic predisposition, the rat model may not completely address the complexity of the human PD condition. It was observed in the prevention group that animals injected with TGF-b1 and ADSCs on day 0 demonstrated enhanced erectile responses at all stimulation voltages studied when compared with control. This could result from increased functional endothelium and/or smooth muscle within the corpora cavernosa, improved sensitivity and neural conduction in response to CNS or any combination of these beneficial aspects of stem cell therapy (Lin et al., 2012). Moreover, although the beneficial effects of ADSCs have on the erectile response to CNS could be owing to multiple mechanisms, the effect of stem cell therapy on MMP and TIMP expression provides new information into ADSC’s therapeutic effect in this model of PD.
CONCLUSION This study documents the preventive and therapeutic benefits of ADSC on TA fibrosis and erectile dysfunction in an animal model of PD. As ADSCs prevented and/or restored the abnormal histology in PD rats, their potential therapeutic benefit in men © 2014 American Society of Andrology and European Academy of Andrology
ADSC AND PEYRONIE’S DISEASE IN RAT
with PD is a distinct possibility. The novel properties of ADSCs provide a new perspective and potentially new therapeutic option for the future management of PD.
REFERENCES Aboseif SR & Lue TF. (1988) Hemodynamics of penile erection. Urol Clin North Am 15, 1–7. Alfarano C, Roubeix C, Chaaya R, Ceccaldi C, Calise D, Mias C et al. (2012) Intraparenchymal injection of bone marrow mesenchymal stem cells reduces kidney fibrosis after ischemia-reperfusion in cyclosporine-immunosuppressed rats. Cell Transplant 21, 2009–2019. Bella AJ, Perelman MA, Brant WO & Lue TF. (2007) Peyronie’s disease (CME). J Sex Med 4, 1527–1538. Bivalacqua TJ, Usta MF, Champion HC, Adams D, Namara DB, Abdel-Mageed AB et al. (2003) Gene transfer of endothelial nitric oxide synthase partially restores nitric oxide synthesis and erectile function in streptozotocin diabetic rats. J Urol 169, 1911–1917. Castiglione F, Hedlund P, Van der Aa F, Bivalacqua TJ, Rigatti P, Van Poppel H et al. (2013) Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile function in a rat model of Peyronie’s disease. Eur Urol 63, 551–560. Chae YB, Lee JS, Park HJ, Park IH, Kim MM, Park YH et al. (2012) Advanced adipose-derived stem cell protein extracts with antioxidant activity modulates matrix metalloproteinases in human dermal fibroblasts. Environ Toxicol Pharmacol 34, 263–271. Chamberlain G, Fox J, Ashton B & Middleton J. (2007) Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells 25, 2739–2749. Deans RJ & Moseley AB. (2000) Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 28, 875–884. Del Carlo M, Cole AA & Levine LA. (2008) Differential calcium independent regulation of matrix metalloproteinases and tissue inhibitors of matrix metalloproteinases by interleukin-1beta and transforming growth factor-beta in Peyronie’s plaque fibroblasts. J Urol 179, 2447–2455. Donnenberg VS, Donnenberg AD, Zimmerlin L, Landreneau RJ, Bhargava R, Wetzel RA et al. (2010) Localization of CD44 and CD90 positive cells to the invasive front of breast tumors. Cytometry B Clin Cytom 78, 287– 301. El-Sakka AI, Hassoba HM, Chui RM, Bhatnagar RS, Dahiya R & Lue TF. (1997) An animal model of Peyronie’s-like condition associated with an increase of transforming growth factor beta mRNA and protein expression. J Urol 158, 2284–2290. Gelbard MK, Dorey F & James K. (1990) The natural history of Peyronie’s disease. J Urol 144, 1376–1379. Gonzalez-Cadavid NF & Rajfer J. (2010) Treatment of Peyronie’s disease with PDE5 inhibitors: an antifibrotic strategy. Nat Rev Urol 7, 215–221.
© 2014 American Society of Andrology and European Academy of Andrology
ANDROLOGY Huang W, Wang T, Zhang D, Zhao T, Dai B, Ashraf A et al. (2012) Mesenchymal stem cells overexpressing CXCR4 attenuate remodeling of postmyocardial infarction by releasing matrix metalloproteinase-9. Stem Cells Dev 21, 778–789. Leungwattanakij S, Bivalacqua TJ, Yang DY, Hyun JS & Hellstrom WJ. (2003) Comparison of cadaveric pericardial, dermal, vein, and synthetic grafts for tunica albuginea substitution using a rat model. BJU Int 92, 119–124. Lin CS, Xin ZC, Wang Z, Deng C, Huang YC, Lin G et al. (2012) Stem cell therapy for erectile dysfunction: a critical review. Stem Cells Dev 21, 343–351. Ma L, Yang Y, Sikka SC, Kadowitz PJ, Ignarro LJ, Abdel-Mageed AB et al. (2012) Adipose tissue-derived stem cell-seeded small intestinal submucosa for tunica albuginea grafting and reconstruction. Proc Natl Acad Sci USA 109, 2090–2095. Mias C, Lairez O, Trouche E, Roncalli J, Calise D, Seguelas MH et al. (2009) Mesenchymal stem cells promote matrix metalloproteinase secretion by cardiac fibroblasts and reduce cardiac ventricular fibrosis after myocardial infarction. Stem Cells 27, 2734–2743. Moodley Y, Atienza D, Manuelpillai U, Samuel CS, Tchongue J, Ilancheran S et al. (2009) Human umbilical cord mesenchymal stem cells reduce fibrosis of bleomycin-induced lung injury. Am J Pathol 175, 303–313. Muller A & Mulhall JP. (2009) Peyronie’s disease intervention trials: methodological challenges and issues. J Sex Med 6, 848–861. Ortiz LA, Gambelli F, McBride C, Gaupp D, Baddoo M, Kaminski N et al. (2003) Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci U S A 100, 8407–8411. Rosen R, Catania J, Lue T, Althof S, Henne J, Hellstrom W et al. (2008) Impact of Peyronie’s disease on sexual and psychosocial functioning: qualitative findings in patients and controls. J Sex Med 5, 1977–1984. Sakaida I, Terai S, Yamamoto N, Aoyama K, Ishikawa T, Nishina H et al. (2004) Transplantation of bone marrow cells reduces CCl4-induced liver fibrosis in mice. Hepatology 40, 1304–1311. Taha MF & Hedayati V. (2010) Isolation, identification and multipotential differentiation of mouse adipose tissue-derived stem cells. Tissue Cell 42, 211–216. Taylor FL & Levine LA. (2007) Peyronie’s disease. Urol Clin North Am 34, 517–534, vi. Usta MF, Bivalacqua TJ, Jabren GW, Myers L, Sanabria J, Sikka SC et al. (2004) Relationship between the severity of penile curvature and the presence of comorbidities in men with Peyronie’s disease. J Urol 171, 775–779. Yu WH & Woessner JF, Jr. (2001) Heparin-enhanced zymographic detection of matrilysin and collagenases. Anal Biochem 293, 38–42. Zhao W, Li JJ, Cao DY, Li X, Zhang LY, He Y et al. (2012) Intravenous injection of mesenchymal stem cells is effective in treating liver fibrosis. World J Gastroenterol 18, 1048–1058.
Andrology, 2014, 2, 244–251
251
