Aging Results in Molecular Changes in an Enriched Population of

0 downloads 0 Views 778KB Size Report
Nov 13, 2013 - injection medium (DMEM, 10% fetal bovine serum, 0.2 mg/ml of DNase I, .... The testes were then dehydrated in a series of alcohol solutions.

BIOLOGY OF REPRODUCTION (2013) 89(6):147, 1–10 Published online before print 13 November 2013. DOI 10.1095/biolreprod.113.112995

Aging Results in Molecular Changes in an Enriched Population of Undifferentiated Rat Spermatogonia1 Catriona Paul,3 Makoto Nagano,4 and Bernard Robaire2,3,4 3 4

Department of Pharmacology and Therapeutics, McGill University, Montre´al, Que´bec, Canada Department of Obstetrics and Gynecology, McGill University, Montre´al, Que´bec, Canada

A strong correlation exists between increasing paternal age and a decline in reproductive function. Testis aging is associated with testicular atrophy, increased DNA damage, and de novo mutations. It is unclear whether these problems arise from the spermatogonial stem cells (SSCs), a buildup of anomalies as older germ cells progress through spermatogenesis, or both. We hypothesize that with the continual divisions of SSCs that maintain the germ cell population, an alteration of these cells occurs over time. To test this, we utilized young (4-mo-old) and aged (18- and 21-mo-old) transgenic rats that express GFP in germ cells only. We first examined the number and activity of SSCs from the different age groups by transplantation. Aged rats had numerically fewer SSCs than young rats (,50%; not significant) despite the lack of testicular atrophy, and 21-moold rats show a significant reduction in colony length, suggesting that the quality of SSCs also deteriorates. To evaluate any molecular changes occurring in the early cells of spermatogenesis with age, we isolated an SSC-enriched population of CD9positive (CD9+) cells using fluorescence-activated cell sorting (confirmed by transplantation studies) and extracted RNA for microarray analysis. In the aged CD9+ cells, 60 transcripts were upregulated and more than 500 downregulated compared to the young cells. An altered expression was found for transcripts involved in mitosis and in DNA damage response. These results suggest molecular alterations in the SSC-enriched population of aged CD9+ cells, implying that reproductive aging originates in the undifferentiated cells of spermatogenesis. aging, gene expression, spermatogonia, spermatogonial stem cells (SSCs), testis

INTRODUCTION Spermatogonial stem cells (SSCs) compose the origin of spermatogenesis, and thus the production of mature sperm relies on the quality and quantity of these cells. New generations of spermatozoa are continuously developing in the seminiferous epithelium of the adult; therefore, the germ cells leaving the testis on an ongoing basis have been dividing 1

C.P. was funded by a Canadian Institutes of Health Research (CIHR) postdoctoral fellowship. These studies were funded by grant MOP89767 from CIHR. Presented in part at the XXII North American Testis Workshop, April 10–13, 2013, San Antonio, Texas. 2 Correspondence: Bernard Robaire, Department of Pharmacology & Therapeutics, McGill University, 3655 Promenade Sir-William-Osler, Montre´al, Que´bec H3G 1Y6, Canada. E-mail: [email protected] Received: 7 August 2013. First decision: 4 September 2013. Accepted: 30 October 2013. Ó 2013 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363

1

Article 147

Downloaded from www.biolreprod.org.

and differentiating for a relatively short period of time (35 days in mice and 64 days in humans), depending on the species [1]. As a consequence, it had been thought that male germ cells are constantly freshly made and thus do not age. However, the precursor cells that give rise to male germ cells act as stem cells and are present throughout the life span of the male. It is now well established that male reproductive function declines with age; increased DNA damage and decreased sperm quality and fertility are just a few of the parameters known to change in aging men (for review, see [2]). During the aging process, male germ cells appear to change both in number and at the molecular level. We have previously shown that isolated pachytene spermatocytes and round spermatids have an altered gene expression signature associated with aging [3]; affected genes included those associated with DNA damage and repair and oxidative stress. As yet, it is unclear where these problems arise. It is not known whether the underlying cause is that the SSCs are continually dividing to produce germ cells, thus resulting in an accumulation of damage that in turn results in the production of sperm of poorer quality, or if the aberrations seen in germ cells occur later in development, such as during meiosis and spermiogenesis. Studies using models of animal aging indicate that significant changes occur in germ cells and mature sperm as males enter advanced age and that such changes have consequences for the progeny [4–6]. One of the characteristics of ‘‘testis aging’’ is the loss of germ cells—that is, testicular regression or atrophy and an increasing abundance of Sertoli cell-only tubules [7–9]. A small number of studies on SSCs in the aging male offer different pieces of the puzzle. It was suggested many years ago that the number of undifferentiated spermatogonia dramatically decreases with age [10]. More recently, there have been studies looking at the SSCs [9] and their niche [11] and showing the differences that can occur with age, albeit in different species and at different ages. As a result of the changes seen in our previous study [3] and the fact that DNA damage and de novo mutations increase in older men [12], we decided to examine the cells at the foundation of germ cell development: the SSCs. We aimed to determine whether similar changes are seen in the cells that are at the foundation of spermatogenesis and, if so, if these changes may offer an explanation for the alterations in later germ cells with age. We hypothesize that older males will have a reduced number of SSCs and that their ability to differentiate into more developed germ cells will be diminished compared to that of SSCs from younger males. In addition, we propose that this may be explained by changes in gene expression related to self renewal and DNA damage. To test this hypothesis, we investigated the consequences of aging on the number and quality of SSCs using spermatogonial transplantation (currently the only available method to detect functional SSCs) and on the molecular changes in an SSC-enriched population using gene expression analysis.

ABSTRACT

PAUL ET AL. TABLE 1. Details of quantitative RT-PCR primers. Gene name Gfra KitL Msh4 Msh5 Dmc1 18Sb a b

Quantitect primer no.a

GenBank accession no. NM_012959 NM_021843 NM_001106477 NM_212536 NM_001130567

QT00195230 QT00411285 QT00465031 QT01597183 QT01627241

F: CCTCCAATGGATCCTCGTTA

R: AAACGGCTACCACATCCAAG

All except 18S were purchased from Quantitect (Qiagen). F, forward; R, reverse.

MATERIALS AND METHODS

Isolation of an SSC-Enriched Population by FluorescenceActivated Cell Sorting

Animals

A single-cell suspension of seminiferous tubule cells was obtained as described for the transplantations above. In all, 5 3 106 cells were pelleted and resuspended in blocking buffer (DMEM and 1% bovine serum albumin [BSA]) containing 5 lg/ll of anti-rat CD9 antibody (BD Pharmingen) and incubated on ice with agitation for 30 min. The cells were washed three times in DMEM by centrifugation and then resuspended in 200 ll of DMEM containing 1 lg/ll of anti-mouse APC fluorescent secondary antibody (BD Biosciences), after which they were incubated with secondary antibody on ice for 30 min with agitation. Next, the cells were washed three times in DMEM by centrifugation (500 3 g) and resuspended in PBS containing 100 lg of DNase. Cells positive for both GFP and CD9 (GFPþCD9þ) were isolated by fluorescence-activated cell sorting (FACS) using a FACSAria flow cytometer (Becton Dickinson Biosystems). Forward and side-scatter plots were used to exclude cellular debris and aggregates using the histogram analysis plots. Cells were sorted, for an average of 2 h at 1 3 106 cells/h, under sterile conditions into microcentrifuge tubes containing DMEM and maintained on ice during the FACS process. Time permitting, up to an estimated 43 3 106 GFPþCD9þ cells could be collected per testis. After sorting, the cells were pelleted and stored at 808C until use.

Germ Cell Transplantation

RNA Extraction and Transciptome Analysis

Each rat was checked for the presence of regressed testes, and only rats without regressed testes were used. Seminiferous tubule cells were isolated from the testes of rats from the three different age groups. Briefly, the tunica albuginea was removed along with any large blood vessels; the parenchyma was subjected to enzymatic digestion at 348C first with 0.5 mg/ml of collagenase (Sigma) for 15 min, followed by sedimentation and washing, and then with 0.5 mg/ml of trypsin in Dulbecco modified Eagle medium (DMEM; Type I; T8003; Sigma) and DNase I in PBS (Type I, DN-25; Sigma) for 15 min. This was followed by mechanical dissociation to a single-cell suspension using a flamed-tip glass Pasteur pipette. Remaining tissue debris was removed by filtration through a 40-lm nylon mesh cell strainer (BD Biosciences). Dissociated cells were centrifuged at 500 3 g for 5 min and resuspended in injection medium (DMEM, 10% fetal bovine serum, 0.2 mg/ml of DNase I, and 0.04% trypan blue) at a final concentration of 20 3 106 cells/ml. Approximately 6 ll of the cell suspension were injected into each recipient mouse testis. Recipient testes were collected 3 mo following transplantation and EGFPpositive (EGFPþ) donor-derived colonies of spermatogenesis were visualized under a fluorescence stereomicroscope. EGFPþ colonies were quantified and measured in length using Image J software (National Institutes of Health).

Total RNA was extracted from FACS-sorted CD9-positive (CD9þ) cells using the RNeasy Mini Plus Kit with on-column DNase digestion (Qiagen). RNA concentration was determined using the Nanodrop 2000 (Nanodrop Technologies), and quality was assessed using a 2100 Bioanalyzer (Agilent Technologies). A total of 600 ng of cyanine 3 (Cy3)-labeled, linearly amplified cRNA with a specific activity of more than 5 pmol of Cy3 per 1 lg of cRNA was hybridized with a SurePrint G3 Rat GE microarray (Agilent Technologies) for 17 h at 658C. The array was washed and scanned according to the one-color, microarray-based gene expression analysis protocol of Agilent Technologies. The Agilent Feature Extraction software package (version 12.5; Agilent Technologies) was used to extract the hybridization signal intensities from the scanned images. The signal intensities were normalized and data analyzed using the GeneSpring software (version 12.0; Agilent Technologies), and only those genes with a signal intensity between the upper and lower percentile cutoffs (20%–100%) were considered to be ‘‘expressed.’’ All transcriptome results have been deposited in Gene Expression Omnibus (www.ncbi.nlm.nih. gov/geo; GEO accession no. GSE50143). Statistical significance between the two age groups (n ¼ 4) was tested by an unpaired t-test using a P-value of less than 0.05 and further filtered using the Benjamini-Hochburg false-discovery

FIG. 1. Changes in SSC number with age. The ratio of mouse testes containing rat GFPþ colonies (A), the average number of colonies (SSCs) per 1 3 106 cells transplanted (B), and the total SSC activity per donor testis (C) with cells from 4-, 18-, and 21-mo-old rats (n ¼ 12, 5, and 9 donors, respectively) are shown. Bars represent the mean 6 SEM.

2

Article 147

Downloaded from www.biolreprod.org.

Homozygous SD-Tg(ROSA-EGFP)2-4Reh transgenic rats that exclusively express enhanced green fluorescent protein (EGFP) in the germ cell lineage (also termed germ cell-specific GFP expression) at 4, 18, and 21 mo of age (n ¼ 4–6 animals/group, depending on the experiment) were maintained under standard conditions as described in A Guide to the Care and Use of Experimental Animals prepared by the Canadian Council on Animal Care. All animals were kept on a 12L:12D photoperiod with free access to food and water. Rats were bred and maintained in-house. Founder rats were kindly provided by R.E. Hammer (University of Texas Southwestern Medical Center, Dallas, TX). The ‘‘aged’’ rats at 18 mo were chosen as this is the time point just before the onset of germ cell loss and testicular atrophy, and the ‘‘aged’’ 21mo-old rats are in the process of losing their germ cells. NCr nude mice (nu/nu; Taconic) served as recipients for rat germ cell transplantation. To destroy endogenous spermatogenesis, the recipient mice were treated at 8 wk of age with busulfan (40 mg/kg; Sigma) at least 5 wk before donor cell transplantation as previously described [13]. All procedures involving animals were approved by the Animal Care and Use Committee of McGill University (McGill Animal Resources Centre Protocol 4687).

TESTIS AGING AND SPERMATOGONIAL STEM CELLS

rate correction. Probe sets that were significantly altered were further filtered using a minimum 1.5-fold difference. GeneSpring analysis included principal component analysis (PCA) to test the reproducibility of samples. Both Ingenuity Pathway Analysis (Ingenuity Systems) and Pathway Studio (version 9; Elsevier) were used to determine significantly changed gene networks.

Immunohistochemistry For CD9 immunostaining, testes were excised, snap-frozen in liquid nitrogen, and embedded in OCT immediately. Testes were subsequently sectioned at a thickness of 5 lm in a cryostat (Leica) and mounted on charged slides. The sections were air-dried, then fixed in methanol for 10 min. Nonspecific-binding sites were blocked using normal goat serum (Vector Laboratories) and diluted 1:4 in BSA/Tris-buffered saline (3%, w/v) for 30 min, after which sections were incubated with an anti-CD9 antibody overnight at 48C. For ZBTB16 immunostaining, rats were asphyxiated with CO2. Testes were excised, and the ends were punctured with a 26-gauge needle and then immersed in modified Davidson fixative [14]. After 2 h of immersion-fixation, the testes were cut in half to allow better fixation and replaced in the fixative for a total of 24 h. The testes were then dehydrated in a series of alcohol solutions and embedded in paraffin. Testicular sections (thickness, 5 lm) were cut and mounted on charged slides. Slides were dewaxed using xylene and rehydrated. Nonspecific-binding sites were blocked as described above for CD9. Sections were incubated overnight at 48C with the primary antibody specific for ZBTB16 (OP128; Calbiochem) diluted 1:100 in blocking buffer (3% BSA and 0.1% Triton X-100 in PBS [pH 7.4]); control sections were incubated with blocking serum alone. Slides were then washed and incubated with the appropriate fluorescent secondary antibodies: anti-rabbit Alexa Fluor 594 and

Real-Time Quantitative RT-PCR The RNA was diluted to a working concentration of 2 ng/ll, and Quantitect One-Step SYBR Green RT-PCR (Qiagen) was done using the StepOnePlus system (Applied Biosystems) according to the manufacturer’s instructions. PCR thermal cycling parameters were 488C for 30 min and 958C for 10 min (one cycle), 958C for 15 sec and 608C for 1min (40 cycles), and 958C for 15 sec, 608C for 15 sec, and 958C for 15 sec (one cycle). Standard curves were generated using 0.1, 1, 10, and 100 ng/ml of RNA from control pachytene spermatocytes in each run for quantification. RT-PCR primers (Table 1) were either ready-made Quantitect Primer Assays (Qiagen) or designed using Primer3 software (http://frodo.wi.mit.edu) and provided by Alpha DNA. The expression levels of all genes of interest were corrected using an endogenous control, 18S rRNA, and the fold-difference in mRNA expression of the samples was determined. The results shown are the mean of at least four rats per group on two separate occasions, and each sample was analyzed in duplicate.

3

Article 147

Downloaded from www.biolreprod.org.

FIG. 2. Changes in SSC quality with age. Views of intact mouse testes 3 mo after transplantation of germ cells from 4-mo-old (young; A), 18-mo-old (aged; D), and 21-mo-old (aged; G) rats are shown. Long GFPþ colonies from young rats (B and C) and 18-mo-old rats (E and F) and variable-sized colonies from 21-mo-old rats (H, I, and I inset) are also shown. Quantitative analysis of colony lengths from young and aged rats (J) is provided. Bars represent mean 6 SEM. ***P , 0.001. Bar ¼ 1 mm.

PAUL ET AL.

from a donor testis by the concentration of functional SSCs (colonies/106 cells) [11]. This revealed that the SSC activity decreases numerically, though not significantly, with age. Both the 18- and 21-mo-old testes contained less than 50% of the SSCs compared to the young testes (Fig. 1C), indicating that SSC numbers decline with age, similar to mice [9, 11]. A statistical significance was not detected by ANOVA (P . 0.05), probably due to a large variation inherent to the transplantation assay and relatively small sample numbers. However, when data from 18 and 21 mo were combined, colony numbers derived from aged donors were significantly lower than those from young donors (P , 0.05). We therefore conclude that SSC numbers decline with age in the rat, as seen in the mouse [9, 11], and that this decline starts before testicular atrophy becomes evident. Age Results in Decreased Quality of SSCs

CD9 þ Cells Are Enriched in SSCs

FIG. 3. Immunoexpression of undifferentiated spermatogonia cell markers in adult rat testes counterstained with 4 0 ,6-diamidino-2-phenylindole. Localization of CD9 (green) in the young (A) and aged (B) rat testis is shown. Localization of ZBTB16 (red) in the young (C) and aged (D) rat testis is also shown. Both markers show immunoexpression in the cells close to the basement membrane of the seminiferous tubule. Bar ¼ 50 lm.

In the present study, we wished to gain insight regarding molecular changes that may occur in SSCs with age. Because SSCs cannot be purified, we first confirmed our ability to enrich rat testis cells for SSCs using a cell surface marker, CD9 [15]. CD9 immunoexpression has been shown previously in the adult mouse testis [15] but not in the adult rat. Using immunohistochemistry in young and aged rat testes, we also examined whether CD9 expression patterns in spermatogonia are affected by age. In the testes of young animals, CD9 expression was observed on the surface of the cells located at the basement membrane of the seminiferous tubules, a corresponding region of the epithelium where we found cells expressing ZBTB16, a well-established marker of type A spermatogonia [16] (Fig. 3, A and C). From observational studies, it appeared that the ratio of ZBTB16-positive cells to CD9 þ cells was between 1.5:1.0 and 2.0:1.0 (n ¼ 3; data not shown). We observed similar localization patterns of CD9 þ cells in the testis of aged (18-mo) rats (Fig. 3, B and D), indicating that CD9 expression patterns are not affected by age in our rat model. To confirm that CD9 was an effective marker to enrich rat SSCs [15], GFP þCD9 þ cells were isolated using FACS, and transplants were done with both unsorted and GFP þCD9 þ sorted cells. The transgenic rat we used expresses GFP only in germ cells in the testis [17]. In comparison with unsorted cells, the transplants of CD9 þ cells yielded a 7-fold increase in the number of colonies generated (Fig. 4A). As a further confirmation, CD9 þ sorted cells were analyzed under an epifluorescent microscope following FACS to assess the presence of different cell types; as expected from the GFP expression specific to germ cells, no Sertoli cells were observed in sorted cells. In addition, we noted that larger GFP þ spermatocyte-like cells appeared absent from this

anti-mouse Alexa Fluor 488 (Invitrogen). Images were captured using a DM LB2 microscope (Leica) under a 403 objective fitted with an Infinity-3 video camera (Lumenera).

Statistical Analysis Results expressed as the mean 6 SEM were analyzed using Student t-test or one-way ANOVA followed by a Bonferroni post hoc test using GraphPad Prism (version 5; Graph Pad Software, Inc.).

RESULTS Aging Results in Decreased Numbers of SSCs Spermatogonial transplantation was used to assess the differences in quantity and quality of SSCs in young (4-moold) and aged (18- and 21-mo-old) rats. The total number of cells recovered from each age group of donor testes was similar, with a slight, but not significant, decrease at 21 mo of age (Supplemental Table S1; all Supplemental Data is available online at www.biolreprod.org). The same trend was seen in testis weight for the three age groups (Supplemental Table S1). Though no change was observed in the ratio of recipient testes that contained at least one colony after transplantation to those that did not (Fig. 1A), a numerical decrease of approximately 60% was found in the number of colonies observed with cells from both 18- and 21-mo-old rats (Fig. 1B). The total SSC activity in the testes from the different age groups was determined by multiplying the total number of cells recovered 4

Article 147

Downloaded from www.biolreprod.org.

In addition to colony numbers, colony length was also measured as an indication of the ability of the SSCs to repopulate recipient tubules (Fig. 2). In all age groups, a range of sizes was observed (Fig. 2, A–H), but on calculating the mean length, we found a small decrease in length in the 18-mo age group but a highly significant decrease in the length of colonies in the 21-mo age group (Fig. 2J). In addition to the change in length, it was noted that many of the colonies observed in the 21-mo-old group were more punctate in terms of GFP fluorescence and less bright in terms of GFP intensity (Fig. 2, G–I), suggesting lower levels of seminiferous tubule repopulation.

TESTIS AGING AND SPERMATOGONIAL STEM CELLS

Changes with Age in Gene Expression in CD9 þ Cells

population, and the cells that were present had a spermatogonia-like appearance (data not shown). The transplant data indicate that the sorted CD9 þ cells have a higher concentration of rat SSCs than do the unsorted cells, as previously reported for mice and rats by Kanatsu-Shinohara et al. [15], who saw a 5-fold increase in colonies. This marker was therefore used to isolate an SSC-enriched population of cells for gene expression studies in aged and young rats. When the CD9 þ FACS profiles were compared for the young and aged samples, we observed that the GFP þCD9 þ cells comprised 2.9% of cells in the young and 2.2% of cells in the aged groups (Fig. 4B), and no differences were observed in the staining profile of these cells between the young and the aged rats (Fig. 4C).

Gene expression microarray analysis showed that as expected from the enrichment study (Fig. 4A), many of the progenitor/stem cell markers, including Gfra, Zbtb16, Sox2, and Ret, were expressed in the isolated CD9 þ cells (Table 2). However, it was noted that some transcripts such as ckit and Dazl, considered to be expressed in spermatogonia later than the SSC stage, were also expressed in these cells [18, 19]. Therefore, given the localization of CD9 immunostaining and the ratio to ZBTB16 cells, it was assumed that CD9 þ cells also contained some non-SSC spermatogonia. The genes that were differentially expressed between CD9 þ cells from young and aged rats are shown in Supplemental Table S2. A total of 574 genes were altered in the aged compared to the young group by at least 2-fold and 1239 genes by at least 1.5-fold (Fig. 5A), with the majority of altered genes being downregulated (90%). Similar numbers of genes had a unique expression in one age group compared to the other (Fig. 5B). PCA revealed a correlation between the samples based on their whole-genome expression; it allows a visualization of the general relationships between the two experimental groups. The PCA plot showed that the two age groups segregate into two distinct spaces according to the age of the animals used for isolating CD9 þ enriched germ cells (Fig. 5C). Pathway analysis revealed that the top networks that were altered were associated with organ morphology and development, with changes in 73 genes involved in that network (Fig.

TABLE 2. Genes enriched in CD9þ cells. Marker Nanog Sox2 CD9 Gfra Ret Itgb1 Id4 Plzf (Zbtb6) Ncam Wt1 Thy1

Positive

Negative

U U U U U U U U U U U

5

Article 147

Downloaded from www.biolreprod.org.

FIG. 4. Flow cytometric analysis and sorting of germ cells immunostained with CD9. Extrapolated number of SSCs after CD9þ germ cell transplantations demonstrating CD9 enrichment of SSCs (A; n ¼ 4 rats), percentage of CD9þ germ cells in the young and aged samples (B; n ¼ 4 and 5, respectively), and profiles for young and aged (21-mo-old) germ cells showing the selection of double GFPþCD9þ germ cells (C; blue events) are shown. Bars represent the mean 6 SEM. *P , 0.05.

PAUL ET AL.

middle of testicular regression (21 mo; full regression would occur around 24 mo) [4]. We determined that SSCs decline in number (numerically; not statistically significant) with age to less than 50% of that seen in young rats by 18 mo, and by 21 mo, we also see a decrease in colony length, which is an evaluation of the quality of the SSCs in terms of their ability to differentiate. Previous studies in mice have shown aged SSCs that have undergone serial transplantation have a slower germ cell expansion rate than younger SSCs; it was suggested, though not confirmed, that this may be due to altered expression of stem cell self-renewal genes over time [20]. To determine molecular changes occurring in the aged cell population enriched for SSCs, we FACS-sorted germ cells that express CD9. It is thought that CD9 is a marker of spermatogonia and SSC/progenitor cells, though it may also be expressed on somatic interstitial cells [15]. In the present study, however, we were able to avoid selection of somatic cells guided by the germ cell-specific GFP expression in our transgenic rats. Using spermatogonial transplantation, we confirmed that the CD9 þ cells were enriched for SSCs and therefore used this marker to isolate this population of cells to determine changes in gene expression with age. We first checked the gene expression signatures of these CD9 þ cells to determine whether they expressed SSC-associated genes. Many of the expected stem/progenitor markers were expressed, including Gfra, Zbtb16, Sox2, and Ret. The expression of cKit indicates the inclusion of some more advanced spermatogonia in CD9 þ cells as c-Kit is expressed mostly by type Aal spermatogonia to early spermatocytes [21].

6). There appeared to be six central components of the interaction-based pathway. These six genes/proteins had the highest number of interactions involving binding, expression, and direct interactions and were either transcription factors (highlighted in blue) or receptors (highlighted in green). All six genes/proteins are known to play a role in stem cell proliferation, development, or maintenance. In addition, a further interaction-based pathway was highlighted where components were exclusively involved in stem cell development, function, and maintenance either in SSCs or other types of stem cells. These were downregulated and included Gfra, Itgb1, and csf1r and also Itga1, Runx2, Fgf3, Wnt7a, and Wnt5b, respectively (Fig. 7A and Supplemental Table S2). It is of particular interest that a number of genes involved in DNA repair were also changed and actually upregulated. These included Msh4, Msh5, Brca1, Dmc1, and Rad52 and are shown in Figure 7B. Due to the limited amount of RNA obtainable from the small number of sorted CD9 þ cells, only a select few transcripts could be tested for confirmation by quantitative RT-PCR. These included three transcripts involved in DNA repair (Msh4, Msh5, and Dmc1) and two involved in stem cell function (Gfra and Wnt7a). Quantitative RT-PCR confirmed the microarray data (Fig. 8). DISCUSSION In the present study, we analyzed three different age groups corresponding to young fertile rats (4 mo), rats at the onset of aging and germ cell loss (18 mo), and rats that should be in the 6

Article 147

Downloaded from www.biolreprod.org.

FIG. 5. Changes in gene expression in a CD9þ population of cells during aging. Number of genes that are significantly altered by 1.5- and 2-fold in aged CD9þ cells compared to young counterparts (A), Venn diagram of genes expressed in both the young and the aged CD9þ cells and those that are exclusively expressed in only one age group (B), and PCA showing the correlation between individual samples from the young (blue dots, circled in orange) and aged (red dots, circled in green) groups based on whole-genome expression (C) are shown.

TESTIS AGING AND SPERMATOGONIAL STEM CELLS

Numerous genes were changed in the aged CD9 þ cells, with approximately 90% being downregulated. It is thought there may be a general decline in transcriptional activity with age, so we checked to see if the GFP expression also changed in the germ cells with age by both FACS and epifluorescent expression. No difference was found in either parameter in our rats (Supplemental Fig. S1). Different groups of transcripts were altered in the aged CD9 þ cells, and the network with the highest number of transcripts changed was associated with organ morphology and development. At the heart of this network, there appeared to be six key transcripts that were transcription factors or receptors: Pparc, Ncam1, Egfr, Fgfr2, Kdr, and Runx2. PPARc is involved in neural stem cell maintenance [22], though its role in SSCs is unknown. NCAM has been reported to mediate GDNF signaling, which stimulates SSC self-renewal [23]. EGFR plays a role in regulation of neural stem cell number and may also be involved in SSC maintenance, whereas EGF and FGF are essential growth factors for maintaining SSCs in vitro for protracted periods of time [24–26]. RUNX2 may be involved in the promotion of proliferation of SSCs, as it does in other types of stem cells, such as during chondrogenesis [27]. Of particular interest is KDR, a VEGF receptor, that was downregulated by 2-fold in our aged CD9 þ cells and is one of the intracellular signals promoting cell proliferation thought to play a role in

balancing the SSC population [28]. In addition, a smaller, more specific pathway associated with ‘‘stem cell development and maintenance’’ was identified; all genes in this pathway were downregulated. These included wnt7a (involved in neural stem cell expansion [29]), Mcam (a marker of SSCs [30]), and a number of integrins, including b1 integrin, which has been shown to play a role in keratinocyte differentiation [31] and to be expressed on SSCs [30]. With these changes in expansion, differentiation, and maintenance-associated transcripts, it is not surprising we saw a decrease in SSC numbers with age. We also saw a decrease in one of the known SSC markers, Gfra, the coreceptor of GDNF, which controls the balance between self-renewal and differentiation of SSCs [32, 33]. Thus, the testicular atrophy that is normally seen with age may be explained by these molecular changes that are taking place in the aging testis before regression occurs. Another network that was altered with age was one including genes involved in DNA damage recognition and repair. Brca2, which is thought to be required for progression through mitosis and for mitotic DNA repair, and Rad52, which is thought to be involved in mitotic recombination and repair [34–36], were upregulated. This suggests that a strand break processing error may be occurring during mitosis in aged CD9 þ cells or that an increase in strand breaks occurs and these proteins are upregulated to help in repairing these lesions. A 7

Article 147

Downloaded from www.biolreprod.org.

FIG. 6. Gene expression network showing direct linkages between genes identified by Gene Ontology analysis to be involved in organ morphogenesis and development and that were significantly altered in the aged CD9þ cells compared to young counterparts. The genes with the highest number of interactions are highlighted in the pathway (transcription factors in blue, receptors in green).

PAUL ET AL.

FIG. 8. Relative mRNA expression of Gfra (A), Wnt7a (B), Msh5 (C), Msh4 (D), and Dmc1 (E) in young and aged CD9þ cells. Bars represent the mean 6 SEM. *P , 0.05, **P , 0.01, ***P , 0.001.

8

Article 147

Downloaded from www.biolreprod.org.

FIG. 7. Gene expression network showing direct linkages between genes identified by Gene Ontology analysis to be involved in stem cell maintenance and development (A) or DNA damage recognition and repair (B) and that were significantly altered in the aged CD9þ cells compared to young counterparts.

TESTIS AGING AND SPERMATOGONIAL STEM CELLS

ACKNOWLEDGMENT The authors wish to thank Trang Luu for her technical assistance and Xiangfan Zhang for her assistance with the transplantation experiments.

REFERENCES 1. Clermont Y. The cycle of the seminiferous epithelium in man. Am J Anat 1963; 112:35–51. 2. Paul C, Robaire B. Ageing of the male germ line. Nat Rev Urol 2013; 10: 227–234. 3. Paul C, Nagano M, Robaire B. Aging results in differential regulation of DNA repair pathways in pachytene spermatocytes in the Brown Norway rat. Biol Reprod 2011; 85:1269–1278. 4. Wright WW, Fiore C, Zirkin BR. The effect of aging on the seminiferous epithelium of the brown Norway rat. J Androl 1993; 14:110–117. 5. Serre V, Robaire B. Paternal age affects fertility and progeny outcome in the Brown Norway rat. Fertil Steril 1998; 70:625–631.

9

Article 147

Downloaded from www.biolreprod.org.

6. Syntin P, Robaire B. Sperm structural and motility changes during aging in the Brown Norway rat. J Androl 2001; 22:235–244. 7. Gosden RG, Richardson DW, Brown N, Davidson DW. Structure and gametogenic potential of seminiferous tubules in ageing mice. J Reprod Fertil 1982; 64:127–133. 8. Wang C, Leung A, Sinha-Hikim AP. Reproductive aging in the male Brown Norway rat: a model for the human. Endocrinology 1993; 133: 2773–2781. 9. Ryu BY, Orwig KE, Oatley JM, Avarbock MR, Brinster RL. Effects of aging and niche microenvironment on spermatogonial stem cell selfrenewal. Stem Cells 2006; 24:1505–1511. 10. Suzuki N, Withers HR. Exponential decrease during aging and random lifetime of mouse spermatogonial stem cells. Science 1978; 202: 1214–1215. 11. Zhang X, Ebata KT, Robaire B, Nagano MC. Aging of male germ line stem cells in mice. Biol Reprod 2006; 74:119–124. 12. Kong A, Frigge ML, Masson G, Besenbacher S, Sulem P, Magnusson G, Gudjonsson SA, Sigurdsson A, Jonasdottir A, Wong WS, Sigurdsson G, Walters GB, et al. Rate of de novo mutations and the importance of father’s age to disease risk. Nature 2012; 488:471–475. 13. Ogawa T, Arechaga JM, Avarbock MR, Brinster RL. Transplantation of testis germinal cells into mouse seminiferous tubules. Int J Dev Biol 1997; 41:111–122. 14. Latendresse JR, Warbrittion AR, Jonassen H, Creasy DM. Fixation of testes and eyes using a modified Davidson’s fluid: comparison with Bouin’s fluid and conventional Davidson’s fluid. Toxicol Pathol 2002; 30: 524–533. 15. Kanatsu-Shinohara M, Toyokuni S, Shinohara T. CD9 is a surface marker on mouse and rat male germline stem cells. Biol Reprod 2004; 70:70–75. 16. Costoya JA, Hobbs RM, Barna M, Cattoretti G, Manova K, Sukhwani M, Orwig KE, Wolgemuth DJ, Pandolfi PP. Essential role of Plzf in maintenance of spermatogonial stem cells. Nat Genet 2004; 36:653–659. 17. Cronkhite JT, Norlander C, Furth JK, Levan G, Garbers DL, Hammer RE. Male and female germline specific expression of an EGFP reporter gene in a unique strain of transgenic rats. Dev Biol 2005; 284:171–183. 18. Prabhu SM, Meistrich ML, McLaughlin EA, Roman SD, Warne S, Mendis S, Itman C, Loveland KL. Expression of c-Kit receptor mRNA and protein in the developing, adult and irradiated rodent testis. Reproduction 2006; 131:489–499. 19. Rocchietti-March M, Weinbauer GF, Page DC, Nieschlag E, Gromoll J. Dazl protein expression in adult rat testis is up-regulated at meiosis and not hormonally regulated. Int J Androl 2000; 23:51–56. 20. Schmidt JA, Abramowitz LK, Kubota H, Wu X, Niu Z, Avarbock MR, Tobias JW, Bartolomei MS, Brinster RL. In vivo and in vitro aging is detrimental to mouse spermatogonial stem cell function. Biol Reprod 2011; 84:698–706. 21. van Pelt AM, de Rooij DG. Retinoic acid is able to reinitiate spermatogenesis in vitamin A-deficient rats and high replicate doses support the full development of spermatogenic cells. Endocrinology 1991; 128:697–704. 22. Wada K, Nakajima A, Katayama K, Kudo C, Shibuya A, Kubota N, Terauchi Y, Tachibana M, Miyoshi H, Kamisaki Y, Mayumi T, Kadowaki T, et al. Peroxisome proliferator-activated receptor gamma-mediated regulation of neural stem cell proliferation and differentiation. J Biol Chem 2006; 281:12673–12681. 23. Sjostrand D, Carlsson J, Paratcha G, Persson B, Ibanez CF. Disruption of the GDNF binding site in NCAM dissociates ligand binding and homophilic cell adhesion. J Biol Chem 2007; 282:12734–12740. 24. Levine E, Cupp AS, Miyashiro L, Skinner MK. Role of transforming growth factor-alpha and the epidermal growth factor receptor in embryonic rat testis development. Biol Reprod 2000; 62:477–490. 25. Kanatsu-Shinohara M, Ogonuki N, Inoue K, Miki H, Ogura A, Toyokuni S, Shinohara T. Long-term proliferation in culture and germline transmission of mouse male germline stem cells. Biol Reprod 2003; 69: 612–616. 26. Aguirre A, Rubio ME, Gallo V. Notch and EGFR pathway interaction regulates neural stem cell number and self-renewal. Nature 2010; 467: 323–327. 27. Kim EJ, Cho SW, Shin JO, Lee MJ, Kim KS, Jung HS. Ihh and Runx2/ Runx3 signaling interact to coordinate early chondrogenesis: a mouse model. PLoS ONE 2013; 8:e55296. 28. Caires KC, de Avila JM, Cupp AS, McLean DJ. VEGFA family isoforms regulate spermatogonial stem cell homeostasis in vivo. Endocrinology 2012; 153:887–900. 29. Qu Q, Sun G, Murai K, Ye P, Li W, Asuelime G, Cheung YT, Shi Y.

number of other DNA damage/repair-associated genes were upregulated, including Smarca5, Msh4, Msh5, and Ube2a, suggesting an overall change in the levels of DNA damage and/ or repair in the older CD9 þ cell population; this is consistent with what we observed in the more developed germ cells, such as spermatocytes [3], and suggests that the DNA damage we see in sperm from older men may originate as early as the male germline stem cells. It is interesting to contrast these findings with those from our previous study [3] where the families of transcripts most dramatically affected in aged pachytene spermatocytes were those associated with DNA repair and oxidative stress. In the present study, the only oxidative-stress associated transcript that was changed was Gpx8, which was downregulated and the function of which is not fully known, especially in the testis. The reason for the differences in the age-dependent alterations between the cell types is not entirely surprising as we previously saw drastic differences in the age-associated transcript expression between pachytene spermatocytes and round spermatids [3]. The reason for this may be that different repair pathways operate in different types of germ cells. Different DNA repair pathways and checkpoints are at play during mitosis and meiosis [37, 38], so a different response of SSCs and spermatogonia (mitotic) compared to that of spermatocytes (meiotic) is not unexpected. Another consideration is that the different types of germ cells are exposed to different environments and therefore their responses differ. For example, the SSCs and spermatogonia and the postmeiotic germ cells are in two different environments separated by the blood-testis barrier. In conclusion, many changes occur in the testis with age, and at least some of these changes can be ascribed to alterations in the SSCs. Not only do these cells change in number and ability to differentiate, they apparently have a significantly altered gene expression signature compared to their younger counterparts. Some of the genes that are altered, such as Gfra, the integrins, and Kdr, may account for the diminished ability of regeneration of spermatogenesis. If the balance between self-renewal and differentiation is disturbed, it is not unexpected that we see testicular atrophy with age. In addition, there are already hints as to the presence of DNA damage within these cells, which could in turn be carried through to mature spermatozoa, especially as DNA repair pathways in later germ cells are not working to their full capacity [3]. The present study provides insight that the molecular signature of aged progenitor cells and spermatogonia is different from that of the young counterparts and that this causes deleterious effects on spermatogenesis that could affect progeny outcome.

PAUL ET AL.

30.

31.

32.

33.

34.

Wnt7a regulates multiple steps of neurogenesis. Mol Cell Biol 2013; 33: 2551–2559. Kanatsu-Shinohara M, Morimoto H, Shinohara T. Enrichment of mouse spermatogonial stem cells by melanoma cell adhesion molecule expression. Biol Reprod 2012; 87:139. Levy L, Broad S, Diekmann D, Evans RD, Watt FM. b1 Integrins regulate keratinocyte adhesion and differentiation by distinct mechanisms. Mol Biol Cell 2000; 11:453–466. Shinohara T, Avarbock MR, Brinster RL. b1- And a6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 1999; 96:5504–5509. Meng X, Lindahl M, Hyvonen ME, Parvinen M, de Rooij DG, Hess MW, Raatikainen-Ahokas A, Sainio K, Rauvala H, Lakso M, Pichel JG, Westphal H, et al. Regulation of cell fate decision of undifferentiated spermatogonia by GDNF. Science 2000; 287:1489–1493. Klovstad M, Abdu U, Schupbach T. Drosophila brca2 is required for

35.

36. 37.

38.

mitotic and meiotic DNA repair and efficient activation of the meiotic recombination checkpoint. PLoS Genet 2008; 4:e31. O’Donovan PJ, Livingston DM. BRCA1 and BRCA2: breast/ovarian cancer susceptibility gene products and participants in DNA double-strand break repair. Carcinogenesis 2010; 31:961–967. Barlow JH, Rothstein R. Timing is everything: cell cycle control of Rad52. Cell Div 2010; 5:7. Xu G, Spivak G, Mitchell DL, Mori T, McCarrey JR, McMahan CA, Walter RB, Hanawalt PC, Walter CA. Nucleotide excision repair activity varies among murine spermatogenic cell types. Biol Reprod 2005; 73: 123–130. Forand A, Fouchet P, Lahaye JB, Chicheportiche A, Habert R, Bernardino-Sgherri J. Similarities and differences in the in vivo response of mouse neonatal gonocytes and spermatogonia to genotoxic stress. Biol Reprod 2009; 80:860–873.

Downloaded from www.biolreprod.org.

10

Article 147