Sugar Tech (2009) 11(4) : 355-359
RESEARCH ARTICLE
Agrobacterium mediated transformation of sugarcane for borer resistance using Cry 1Aa3 gene and one-step regeneration of transgenic plants Raviraj M Kalunke · Archana M Kolge
· K Harinath Babu · D Theertha Prasad
Received: 8 August, 2009; Accepted: 2 October, 2009
Abstract Sugarcane borers are the major biotic pest in sugarcane that accounts nearly 25-30% yield loses. Most of the present sugarcane varieties are not resistant to borers. Development of borer resistance in sugarcane through transgenic technology could be the best approach. Cry series of genes are known for development of insect pest resistance in plants in particular for the most damaging order ‘Lepidoptera’. The sugarcane (Saccharum hybrids) genotype CoC671 was transformed by Agrobacterium mediated method. Cry 1Aa3 gene driven by CaMV35S promoter and Ocs terminator with selectable marker nptII driven by Nos promoter and terminator harboring in binary vector pBinAR was transformed into Agrobacterium tumefaciens strain EHA 105 was used in sugarcane transformation. Young leaf roll discs were infected and regenerated plants were obtained in one step after infection with minimal callus phase. Three to four shoots per explant were developed after 7-10 days incubation. Regenerated shoots were allowed to grow further. Two months old putative transgenic plants were taken for molecular characterization. Out of 65 plants tested by PCR, 24 plants were positive for Cry1Aa3 gene. This represents nearly 28% of the transformation efficiency. All these plants were analyzed Raviraj M Kalunke* ·Archana M Kolge · K Harinath Babu () Molecular Biology & Genetic Engineering Laboratory, Vasantdada Sugar Institute, Manjari, Pune, Maharashtra, India email:
[email protected] Universita’ degli Studi della Tuscia, Dipartimento di Agrobiologia e Agrochimica, Via San Camillo de Lellis, 01100 Viterbo Italy
*
D Theertha Prasad Department of Biotechnology, University College of Agricultural Sciences, GKVK, Bangaluru, Karnataka, India
by Southern blot hybridization for integration of the inserted gene. Four plants showed single copy number and another two showed more than two integrations. All those 24 plants that are positive by PCR were subjected to ELISA test for expression of foreign protein. It was observed that four transgenic plants showed around ten-fold high level expression and another two plants showed with moderate levels, 3-5 fold expression. Keywords Sugarcane, genetic transformation, Cyr1Aa3 gene, borer resistance Introduction Sugar industry is the second largest agro-based industry in India next to cotton. Sugarcane (Saccharum hybrids) is the major contributor to sugar production all over the world followed by sugar beet (Beta vulgaris). Cultivated sugarcane varieties are complex aneupolyploid hybrids of noble sugarcane S. officinarum (2n=20-122) and S. spontaneium (2n=36-128) (Roach 1989). Traditional plant breeding techniques have been used to improve economic traits in agriculture crops but this approach is time consuming, especially the vegetatively propagated long duration crop like sugarcane. At present, sugarcane germplasm lack the genotypes that possess agronomic traits like resistance to insects, viruses and herbicide. Chilo infuscatellus – shoot borer, Chilo sacchariphagus – internode borer and Scripophaga excerptalis – early shoot borer are the major insect pest of sugarcane in India, and insecticides spraying is not much effective as the borers lodge inside the stem. Development of borer resistance in sugarcane through biotechnological tools could be one of the best approach.
13
356
Several attempts have been made to understand the factors enhancing somatic embryogenesis and plant regeneration from immature leaf discs in sugarcane, which is a basic requirement for further regeneration of entire plant from transformed cell lines (Snyman et al., 2001; Gill et al., 2004; Lakshmanan et al., 2006). Further Desai et al. (2004) reported a simple and reproducible protocol for direct somatic embryogenesis from cultured immature inflorescence segments of sugarcane (Saccharum spp.). Rapid in vitro protocol for somatic embryogenesis and suitability of different ex-plants for microprojectile bombardment was investigated by Snyman et al. (2006) to establish the developmental stages suitable for efficient transformation system in sugarcane. Direct plant regeneration from cultured young leaf explants without intervening callus phase was found to be advantageous in production of true-to-type progenies after transformation (Manickavasagam et al., 2004; Raman et al., 2006). Their findings depict that, axillary bud explants from six months old sugarcane cultivars Co92061 and Co671 showed 50% transformation efficiency in Agrobacterium mediated transformation of bar and nptII genes. There are several reports indicating the development of transgenic sugarcane plants expressing Cry genes (Bower et al., 1996; Elliot et al., 1998; Arencibia et al., 1999; Weng et al., 2006; Xu et al., 2008) and proteinase inhibitors (Falco and Silva-Filho, 2003; Leela et al., 2009) for insect resistance.
Sugar Tech (2009) 11(4) : 355-359
Fig.1. Different stages of direct plant regeneration. A) leaf discs inoculated on day 1, B) direct regeneration after 3 weeks, C) plantlets after 2 months of inoculation
The present work reports on the development of early shoot borer and internode borer resistant sugarcane plants using Cry1Aa3 gene, through Agrobacterium mediated transformation and regeneration of plants in one step with minimal callus phase to avoid the somaclonal variations from sugarcane variety CoC671.
(Fig. 1B). MS medium (Murashige and Skoog 1962) supplemented with 3% (w/v) sucrose, 0.6 mg/l 2,4-D, 100 mg/l PVP, 500 mg/l CH with 0.8% (w/v) bacto agar (Himedia) was adjusted to pH 5.8 with 0.1M NaOH before autoclaving used as one-step regeneration medium. Cultures were incubated in light and dark (16 and 8h) conditions of coolwhite-fluorescent light providing a quantum flux density of 30 ìmol s–1 m–2 at 25 ± 2oC. Regenerated shoots were transferred on to the same medium for further growth and then transferred to MS basal medium supplemented with 2 mg/l NAA for root initiation. The rooted plants of 8-10 cm height were transferred to polybags containing sterile soil, sand and farmyard manure (2:1:1 ratio) for further growth in green house (Fig.1C).
Materials and Methods
A. tumefaciens strain and plasmid vector
Plant material and explants preparation
Transformation vector pBinAR having Cry1Aa3 gene flanked by 35S CaMV promoter and Ocs terminator and selectable marker gene nptII under the control of nos promoter and terminator (Fig.2), in Agrobacterium tumefaciens strain EHA105 was used in transformation. Agrobacterium was grown overnight at 28oC in LB medium with 50 mg/l Kanamycin
Healthy shoots (main or offshoots) with intact apical meristem and young leaves of var. CoC671 were collected from 4-6 months old field-grown sugarcane plants. Cylinders of young leaf rolls (5–8 cm height) were removed just above the shoot tip. These cylinders were treated with 0.5% carbendism (Bavistin) for 1 h and surface sterilized with 0.1% (w/v) mercuric chloride for 10-15 min. After treatment, they were washed thoroughly in sterilized distilled water for 3-4 times. Subsequently, the outer layers of leaf sheath were pealed out one by one until the cylinder reached approximately 0.5 cm in diameter. The cylinders were cut transversely into thin slices (0.5 – 1.0 mm thick) and used as starting materials for further experiments (Fig. 1A). Direct regeneration of shoots Transversely chopped young leaf segments were placed on one-step regeneration medium with minimal callus phase
13
Fig.2. Restriction map of vector pBinAR harboring Cry1Aa3 gene
(Himedia) and 50 mg/l Rifampicin (Himedia). The cells were collected and re-suspended in same volume of liquid MR medium (MS Basal reduced to 1/5 strength) with 100 µM/l Acetosyringone, 10 µM/l Glucose and 10 µM/l Fructose at pH 5.3. The culture was allowed to grown a cell density of 0.6 at OD600nm for sugarcane transformation.
Sugar Tech (2009) 11(4) : 355-359
Agrobacterium infection, co-cultivation and regeneration of plants Leaf discs of 0.5-1.0 mm thick were aseptically air-dried for 20-30 min before agro-infection and incubated with 50 ml of activated Agrobacterium suspension for 20 min with intermittent agitation. The inoculated leaf discs were blotted on sterile tissue paper to remove excess bacterial suspension and inoculated on co-cultivation medium (MS basal with 0.6 mg/l 2,4-D solidified with 0.8% agar) for 72h. After cocultivation, infected leaf discs were washed once with sterile distilled water followed by liquid MS shooting medium containing 500 mg/l cefotaxime for 30 min on rotary shaker and transferred to the same composition with agar solidified medium having Kanamycin (150 mg/l). These cultures were incubated under light (30 mol s–1 m–2) and dark (16h and 8h) for regeneration. Fifteen days after incubation on selection and regeneration medium, regenerated shoot buds were transferred to MS basal medium with Kanamycin (150 mg/l) for another 15 days for further growth of the plants. PCR analysis Genomic DNA was isolated from 100 mg of young leaf tissue of putative transgenic plants as per the protocol of Aljanabi et al. (2002). Tissue culture raised non-transformed plant of the same age was used as control. About 25ng of genomic DNA used as template for 25l reaction. PCR mix contained 2.5l of 10x PCR buffer, 0.5l dNTP mix (10 mM), 0.5l of Cry1Aa3 specific primers containing 10mM of forward (5’ GGCAACCACATCTTATGGAC 3’) and reverse (5’CAAGTTTGTGGTGCTAGCGT 3’), 5.0 l of MgCl2 (25 mM), 1.5 units of Taq DNA polymerase (Bangalore Genei, India), 2l of template DNA and 13.5l of sterile distilled water. PCR conditions used for amplification were initiated with denaturation at 94oC for 5 min followed by 35 cycles of 94oC denaturation for 45sec, 60oC annealing for 45sec and 72oC
357
extension for 1 min, followed by final extension cycle of 72oC for 7min. The amplified DNA was analyzed on 1.0% agarose gel at 80V for 60min. Southern blot analysis Genomic DNA (10 g per reaction) from PCR positive putative transgenic plants and untransformed control plants was digested with EcoRI, HindIII. The restricted DNA was resolved on 0.8% agarose gel at 15V for 12-14h. The digested DNA was transferred to Biodyne B.0.45 positively charged nylon 6.6 transfer membrane (Pall Corporation, India) by downward alkaline blotting. The PCR amplified gene probe (576 bp) of Cry1Aa3 labeled with 32P-dCAP (6,000 Ci/mol) was used in hybridization. Unincorporated nucleotides were removed with Probe Quant G-50 micro-columns (Pharmacia Biotech, Uppsala, Sweden) before hybridization. Prehybridization and hybridization conditions were followed as per the standard protocol Sambrook et al. (2001). After hybridization at 65oC for 24 h the membranes were washed three times with different concentrations of saline sodium citrate (SSC) buffer (2x, 1x and 0.5x SSC). Membranes after final wash with 0.1x SSC, 0.1% SDS at 65oC were exposed to Xray film (Kodak, India) for 48 h and developed. ELISA ELISA was performed using HRP based qualitative kit (Desigen Diagnostics, Mahyco, India) following manufacturer’s protocol. Total protein was extracted from 200 mg dry leaf powder using extraction buffer. Anti-Cry1Ac conjugate (50 µl) was added to the anti-Cry1Ac antibody precoated plate. The positive and negative controls provided along with kit were used as reference. Incubated for 45min at room temperature and washed four times with 1x wash buffer. After removing the excess buffer, 100 l of 1x substrate per well was added and incubated at room temperature for 15 min in dark. Equal volume of stop solution was added and absorbance was recorded at 450nm using Micro-plate reader (Labsystems, USA). Results and Discussion Direct regeneration of plants
Fig.3. PCR analysis of putative transformed plants for Cry 1Aa3 gene. Lane 1, Positive control of plasmid; lane 2, water control; lane 3-8, putative transformed plants; lane 9, untransformed plant negative control
Several media combinations were tested for direct regeneration of the plantlets in one step from leaf discs (data shown somewhere else). It was observed that 7-10 days after placing the leaf discs on MS medium supplemented with 3% sucrose, 500 mg/l Casein hydrolysate, 0.6 mg/l 2,4-D and 100 mg/l PVP induced 3-4 shoots per explants from midrib region of the leaf tissue. This combination was found suitable for shoot initiation. These shoots attained an height of 2-3 cm within 30 days of the initial culture.
13
358
Direct regeneration of plants from axillary bud culture was reported Manickavasagam et al. (2004) and rapid in vitro protocols for somatic embryogenesis that are suitable for microprojectile transformation and subsequent regeneration of plants by Snyman et al. (2006). Mulleegadoo and DookunSaumtally (2005) reported that they transferred the transformed leaf rolls on callus induction medium for a period of six days, the leaf rolls enlarged and some embryogenic callus developed on the cut surface. When they transferred this material onto regeneration medium, within three to four weeks green shoot primordial developed from the callus. In our case, initial callus development and subsequent regeneration was achieved in a single step without subculturing.
Sugar Tech (2009) 11(4) : 355-359
Southern blot hybridization of transformed plants Genomic DNA (10 g) from transformed plants that were positive to PCR/ELISA tests, untransformed plant and plasmid DNA were digested with EcoRI and HindIII and subjected to southern analysis using 576 bp Cry1Aa3 probe labeled with 32P-dCAP. Out of the 24 plants tested, four plants showed single copy number and two showed more than two integration events (Fig.4).
Agrobacterium infection, co-cultivation and regeneration of plants Agrobacterium over growth during co-cultivation period was observed when aseptically air-dried leaf discs for 20-30 min before agro-infection compared to non-air dried material used for infection. This indicated the air-dried material has more capacity to hold the Agrobacterium cells to it and the chances of infection. Over growth of Agrobacterium was over come by repeated washings with sterile distilled water followed by liquid half strength MS medium with 500 mg/l Cefotoxin for 30 min. Prior to the transformation experiments, Kanamycin sensitivity was tested and found the concentration of 150 mg/l suitable to select the transformed cell lines. This concentration was maintained in the medium till end of plant regeneration. These cultures were incubated under light for selection and subsequent regeneration. Fifteen days after incubation on selection and regeneration medium, regenerated shoot buds were transferred to MS basal medium with Kanamycin (150 mg/l) for another 15 days for further growth of the plants. All the developed shoot primordial did not grow further despite regular subcultures under selection pressure. The putative transgenic plants of 44 of CoC671 obtained were taken for further analysis. PCR analysis The putative transgenic plants of CoC671 were subjected to PCR analysis for the presence of Cry1Aa3. Twelve plants out of 44 in CoC671 showed the presence of Cry1Aa3 with expected band size of 576 bp. This represents nearly 28% of the transformation efficiency. Zi-Zhang et al. (2005) reported similar results that about 30% of the PPT-resistant plants were detected positive by PCR. Where as Ai-Qin Wang et al. (2009) reported that only two of the nineteen plants were found to be positive, which was about 10.5% of the total G418-resistant plants.
13
Fig.4. Southern blot analysis of transformed plants. Lane 1, positive control; lane 2-10, putative transgenic plants; lane 11, negative control
The presence of bands indicates integration of gene at multiple sites. No hybridization signals were found in negative control plants. In one of the earlier studies using biolistic method, the average five gene insertions in sugarcane was observed (Bower et al., 1996). However in sugarcane plants that were transformed using Agrobacterium mediated method, the number of copy number varied from one to three (Arencibia et al., 1998). ELISA test All those 24 PCR positive plants and non-transformed tissue culture raised sugarcane plant of the same variety as negative control were subjected to ELISA test for expression analysis. It was observed that four transgenic plants of CoC671 showed around ten-fold high level of expression and another two plants with moderate levels, 3-5 fold expression (Table-1). Table 1. ELISA results. Colums 1-4 are the plant samples, 5-8 are the corresponding readings OD at 450 nm. A1, H4 are blanks, B1, G4 are Positive controls supplied along with kit, C1, F4 are negative controls supplied along with kit, D2, E4 are un-transformed sugarcane controls. A B C D E F G H
1 Bla Pos Neg 49 51 52 54 55
2 56 57 58 Cont-1 60 73 74 75
3 76 77 79 80 81 83 112 113
4 114 116 F 18 H26 Cont-2 Neg Pos Bla
5 0.067 2.814 0.119 1.874 2.147 1.63 1.536 1.52
6 0.585 0.628 0.577 0.283 1.895 0.439 1.207 0.822
7 0.637 0.097 0.373 0.478 0.842 0.56 0.472 0.686
8 0.815 0.524 0.324 2.959 0.185 0.124 2.189 0.072
Sugar Tech (2009) 11(4) : 355-359
Our investigation reports that regeneration of plants with minimal callus phase in one step after transformation yielded as good as 28% of the total plants transformed from CoC 671. Although the expression levels by ELISA test showed as high as ten fold over control, further confirmation by insect bioassay at green house level is essential. Further analyses in progenies are to be carried out for stable integration and expression of transgene. Acknowledgement Authors are thankful to Mr. Shivajirao Deshmukh, DG, VSI for his encouragement, Dr. P. Anand Kumar, Director, NRC Plant Biotechnology for providing the gene and to Dr. V Seshadri, Scientist, NCCS for his help in Southern hybridization. Authors also thankful to Dr. R.M. Devarumath and Mr. Prashant Kawar for their help.
References Ai-Qin Wang, Wei-Aing Dong, Yuan-Wen Wei, Cheng-Mei Huang, LongFei He, Li-Tao Yang, Yang-Rui Li (2009). Transformation of sugarcane with ACC oxidase antisense gene. Sugar Tech 11(1): 3943. Aljanabi SM, Forget L, Dookun A (1999). An improved and rapid protocol for the isolation of polysaccharide- and polyphenol- free sugarcane DNA. Plant Mol. Biol. Rep. 17: 1-8. Arencibia A, Carmona E, Cornide MY, Castiglione S, O’Relly J, Cinea A, Oramas P, Sala F (1999). Somaclonal variation in insect-resistant transgenic sugarcane (Saccharum hybrid) plants produced by cell electroporation. Transgenic Res. 8: 349-360. Bower R, Elliott AR, Potier BAM, Birch RG (1996). High-efficiency microprojectile-mediated cotransformation of sugarcane using visible or selectable markers. Mol. Breed. 2: 239-249. Desai NS, Suprasanna P, Bapat VA (2004). Simple and reproducible protocol for direct somatic embryogenesis from cultured immature inflorescence segments of sugarcane (Saccharum spp.). Curr.Sci. 87 (6): 764-768. Elliott AR, Campbell JA, Bretell RIS, Grof CPL (1998). Agrobacteriummediated transformtion of sugarcane using GFP as a screenable marker. Aust. J. Plant Physiol. 25: 739-743. Falco MC, Silva-Fliho MC (2003). Expression of soybean proteinase inhibitors in transgenic sugarcane plants: effects on natural defense against Diatracea saccharalis. Plant Physiol Biochem. 41: 761766. Franklin S. Arvinth, Sheeba CJ, Kanchana M, Subramonian N (2006). Auxin pretreatment promotes regeneration of sugarcane (Saccharum spp. hybrids) midrib segment explants. Plant Growth Reg. 50:111–116. Gill NK, Raman Gill, Gosal SS (2004). Factors enhancing somatic embryogenesis and plant regeneration in sugarcane (Saccharum
359 officinarum L). Indian J. Biotech. 3: 119-123. Leela Amala Christy, Arvinth S, Saravanakumar M, Kanchana M, Nukunthan N, Srikant J, George Thomas, Subramonian N (2009). Engineering sugarcane cultivars with bovine pancreatic trypsin inhibitor (aprotinin) gene for protection against top borer (Scripophaga excerptalis Walker). Plant Cell Rep. 28: 175-184. Manickavasagam M, Ganapathi A, Anbazhagan VR, Sudhakar B, Selvaraj N, Vasudevan A, Kasthurirengan S (2004). Agrobacterium-mediated genetic transformation and development of herbicide-resistant sugarcane (Saccharum species hybrids) using axillary buds. Plant Cell Rep. 23: 134-143. Mulleegadoo KD, Dookun-Saumatally D (2005). Genetic transformation of sugarcane by microprojectile bombardment of young leaf rolls. Proc. Intl. Soc. Sugarcane Technol. 25: 579-583. Murashige T, Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant. 15: 473-497. Prakash Lakshmanan, Geijskers Jason, Lifang Wang R, Adrian Elliott, Christopher PL, Grof, Nils Berding, Smith Grant R (2006). Developmental and hormonal regulations of direct shoot organogenesis and somatic embryogenesis in sugarcane (Saccharum spp. interspecific hybrids) leaf culture. Plant Cell Rep. 25: 10071015. Raman Gill, Malhotra PK, Gosal SS (2006). Direct plant regeneration from cultured young leaf segments of sugarcane. Plant cell, Tissue and Organ Culture. 84: 227-231. Roach BT (1989). Origin and improvement of the genetic base of sugarcane. In: Egan BT Ed. Proc. Aust. Soc. Sugarcane Technol. 11: 34-47. Sambrook J, Fritsch EF, Maniatis T (2001). Molecular Clone: A Laboratory Mannual (M): 3rd Ed. Cold Spring Harbor Laboratory Press, NY, 2001 Snyman SJ, Huckett BI, Watt MP, Botha FC (2001). A comparison of direct and indirect somatic morphogenesis for the production of transgenic sugarcane (Saccharum spp. hybrids). Acta Hort. 560: 105-108. Snyman SJ, Meyer GM, Richards JM, Haricharan N, Ranmgarib S, Huckett BI. (2006). Refining the application of direct embryogenesis in sugarcane: effect of the developmental phases of leaf disc explants and the timing of DNA transfer on transformation efficiency. Plant Cell Rep. 25: 1016-1023. Weng LX, Deng H, Xu H, Li Q, Wang LH, Jiang Z, Zhang HB, LiQ, Zhang LH (2006). Regeneration of sugarcane elite breeding lines and engineering of stem borer resistance. Pest Manag. Sci. 62: 178-187. Xu L-P, Y-X Que, Xu J-S, Fang S-R, Zhang M-Q, Chen Y-Q, Chen R-K (2008). Establishment of genetic transformation system and obtaining transgenic sugarcane (var. badila) transformed with RS gene. Sugar Tech 10(2): 128-132. Zi-Zhang Wang, Shu-Zhen Zhang, Ben-Peng Yang and Yang-Rui Li (2005). Trehalose synthase gene transfer mediated by Agrobacterium tumefaciens enhances resistance to osmotic stress in sugarcane. Sugar Tech 7(1): 49-54.
13
