Alexandria Journal of Veterinary Sciences www.alexjvs ... - eJManager

0 downloads 0 Views 585KB Size Report
shown in Table (1). Sample were inoculated into ... per sample were collected and then cultured onto ..... McNamara, A. M. 1997: Generic HACCP applications in.

Alexandria Journal of Veterinary Sciences www.alexjvs.com AJVS. Vol. 58 (1): 132-138. July 2018. DOI: 10.5455/ajvs.285297

Studies on the Prevalence of E. coli in Chicken Carcasses in Abattoirs and its Antibiotic Sensitivity Mahmoud Abd Elzaher1, Ebeed A. Saleh2, Reem Abd Elhamied1, Dalia Talat1, Madiha S. Ibrahim1 1Department 2Department

of Microbiology, Faculty of Veterinary Medicine, Damanhour University, Egypt of Food Hygiene, Faculty of Veterinary Medicine, Damanhour University, Egypt

ABSTRACT Key words: E. coli, abattoir, chicken carcasses, antimicrobial sensitivity *Correspondence to: [email protected]

1.

This study aimed to estimate Butchers hands and articles as a source of E. coli contamination in poultry meat and slaughterhouses andto estimate the effect of random antimicrobials usage on the antimicrobial susceptibility of the isolated E. coli. A total of 192 samples were collected from four poultry abattoirs in El-Beheira governorate. Samples were collected from butchers' hands, articles, carcass internal and external surfaces. E. coli was isolated and identified by culture, biochemical analysis and PCR. Further the isolates were studied for their antimicrobial susceptibility against 11 commonly used antibiotics in poultry farms. E. coliwas detected in hands (87.5%), articles (81.25%), internal (80.35%) and external (78.57%) surfaces of the carcasses. The highest antimicrobial sensitivity of the isolates was detected to Tobramycin (100%), Cefotaxime (50-75%) and Chloramphenicol (59-66.7%). While, the highest resistance was detected to Penicillin, Sulfamethoxazole and Trimethoprim, (100%), Amoxicillin (93- 100%), Cephradine and Doxycycline. Further, multiple antimicrobial resistance was detected. By PCR, 33.3% (2/6) of the samples from the internal surface of the carcasses were positive for the intimin; eaeA gene. Thus, contamination of chicken carcasses in the abattoirs with pathogenic E. coli that resists different antimicrobials poses a challenge for human food and thus human health. The use of antimicrobials as well asapplying hygienic proceduresin abattoirs are clearly a necessity for the production of healthy food.

coli in both human and animal (Mooljuntee et al., 2010). Over the past 20 years, poultry meat production and consumption worldwide has increased very rapidly. This has led to intensive animal production with an increase in both the number of farms and in flock size. Broilers are normally raised on litter floors and this may lead to contamination of poultry both with spoilage microorganisms and also with human pathogens, such as Salmonella spp., Campylobacter spp., Clostridium perfringens, Listeria monocytogenes and Escherichia coli or Staphylococcus aureus. Young animals show symptoms of bacterial infection only occasionally but most of them are healthy carriers of pathogens and they are not excluded from farm or from slaughter during ante mortem inspection. Epidemiological data suggest that contaminated products of animal origin, especially poultry, contribute significantly to foodborne diseases. Reduction of raw poultry contamination levels would thus have a large impact on reducing the incidence of illness (Keener et al. 2004). Transport and slaughter

INTRODUCTION

Antimicrobial usage is considered the most important factor promoting the emergence, selection and dissemination of antimicrobial-resistant microorganisms in both veterinary and human medicine. E. coli is often found in our surrounding environment because of fecal contamination, which is implicated in food borne illness, death and increasing health care costs in human beings (Ferens and Hovde et al., 2011),especially in the developing countries, where hygiene and sanitation facilities are often poor. Raw meat rather than under-cooked meat represents a major source of E. coli infection (Sammarco et al., 1997) whereavian pathogenic E. coli was reported to be a zoonotic pathogen of hemorrhagic colitis and human uremic syndrome in human (Ferens and Hovde et al., 2011). There is no reference policy in applying antimicrobial therapy in poultry farms and the choice of suitable antimicrobial depends on its availability, which result in increasing multi-drugs resistant E.

132

Abd Elzaher et al. 2018. AJVS 58 (1): 132-138

of poultry involve a number of operations that may substantially affect the extent of poultry contamination. Due to stress during transport, excretion patterns of birds carrying e.g. Salmonella can change through disturbance of intestinal function or even damage to the birds’ intestinal tract to such extent that they may adversely affect their immune system (Cox and Pavic et al. 2010). An important process operation that impacts the presence of microorganisms in poultry slaughter is scalding. At present, the trend is to scald poultry at lower temperatures (50-52 °C), which are more suitable for air-chilled poultry. Lower scalding temperatures may, however, allow some microorganisms including pathogens to survive. A way of avoiding this problem is to use multistage scalding, where poultry is scalded in several scald tanks lined one behind another, which substantially reduces contamination on poultry surfaces (Berrang et al. 2008). The next process operation is plucking, which is closely related to the scalding operation. The main hygienic problem is cross-contamination via equipment or via aerosols in the air. Evisceration is the first stage of the clean part of the slaughter process. Consisting of several stages, evisceration starts with head removal followed by opening of the body cavity, removal of intestines, and ends with the cleaning of the carcass (Cox and Pavic et al. 2010). From the hygienic point of view, attention is paid to the removal of the intestines and the prevention of cross-contamination with fecal material. The next processing step is chilling which is essential to control microbial growth (James et al. 2006). Common methods include continuous mechanical immersion, chilling and airblast chilling, with or without the incorporation of water-sprays to maintain product yield and enhance cooling by evaporation (Mead et al. 2004). It follows from the above overview of basic processing steps in broiler slaughter that there are many steps in the poultry meat processing that could significantly influence the extent of poultry contamination and thus also its marketability and incidence of pathogenic microorganisms. The most critical processing steps in this respect include scalding, plucking,

evisceration and the type of poultry chilling (Keener et al. 2004). Changes in contamination levels during poultry slaughter have been published by many authors, who reported a substantial decrease in TVC and coliform bacteria counts after carcass washing and after chilling. Mead et. al. (2004) found that the highest counts of microorganisms were recorded in the initial stages of processing, comprising the receivingkilling and defeathering areas, whereas the counts toward the evisceration, air chilling, packaging and dispatch areas decreased. (Lues et al. 2007) 2. MATERIALS AND METHODS 2.1. Samples, bacteriological and biochemical Identification: A total of 192 swab were collected from poultry abattoirs in El- Beheira governorate. The four abattoirs were assigned A, B, C, and D. Samples were collected as follows; 40 swabs from butchers' hands (H), 48 swabs from carcass external surface(EX), 48 swabs from carcass internal surface(IN) and 24 swabs from articles in the slaughterhouses (AR) as shown in Table (1). Sample were inoculated into nutrient broth for 18 h and then onto MacConkey agar and onEosin methylene blue agar (EMB), incubated aerobically at 37°C for 24 h and then examined for bacterial growth. Bacteria were isolated and identified by gram stain and conventional biochemical profile according to MacFaddin et al (1985.) 2.2. Antimicrobial susceptibility testing: Samples were inoculated on MacConkey agar and Eosin methylene blue (EMB) agar and three colonies per sample were collected and then cultured onto nutrient agar for Antimicrobial susceptibility testing, which was carried out according to the Clinical Laboratory standards Institute (CLSI, 2012). The following antibiotic discs were12 antibiotics with standard concentration (mg/ml) Tobramycin, 10 (TOB), Sulfamethoxazole /trimethoprim, 25 (SXT), Penicillin, 10 (P), Cephradine, 30 (CE); Amoxicillin, (AMX) 25, Cefotaxime, 75 (CTX), Rifampicin, 30 (RA), Chloramphenicol. 3o (C), Ofloxacin .

Table (1): Samples collected from different abattoirs Abattoirs A B C 16 16 H 16 Ar 16 8 16 Ex 16 8 16 In 48 16 64 Total The four abattoirs were assigned A, B, C, and D, H; butchers' hands, Ex; carcass surface, Ar; articles in the slaughterhouses Samples

133

D Total 16 48 16 32 16 56 16 56 64 192 external surface, In; carcass internal

Abd Elzaher et al. 2018. AJVS 58 (1): 132-138

(OFX), Doxycycline, 30 (DO), Norfloxacin, 10 (NOR), Ciprofloxacin .5 (CIP). 2.3 Detection of E. coli and antimicrobial resistance genes by Polymerase Chain Reaction (PCR): DNA was extracted by phenol-chloroform according to (Sambrook et al., 1989). PCR (Emerald Amp GT

PCR master mix (Takara) Code No. RR310A kit) was conducted by adding 12.5 μl of Emerald Amp GT PCR master mix (2x premix), 4.5 μl PCR grade water, 1 μl forward primer (20 pmol), 1 μl reverse primer (20 pmol) and 6 μl template DNA to a total volume of 25 μl. Primers used for the detection of the different genes are listed in Table (2).

Table (2): Oligonucleotide primers sequences used for PCR. Target gene

Primers sequences

eaeA

ATGCTTAGTGCTGGTTTAGG GCCTTCATCATTTCGCTTTC ATTTCTCACGCCAGGATTTG GATCGGCAAAGGTTAGGTCA CCCGCTTTCTCGTAGCA TTAGGCATCACTGCGTCTTC

qnrA aac(6′)-Ib-cr

Reference

248

Bisi-Johnson et al., 2011

516

Robicsek et al., 2006

113

Lunn et al., 2010

Table 4 shows the antimicrobial resistance detected by the tested isolates. 3.4. PCR detection of E. coli genes and

3. RESULTS 3.1. Prevalence of E. coli among the collected samples from different abattoirs: E. coli was isolated from 157 out of 192 samples with a total percentage of 81.77. Hand samples (H) showed the highest incidence of E. coliisolation followed by the carcass internal surfaces (In) then both equally the carcass external surface (Ex) and the articles (Ar), as shown in Table (3). 3.2. Antimicrobial susceptibility of isolated E. coli: Antimicrobial susceptibility was observed in E. coli isolates from all samples. As shown in Table (4), the highest percentage of resistance was to the Penicillin, Sulfamethoxazole and Trimethoprim with 100%. While all isolates were sensitive Tobramycin with 100%, followed by Amoxicillin (93.7%), Cephradine (93.4%), Doxycycline (76.97%), Ofloxacin (61.77%), Norfloxacin (50.27%), Rifampicin (44.25%), Chloramphenicol (37.75%) and Cefotaxime (35.92%). 3.3.

Amplified segment (bp)

antimicrobial resistance genes: Some of E. coli positive samples, as shown in Table (5) and Figure (1) were subjected to PCR for the detection of E. coli eaeA (intimin) gene as well as antimicrobial resistance genes; qnrA and acc6-Ib-cr. Of the isolates,33.3% (2/6) were positive for eaeA and acc6-Ib-cr genes, where all the isolates (6/6) was negative for qnrA gene. 3.5. PCR detection of E. coli genes and antimicrobial resistance genes: Some of E. coli positive samples, as shown in Table (5) and Figure (1) were subjected to PCR for the detection of E. coli eaeA (intimin) gene as well as antimicrobial resistance genes; qnrA and acc6-Ib-cr. Of the isolates,33.3% (2/6) were positive for eaeA and acc6-Ib-cr genes, where all the isolates (6/6) was negative for qnrA gene.

Antimicrobial resistance of E. coli isolates

Table (3): Incidence of E. coli among different samples and abattoirs A

B

Abattoirs C

H

11/16 (68.75%)

-

16/16 (100%)

Ex

12/16 (75%)

8/8 (100%)

14/16 (87.5%)

In

10/16 (62.5%)

8/8 (100%)

12/16 (75%)

Ar

-

-

13/16 (81.25%)

12/16 (75%)

Total

33/48 (68.75%)

16/16 (100%)

55/64 (85.94%)

53/64 (82.81%)

Sample

D 16/16 (100%) 10/16 (62.5%) 15/16 (93.75%)

Total 43/48 (89.58%) 44/56 (78.57%) 45/56 (80.35%) 25/32 (78.125%) 157/192 (81.77%)

The four abattoirs were assigned A, B, C, and D, H; butchers' hands, Ex; carcass external surface, In; carcass internal surface, Ar; articles in the slaughterhouses

134

Abd Elzaher et al. 2018. AJVS 58 (1): 132-138

Table (4): Antimicrobial resistance of E. coli isolates Sample Antibiotic Penicillin

H

Ex

En

Ar

Total

100

100

100

100

100

Sulfamethoxazole

100

100

100

100

100

Trimethoprim Cephradine Amoxicillin Norfloxacin Doxycycline Ofloxacin Chloramphenicol Tobramycin Cefotaxime

100 89.5 93.7 43.7 89.5 58.3 33.3 0 31.2

100 100 100 94.6 89.2 41 41 0 37.5

100 100 100 28.5 69.6 60.7 39.2 0 25

100 96.8 93.7 34.3 59.3 78.1 37.5 0 50

100 93.4 93.7 50.27 76.97 61.77 37.75 0 35.92

Rifampicin

28.1

64.2

53.5

31.2

44.25

H; butchers' hands, Ex; carcass external surface, In; carcass internal surface, Ar; articles in the slaughterhouses.

Table (5): Detection of E. coli eaeA gene and antimicrobial resistance genes. Sample In H Ex In Ex H

Virulence eaeA + + -

Genes Antimicrobial resistance qnrA acc6-Ib-cr + +

H; butchers' hands, Ex; carcass external surface, In; carcass internal surface.

Figure (1): Agarose gel electrophoresis of amplified DNA showing the specificity of the single reaction for the detection of the different genes; eaeA gene, qnrA gene and acc6-Ib-cr gene.

135

Abd Elzaher et al. 2018. AJVS 58 (1): 132-138

microbial contamination and limited incidence of pathogens. There is evidence that bacterial numbers differ between external and internal areas of the carcass. (Bodnaruk et al. 1998) reported that E. coli numbers recovered from the internal cavity of turkey carcasses were not different from the external breast skin area. However, these areas contained lower E. coli numbers than the external thigh or back skin areas. Commercial processing, particularly the evisceration process, may result in carcass contamination. There are reported differences in visible contamination and bacterial numbers between the external surface and internal cavity. However, broilers entering slaughter processing are highly contaminated by microorganisms, including foodborne pathogens such as Salmonella and Campylobacter spp., and these pathogens tend to be disseminated in the processing plant during processing (Mead et al., 1994; Kotula and Pandya et al, 1995). The overall bacterial levels of freshly processed poultry carcasses are influenced by the time of feed withdrawal before slaughter (Bilgili et al 1988; Izat et al. 1989), transport and crating time (McNab et al. 1993), outside air temperature and plant temperature (Renwick et al. 1993), processing steps (Lillard et al.1990; Mead et al. 1993), plant temperature control, and hygienic practices in the plant (Bailey et al., 1987; Mead et al. 1989). Although it is impossible to ensure the complete absence of pathogens from broilers, the risk of foodborne disease can be reduced substantially by minimizing their numbers. (Mead et al. 1989) summarized the reasons why controlling microorganisms in poultry processing is difficult as 1) the rapid rate of production keeps the birds in close proximity throughout processing, 2) limitations in the design of processing equipment, including that used in scalding, defeathering, and evisceration, 3) the difficulty of washing the abdominal cavity effectively after evisceration when the carcass remains whole, 4) retention of water by skin, which tends to entrap bacteria in the crevices and feather follicles (Notermans and Kampelmacher et al. 1974) During processing, most of the gram-positive bacteria originating from live birds are removed and replaced by a heterogeneous population mainly composed of gram negative bacteria, including Pseudomonas, flavobacteria, Acinetobacter, Morexella and Enterobacteriaceae (Mead et al. 1989). In addition, pathogens, mainly Salmonella, Campylobacter, Clostridium perfringens, and Staphylococcus aureus, also contaminate the final

4. DISCUSSION E. coli mediated infection is increasing over the world, which should be taken under serious concern as a public health importance (Todar et al. 2006). E. coli is one of the normal microbial flora of the gastrointestinal tract of poultry, animals and human but with the potential to convert to pathogenicity (Levine et al. 1987). In the present study, 192 Samples were collected from four poultry abattoirs in El-Behira governorate. Samples were collected from butchers hands and articles, carcass internal and external surface. Incidence of E. coli was 81.77% in total and 68.75%, 100%, 85.93%, and 82.81% for abattoir A, B, C, and D, respectively.This indicates high risk ofraw food contamination. Difference in E. coli contamination level among abattoirs may be caused by different sanitary level control during carcass evisceration, handling and washing as well as butchers’ personal hygiene. Antimicrobial susceptibility test was performed to all of the E. coli isolates. The highest antimicrobial sensitivity were detected to Tobramycin (100%), Cefotaxime (50-75%) and Chloramphenicol (5966.7%), indicating that these antibiotics could be drugs of choice to control poultry products related food poisoning. The highest percentage of resistance was detected to Penicillin, Sulfamethoxazole and Trimethoprim (100%), Amoxicillin (93%), Cephradine and Doxycycline (89.5%), indicating that these antibiotics should not be used for control ortreatment. Further, multiple antimicrobial resistance was detected in 91.7% of the isolates. Moreover, the resistant E. coli was isolated from the different types of samples indicating that cross contamination of the resistant isolates could take place between animal and human as well as the surrounding environment. The feasible transfer of antibacterial resistant organisms from food animals to humans is well established by (Mølbak et al. 2004). As was mentioned above, the microflora of poultry is very heterogeneous. Poultry meat contamination with microorganisms which cause deterioration in food quality, and especially those which cause foodborne diseases, is a major challenge for poultry industries in many countries that must aim at improving hygiene control during slaughter. In EU member states, principles of good manufacturing practice are used on farms and, for poultry slaughtering and processing, the HACCP system is the most important. Together with preventive measures on poultry farms and the use of modern slaughtering technologies, these systems can guarantee that poultry is produced with minimum 136

Abd Elzaher et al. 2018. AJVS 58 (1): 132-138

Keener, K.M., Bashor, M.P., Curtis, P.A., Sheldon, B.W., Kathariou, S. 2004: Comprehensive review of Campylobacter and poultry processing. Compr Rev Food Sci Food Safety 3: 105-116. Lillard, H. S. 1990: The impact of commercial processing procedures on the bacterial contamination and cross contamination of broiler carcasses. J. Food Prot. 53:202– 204. Lues J.F., Theron M.M., Venter P, Rasephei M.H. 2007: Microbial composition in bioaerosols of a highthroughput chicken-slaughtering facility. Poult Sci 86: 142-149. MacFaddin, J.F. 1985: Media for isolation-cultivationidentification-maintenance of medical bacteria, vol 1. Williams and Wilkins, Baltimore, Maryland. McNab, W. B., S. A. Renwick, H. R. Lowman, R. C. Clarke. 1993: Variability of broiler carcass bacterial load at three abattoirs, as measured by a hydrophobic grid membrane filter interpreter. J. Food Prot. 56:700–705. McNamara, A. M. 1997: Generic HACCP applications in broiler slaughter and processing. National Advisory Committee on Microbiological Criteria for Foods. J. Food Prot. 60:579–604. Mead, G. C. 1989: Hygiene problems and control of process contamination. Pages 183–221 in Processing Poultry, G. Mead, ed. Elsevier Applied Science, London, UK. Mead, G. C., W. R. Hudson, M. H. Hinton. 1993: Microbiological survey of five poultry processing plants in the UK. Br. Poult. Sci. 34:497–503. Mead, G. C., W. R. Hudson, M. H. Hinton. 1994: Use of a marker organism in poultry processing to identify sites of cross-contamination and evaluate possible measures. Br. Poult. Sci. 35:345–354. Mead, G.C. 2004: Microbial hazards in production and processing. In Mead GC (Ed.): Poultry meat processing and quality. Woodhead Publishing, Cambridge, pp. 232257 Mølbak, K. 2004: Spread of Resistant Bacteria and Resistance Genes from humans, The Public Health Consequences. Journal of Veterinary Medicine, Series B, 51(2004) (8-9), 364-369. Mooljuntee, S., Chansiripornchai, P., Chansiripornchai, N. 2010: Prevalence of the cellular and molecular antimicrobial resistance against E. coli isolated from Thai broilers. Thai Journal of Veterinary Medicine 40(3): 311–315. Notermans, S. F., E. H. Kampelmacher. 1974: Attachment of some bacterial strains to the skin of broiler chickens. Br. Poult. Sci. 15:573–585. Renwick, S. A., W. B. McNab, H. R. Lowman, R. C. Clarke. 1993: Variability and determinants of carcass bacterial load at a poultry abattoir. J. Food Prot. 56:694– 699. Sambrook, J.; Fritscgh, E.F., and Mentiates 1989: Molecular coloning. A laboratory manual. Cold spring Harbor Laboratotry press, New York. Sammarco, M.L., Ripabelli, G., Grasso, G.M. 1997: Consumer attitude and awareness towards food relative hygienic hazards. J.food Safety,17:215-221.

product (Notermans et al., 1974; Bailey et al., 1987; Mead, 1989). The USDA's Food Safety Inspection Service (FSIS) implemented Escherichia coli and Salmonella testing on post chill poultry carcasses to reduce or eliminate bacterial pathogens (USDA, 1996). To assist this effort, FSIS mandated a zero tolerance policy for fecal material on poultry carcasses prior to entering the chiller (USDA, 2005). These actions demonstrate FSIS is determined to reduce fecal contamination and associated numbers of pathogens on processed poultry. Hazard Analysis Critical Control Points (HACCP) is a well-accepted systematic program for identification and control of microbiological hazards associated with poultry processing, and has been applied to the poultry industry to improve microbiological quality of broiler carcasses and reduce microbiological hazards from farm to consumption (Unnevehr and Jensen et al. 1996; McNamara et al. 1997). The use of antibiotics in the treatment and prevention of animal disease is clearly a necessity, hence, much care must be given to the choice of antibiotic in control, treatment and as growth promotors. 5.

REFERENCE

Bailey, J. S., J. E. Thomson, N. A. Cox. 1987: Contamination of poultry during processing. Pages 193– 211 in The Microbiology of Poultry Meat Products. F. E. Cunningham, and N. A. Cox ed. Academic Press, Orlando, FL. Berrang, M.E., Meinersmann, R.J., Smith, D.P., Zhuang, H. 2008: The effect of chilling in cold air or ice water on the microbiological quality of broiler carcasses and the population of Campylobacter. Poultry Sci 87: 992-998 Bilgili, S. F. 1988: Effect of feed and water withdrawal on shear strength of broiler gastrointestinal tract. Poult. Sci. 67:845– 847. Bodnaruk, P.W., Schmedler, J.L., Krakar, P.J., Tompkin., R.B. 1998: A comparison of Escherichia coli levels at four sampling sites on turkey carcasses. Poult. Sci. 77(10):1531-1533. Cox, J.M., Pavic, A. 2010: Advances in enteropathogen control in poultry production. J Appl Microbiol 108: 745-755 Huang B, Eglezos S, Heron BA, Smith H, Graham T, Ferens, W.A, Hovde, C.J. 2011: Escherichia coli O157:H7: animal reservoir and sources of human infection. Foodborne Pathogens and Disease 8, 465–485. Izat, A.L., M. Colberg, C.D. Driggers, Thomas., R.A. 1989: Effect of sampling method and feed withdrawal period on recovery of microorganisms from poultry carcasses. J. Food Prot. 52:480–483. James, C., Vincent, T., Andrade Lime T.I., James, S.J. 2006: The primary chilling of poultry carcasses-a review. Int J Refriger 29: 847-862

137

Abd Elzaher et al. 2018. AJVS 58 (1): 132-138

USDA, Food Safety Inspection Service. 1996: Pathogen reduction; hazard analysis and critical control point (HACCP) systems. Fed. Reg. 61:38806-38989 USDA, Food Safety Inspection Service. 2005: Verification of procedures for controlling fecal material, ingesta, and milk in slaughter operations. FSIS Directive 6420.2.

Todra, k. 2006: Pathogenic E. coli. In:Todars Online Textbook of Bacteriology, Todra,k (Ed.). University of Wisconsin-Madison Department of Bacteriology, USA :1-4. Unnevehr, L. J., H. H. Jensen. 1996: HACCP as a regulatory innovation to improve food safety in meat industry. Am. J. Agric. Econ. 20:186–201.

138

Suggest Documents