Amino Acid Changes in Elongation Factor Tu of Mycoplasma ...

INFECTION AND IMMUNITY, Sept. 2009, p. 3533–3541 0019-9567/09/$08.00⫹0 doi:10.1128/IAI.00081-09 Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Vol. 77, No. 9

Amino Acid Changes in Elongation Factor Tu of Mycoplasma pneumoniae and Mycoplasma genitalium Influence Fibronectin Binding䌤 Sowmya Balasubramanian,1 T. R. Kannan,1 P. John Hart,2,3 and Joel B. Baseman1* Department of Microbiology and Immunology1 and Department of Biochemistry,2 University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Drive, San Antonio, Texas 78229-3900, and Geriatric Research, Education, and Clinical Center, Department of Veterans Affairs, South Texas Veterans Health Care System, The University of Texas Health Science Center at San Antonio, San Antonio, Texas 782293 Received 21 January 2009/Returned for modification 12 March 2009/Accepted 13 June 2009

Mycoplasma pneumoniae and Mycoplasma genitalium are closely related organisms that cause distinct clinical manifestations and possess different tissue predilections despite their high degree of genome homology. We reported earlier that surface-localized M. pneumoniae elongation factor Tu (EF-TuMp) mediates binding to the extracellular matrix component fibronectin (Fn) through the carboxyl region of EF-Tu. In this study, we demonstrate that surface-associated M. genitalium EF-Tu (EF-TuMg), in spite of sharing 96% identity with EF-TuMp, does not bind Fn. We utilized this finding to identify the essential amino acids of EF-TuMp that mediate Fn interactions by generating modified recombinant EF-Tu proteins with amino acid changes corresponding to those of EF-TuMg. Amino acid changes in serine 343, proline 345, and threonine 357 were sufficient to significantly reduce the Fn binding of EF-TuMp. Synthetic peptides corresponding to this region of EF-TuMp (EF-TuMp 340-358) blocked both recombinant EF-TuMp and radiolabeled M. pneumoniae cell binding to Fn. In contrast, EF-TuMg 340-358 peptides exhibited minimal blocking activity, reinforcing the specificity of EFTu–Fn interactions as mediators of microbial colonization and tissue tropism. bind to subepithelial tissue targets through EF-Tu interactions with Fn. Furthermore, these distinct pathogenic pathways may also contribute to the ability of M. pneumoniae to invade and to establish intracellular and perinuclear residence (9, 57). Detailed analyses of EF-TuMp–Fn interactions revealed the critical role of the carboxyl region of EF-Tu (amino acids 192 to 219 and 314 to 394) in Fn recognition (3). Other mycoplasmas with tip organelles, such as Mycoplasma penetrans and Mycoplasma gallisepticum, have been reported to bind Fn through a 65-kDa protein (13) and the PlpA and Hlp3 proteins (34). Following our initial findings of EF-TuMp–Fn interactions, surface-associated EF-Tu proteins from other microorganisms, including Lactobacillus johnsonii, Listeria monocytogenes, and Pseudomonas aeruginosa, were reported to bind mucin (16), fibrinogen (43), plasminogen, and factor H (32). Since EF-Tu is one of the most highly conserved proteins in mycoplasmas, it has been used to create an EF-Tu sequence-based mycoplasma phylogeny tree. This allows the classification of the human pathogens, M. genitalium and M. pneumoniae, along with M. gallisepticum, a poultry pathogen, in the same group (28). M. pneumoniae is an established pathogen of the respiratory tract (54) but has also been isolated from the urogenital tract (15). M. genitalium, an emerging sexually transmitted disease pathogen (27, 51), has also been associated with respiratory (6) and joint (50) pathologies. It has been suggested that the tissuespecific tropisms and pathogenic mechanisms of these two mycoplasmas are determined by genetic distinctions between them (19). Most of the open reading frames proposed for M. genitalium are present in M. pneumoniae. Overall, M. pneumoniae and M. genitalium share 67.4% average identity at the amino acid level, while conserved housekeeping proteins ex-

Many pathogens express surface proteins that facilitate colonization and cellular invasion (12, 39, 44, 49, 55). The human mycoplasmas, Mycoplasma pneumoniae and Mycoplasma genitalium, have genome sizes of 816,394 bp (20) and 580,070 bp (12), respectively, with the latter considered the smallest selfreplicating biological cell (14, 38). These bacterial pathogens possess terminal tip-like structures comprised of specific membrane adhesins and adherence-related accessory proteins that mediate surface parasitism of target cells (5) and are essential for virulence (4). While adherence of virulent M. pneumoniae is mediated primarily by tip organelle-associated adhesins (10, 24), the absence of these proteins in hemadsorption-negative mutants (HA⫺ class II mutants) (17) still permits detectable adherence (18), suggesting the involvement of alternative mechanisms by which mycoplasmas bind to host cells. Recently, we showed that M. pneumoniae surface-associated elongation factor Tu (EF-TuMp; MPN665) and the pyruvate dehydrogenase E1 beta subunit (MPN392) interact with fibronectin (Fn) (11). In addition, we demonstrated that HA⫺ class II mutants also bind Fn through EF-Tu (11). Fn is an abundantly available pathogen target (22) that exists in soluble form in blood fluids and plasma and in fibrillar form in the extracellular matrix (56). M. pneumoniae could readily access the extracellular matrix through virulence-related determinants following epithelial cell damage (29) and could directly

* Corresponding author. Mailing address: Department of Microbiology and Immunology, University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Drive, San Antonio, TX 782293900. Phone: (210) 567-3939. Fax: (210) 567-6491. E-mail: baseman @uthscsa.edu. 䌤 Published ahead of print on 22 June 2009. 3533

3534

BALASUBRAMANIAN ET AL.

INFECT. IMMUN.

TABLE 1. Primers used for amplification of EF-Tu constructsa Primer

Nucleotide sequence (5⬘33⬘)b

Amino acid change(s) (EF-TuMp3EF-TuMg)

MPN EF-Tu FP MPN EF-Tu RP MG EF-Tu FP MG EF-Tu RP 1 FP 1 RP 2 FP 2 RP 3 FP 3 RP 4 FP 4 RP 5 FP 5 RP 6 FP 6 RP 7 FP 7 RP

GAGACGTAATTCAAACATATGGCAAGAGAG GTGCCTGGCTTTCCTTGAGGATCCTAACAGAGT CATATGGCAAGAGAGAAATTTGACCG GGATTCTCACTATTCTAGAACTTCTG GAGACGTAATTCAAACATATGGCAAGAGAG CGGAGCCTTATCGATTTCGTCGTAACGAG CTCGTTACGACGAAATCGATAAGGCTCCG CACTTGCAATGTCACACTTGTTTAGGAACACTACCATTTTTGG CCAAAAATGGTAGTGTTCCTAAACAAGTGTGACATTGCAAGTG CGTGTAGGAGTTGGAATCCATTCATCAACTGCTTTAATTAAATC GATTTAATTAAAGCAGTTGATGAATGGATTCCAACTCCTACACG GGTTTTAAACCAACGATTTCAACTTCTTG CAAGAAGTTGAAATCGTTGGTTTAAAACC CACTTGACCACGTTCCACTTCTTTACGTTCCAC GTGGAACGTAAAGAAGTGGAACGTGGTCAAGTG CGAAGCATTGTCACCTGGTAGCACCATTTCGGTGTTTTCAGCTAGAGC GCTCTAGCTGAAAACACCGAAATGGTGCTACCAGGTGACAATGCTTCG GGATCCTATTCAAGCACTTCCGTGACAGTACCAGCACCAAC

None None None None None Q3E Q3E RT3KS RT3KS MNE3IKT MNE3IKT IR3VK IR3VK D3E D3E SPT3AAA SPT3AAA S3T

a All regions were amplified using the respective mutagenic forward and reverse primers, as required. Overlapping fragments with changes were then annealed and amplified using MPN EF-Tu FP and either MPN EF-Tu RP or 7 RP to generate full-length products. b Introduced BamHI and NdeI sites are italicized. Changed nucleotides are shown in bold.

hibit 70 to 97% identity (19). Among the latter proteins, EF-Tu displays a high sequence identity (96%). In this study, we compared EF-Tu–Fn binding between M. pneumoniae and M. genitalium and discovered biological and biochemical differences that facilitated the identification of key amino acids responsible for these interactions. Such distinctions provide evidence of unique colonization capabilities of these bacteria. MATERIALS AND METHODS Bacterial strains, plasmids, and DNA manipulations. Escherichia coli INV␣F⬘ [F⬘ endA1 rec-1 hsdR17 supE44 gyrA96 lacZ⌬M15 (lacZYA-argF)] (Invitrogen, Carlsbad, CA) and E. coli BL21(DE3) [F⬘ ompT hsdSB(rB⫺ mB⫺) gal dcm (DE3)] (Stratagene, La Jolla, CA) were grown in Luria-Bertani (LB) broth for cloning, expression, and purification of recombinant EF-TuMp (rEF-TuMp), recombinant EF-TuMg (rEF-TuMg), and mutagenized constructs. pCR2.1 (TA cloning vector; Invitrogen) and E. coli INV␣F⬘ were used for gene manipulations, and pET19b (N-terminal His10-tagged expression vector; Novagen/EMD Biosciences Inc., San Diego, CA) and E. coli BL21 were used for protein expression. M. pneumoniae clinical isolate S1, reference strain M129, and its class II HA⫺ mutant and M. genitalium reference strain G37 and clinical isolate 1019V (37) served as sources of genomic DNA (10). Since both M. genitalium reference strain G37 and clinical isolate 1019V exhibit similar biological properties (52), we used G37 along with M. pneumoniae strain S1 for comparative EF-Tu binding experiments. Mycoplasma culture conditions. M. pneumoniae cells were grown to late log phase in SP-4 medium at 37°C for 72 h in 150-cm2 tissue culture flasks. Adherent mycoplasmas were harvested by being washed three times with phosphate-buffered saline (PBS) (150 mM NaCl, 10 mM sodium phosphate, pH 7.4), scraped, and pelleted at 12,500 ⫻ g for 15 min at 4°C. For radiolabeling, mycoplasmas grown as surface-attached monolayers were washed three times with PBS, scraped, and collected by centrifugation. Cells were resuspended in 1/10 their original volume in Dulbecco’s modified Eagle’s medium without cysteine or methionine and supplemented with 10% fetal bovine serum. [35S]methionine (1 mCi; specific activity, 43.5 TBq/mmol) (Perkin-Elmer Inc., Waltham, MA) was added, and mycoplasmas were incubated at 37°C for 4 h on a rocker, pelleted, and washed four times with PBS. Identification of Fn binding proteins by ligand immunoblot assay. M. pneumoniae and M. genitalium whole-cell lysates were separated in 4 to 12% preparative NuPAGE gels and transferred to nitrocellulose membranes. Membranes were cut into strips, blocked for 1 h at room temperature (RT) with 3% (wt/vol) nonfat dry milk in Tris-buffered saline (TBS) (Blotto), and incubated at 4°C

overnight with human Fn (20 ␮g/ml; Sigma, St. Louis, MO) in Blotto. Individual membrane strips were washed three times with TBST (TBS containing 0.05% Tween 20) and incubated for 2 h at RT with rabbit anti-Fn antibodies (Sigma) at a 1:1,000 dilution in 1% Blotto. Parallel strips of mycoplasma lysates were incubated with rabbit anti-EF-Tu serum (11) diluted 1:2,000 in 3% Blotto for 2 h at RT. Subsequently, blots were washed three times and incubated for 1 h at RT with alkaline phosphatase (AP)-conjugated goat anti-rabbit immunoglobulin G (IgG) antibody (Invitrogen) at a 1:2,000 dilution in 3% Blotto, washed with TBST, and developed with nitroblue tetrazolium chloride–5-bromo-4-chloro-3indolyl phosphate (Roche Diagnostics, Indianapolis, IN). Mycoplasma membrane purification. Mid-log-phase cultures of M. pneumoniae and M. genitalium cells were pelleted and subjected to membrane isolation by osmotic lysis. Membranes were further purified by sucrose gradient centrifugation as previously described (11), and protein concentrations in total and membrane fractions were estimated by the bicinchoninic acid method (Pierce, Rockford, IL). Equal amounts of each fraction were further separated by 4 to 12% NuPAGE gel electrophoresis and transferred to nitrocellulose membranes. Immunoblotting was performed with rabbit anti-EF-Tu (1:2,000) or anti-elongation factor G (EF-G) (1:2,000) serum and goat anti-rabbit–AP (1: 2,000) antibodies. The percentage of membrane-associated EF-Tu was determined as described earlier (11). Immunogold electron microscopy. Immunogold labeling of M. genitalium was performed as described earlier (11). Intact M. genitalium cells were incubated with rabbit anti-EF-Tu or prebleed sera (1:1,000) followed by a 1:20 dilution of goat anti-rabbit IgG–gold particles (20 nm) in PBS (pH 7.4) containing 1% bovine serum albumin. After multiple washes, mycoplasma cells were mounted on Formvar-coated nickel grids and fixed with 1% glutaraldehyde–4% formaldehyde for 20 min at RT. Individual grids were examined by JEOL 1230 transmission electron microscopy at an 80-kV accelerating voltage after being stained with 7% uranyl acetate followed by Reynold’s lead citrate. Site-directed mutagenesis using overlap extension PCR. Amino acid and nucleotide sequences of EF-TuMp and EF-TuMg were subjected to BLAST analysis (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi) (48). Complementary oligodeoxyribonucleotide primers were synthesized with nucleotide changes encoding multiple amino acid substitutions (Table 1) and used in overlap extension PCR (21). pCR2.1 plasmids with EF-TuMp inserts served as templates for amplification of mutagenized EF-Tu constructs. Multiple overlapping DNA fragments with nucleotide changes were generated for each construct by amplification using Pfu Turbo polymerase (Stratagene) and mutagenic primers. These fragments were combined in a subsequent fusion reaction in which the overlapping ends annealed. The resulting product was subjected to a final PCR amplification using Platinum Taq high-fidelity DNA polymerase (Invitrogen), MPN EF-Tu FP forward primer, and specific reverse primers (RP) (Table 1) to generate complete DNA fragments.

VOL. 77, 2009

M. PNEUMONIAE EF-Tu BINDS FIBRONECTIN

TABLE 2. Peptides used in Fn blocking assays Peptide

Amino acid sequencea

Positions of amino acid changes

EF-TuMp 192-219

LMNAVDEWIPTPEREV DKPFLLAIEDT LIKAVDEWIPTPTREVD KPFLLAIEDT GSISLPENTEMVLPG DNTS GSIALAENTEMVLPG DNAS

193M, 194N, 204E

EF-TuMg 192-219 EF-TuMp 340-358 EF-TuMg 340-358

193I, 194K, 204T 343S, 345P, 357T 343A, 345A, 357A

a Amino acid residues that differ in EF-TuMp and EF-TuMg peptides are underlined.

Cloning, expression, and purification of EF-Tu. rEF-TuMp was purified as described previously (3). rEF-TuMg was generated by PCR amplification of DNA from M. genitalium strain G37. All EF-Tu-related fragments were cloned into pCR2.1 and pET-19b vectors as described earlier (3). pET-19b plasmids with inserts were screened by PCR amplification using specific primers (Table 1) and then sequenced. Representative clones containing changes corresponding to the amino acid mutations in the EF-Tu amino and carboxyl regions were selected and transformed into E. coli BL21(DE3) for expression studies. Expression and large-scale purification of rEF-TuMg and mutagenized proteins under native conditions were performed as reported previously (3). All purified proteins were separated in NuPAGE 4 to 12% gradient gels and visualized using Coomassie blue. Immunoblots of parallel gels transferred to membranes were performed with rabbit polyclonal anti-EF-Tu antibodies and mouse anti-His monoclonal antibodies (MAb) (Clontech/BD Biosciences, San Jose, CA) (3). Interactions of EF-Tu with Fn. Interactions between rEF-Tu and Fn were measured by enzyme-linked immunosorbent assay (ELISA) (3). Individual wells of 96-well plates (Reacti-Bind amine binding, maleic anhydride activated; Pierce) were coated overnight at 4°C with 100 ␮l of 100-ng/well Fn in PBS (pH 7.4). After wells were blocked with 200 ␮l of 0.1% BSA (Sigma), increasing concentrations (100 ␮l at 25 nM, 50 nM, 75 nM, and 100 nM in PBS) of recombinant His-tagged proteins were added and incubation continued for 2 h at RT. Individual wells were washed with PBS and incubated with a 1:2,000 dilution of anti-His MAb in PBS followed by a 1:2,000 dilution of goat anti-mouse–AP antibody in PBS. Wells coated with 0.1% BSA alone served as negative controls. All assays were performed in triplicate and developed using p-nitrophenyl phosphate (pNPP) substrate (Sigma). Values were determined by an ELISA reader (Dynatech Laboratories, Chantilly, VA) at 405 nm. Comparisons of Fn binding of different EF-Tu mutagenized constructs were performed as described above, except that a 75 nM concentration was used for Fn binding. Nonmutagenized rEF-TuMp served as a positive control. We also examined all purified proteins for reactivity to anti-His MAb and anti-EF-Tu antibodies. Peptide design and synthesis. Peptides representing amino acid regions 192 to 219 and 340 to 358 in EF-TuMp and EF-TuMg (Table 2) were generated by New England Peptides LLC (Gardner, MA). Their purity was ⬎99%. Peptide inhibition assay. Individual wells of 96-well plates were coated overnight at 4°C with 75 nM rEF-TuMp. Separately, 0.1 ␮g of Fn was added to 100 ␮l PBS contained in Eppendorf tubes in the presence of 75, 375, or 750 nM of each specified EF-Tu-related peptide, and incubation was continued for 2 h at RT. Fn alone (0.1 ␮g/well) or Fn incubated with peptides was then added to the rEFTuMp-coated wells for 2 h at RT. After washes with PBS, the relative quantity of bound Fn was determined using rabbit anti-Fn antibodies (1:2,000) and goat anti-rabbit IgG–AP (1:2,000). All assays were performed in triplicate, and pNPP substrate was used to develop color. The background absorbance values were determined for wells without Fn and subtracted from test values. To further determine the blocking activities of individual peptides on M. pneumoniae cell binding to Fn, ELISA plates were coated with 0.1 ␮g/well Fn and blocked with 0.1% BSA as described earlier. After being blocked, Fn-coated wells were incubated with 75, 375, or 750 nM of each specified peptide for 2 h at RT. Biosynthetically [35S]methionine-labeled M. pneumoniae cells were then added for 1 h at 37°C. After extensive washes with PBS, M. pneumoniae binding to Fn was assessed by radioactivity. Mycoplasma EF-Tu sequence alignment and phylogeny. All available mycoplasma EF-Tu amino acid sequences in the comprehensive microbial resource database (http://cmr.jcvi.org/tigr-scripts/CMR/CmrHomePage.cgi) were subjected to ClustalW2 sequence alignment analysis (http://www.ebi.ac.uk/Tools

3535

/clustalw2/index.html) (8, 33). Evolutionary relationships based on the EF-Tu sequences were also generated in the form of a phylogeny tree by ClustalW2 analysis. Molecular modeling of M. pneumoniae EF-Tu. To further characterize EF-Tu sequence and conformational properties that might influence Fn binding, we searched for the best structural homologs of EF-TuMp by using a variation of protein threading as implemented in the program HHPRED (http://toolkit .tuebingen.mpg.de/hhpred) (45, 46). HHPRED uses pairwise comparisons of profile hidden Markov models (HMMs). First, an alignment of sequence homologs was built for the EF-TuMp query sequence via multiple iterations of PSI-BLAST against the nonredundant sequence database from NCBI. Second, a single EF-TuMp profile HMM was generated from this multiple sequence alignment. This HMM contained a statistical description of the alignment, including secondary structural information. For each column in the multiple sequence alignment that had a residue in the query sequence, an HMM column was created that contained the probabilities of each of the 20 amino acids plus four probabilities that described how often amino acids were inserted and deleted at this position (insert open and extend and delete open and extend). These insert/ delete probabilities were translated into position-specific gap penalties when an HMM was aligned to a sequence or to another HMM (45, 46). The same two steps were also performed for each sequence corresponding to a known structure in the Protein Data Bank (PDB) in order to generate a library of profile HMMs to which the query profile HMM could be compared. Third, the query profile HMM was compared to each profile HMM in the structural database and scored (45, 46). The HHPRED output, which consisted of an alignment of a sequence to be modeled with known related structures, was used as input for the program MODELLER, which automatically calculates a model of the query sequence containing all nonhydrogen atoms by satisfaction of spatial restraints (42).

RESULTS EF-TuMg does not interact with Fn. Parallel ligand immunoblot assays were performed with M. genitalium and M. pneumoniae whole-cell lysates to compare profiles of mycoplasma proteins that bind to human plasma Fn. As reported earlier (11), EF-TuMp (43 kDa) interacted with Fn. Interestingly, no M. genitalium protein in the 43-kDa range bound to Fn (data not shown), suggesting that structural and functional differences exist between EF-TuMp and EF-TuMg. To further confirm this observation, EF-TuMg was expressed and purified as a His-tagged recombinant protein in E. coli. Similar to EF-TuMp, EF-TuMg constitutes 394 amino acids, with a predicted molecular mass of 43.34 kDa; rEF-TuMg resolved around 45 kDa, as predicted with a His tag (Fig. 1A). Both anti-His MAb and polyclonal rabbit anti-EF-TuMp sera recognized rEF-TuMg, similar to rEF-TuMp (see Fig. 4A). To compare Fn binding properties of rEF-TuMp and rEF-TuMg, increasing concentrations (10, 25, 50, 75, and 100 nM) of rEF-Tu proteins were added to immobilized Fn, and Fn interactions were monitored using anti-His-tag antibodies. As expected, rEF-TuMp bound to Fn in a dose-dependent manner (Fig. 1B) (3, 11). In contrast, rEF-TuMg exhibited minimal binding to Fn at all concentrations (Fig. 1B). Surface localization of EF-TuMg. We isolated M. genitalium membranes to determine EF-Tu localization. Membrane fractions were shown to be free of cytoplasmic contamination based upon the absence of EF-G, a protein restricted to the cytosol (Fig. 2A). Immunoblot analysis of mycoplasma cellular fractions with rabbit anti-EF-Tu antibodies revealed ⬃12% of total EF-Tu to be associated with M. genitalium membranes (Fig. 2A). Immunoelectron microscopy of M. genitalium cells further confirmed the surface topography of EF-Tu (Fig. 2B). EF-Tu sequence differences exist between M. genitalium and M. pneumoniae. We compared EF-Tu sequences of M. geni-

3536


INFECT. IMMUN.

FIG. 1. Characterization of Fn binding properties of mycoplasma EF-Tu proteins. (A) Purification of rEF-TuMp and rEF-TuMg. The gene encoding EF-TuMg (MG451) was cloned, expressed, and purified, along with that for EF-TuMp (MPN665), separated in 4 to 12% NuPAGE gels, and stained with Coomassie blue. (B) Interactions of rEF-TuMp and rEF-TuMg with Fn. Individual wells were coated with 0.1 ␮g human Fn and incubated with increasing concentrations of recombinant His-tagged EF-Tu for 2 h at RT. Bound proteins were detected with mouse anti-His MAb (1:3,000) and AP-conjugated goat anti-mouse antibodies (1:2,000), followed by pNPP substrate. Results are expressed as means ⫾ standard deviations. Each sample point is based upon triplicate values. OD 405, optical density at 405 nm.

talium reference strain G37 and clinical isolate 1019V and determined that they were identical (data not shown). In our previous study (11), we compared EF-Tu sequences from M. pneumoniae strains S1 and M129 and an HA⫺ class II mutant

FIG. 2. Localization of EF-TuMg. (A) Membrane association of EF-TuMg. M. genitalium membranes were purified by osmotic lysis and ultracentrifugation (30 to 60% sucrose gradient). Four-microgramsamples of total mycoplasma and membrane proteins were separated by 4 to 12% NuPAGE gel electrophoresis and transferred to nitrocellulose membranes. Immunoblotting was performed with rabbit antiEF-G (1:2,000) and rabbit anti-EF-Tu (1:2,000) antibodies as described in Materials and Methods. (B) Immunogold labeling of EF-Tu on intact M. genitalium cells. Mycoplasmas were incubated with antisera (1:1,000) generated against rEF-TuMp followed by anti-rabbit IgG–gold complex (20 nm). Mycoplasma membrane-associated gold labeling of EF-Tu was readily observed. Prebleed sera demonstrated no background labeling. Bar ⫽ 100 nm.

and found them to be identical. However, since subpopulations of EF-TuMp and EF-TuMg are surface associated but exhibit markedly different Fn binding abilities (Fig. 1), we compared their sequences through amino acid alignment and observed 98% similarity and 96% identity. EF-Tu sequences from M. pneumoniae and M. genitalium differed in 13 amino acids, 10 of which were found within the carboxyl Fn binding region (amino acids 192 to 394) (Fig. 3); the remaining 3 were located within the non-Fn-binding amino-terminal region (amino acids 1 to 192) (Fig. 3) of EF-TuMp. These conserved amino acid variations between EF-TuMg and EF-TuMp are species specific, not strain specific. Expression and purification of mutagenized rEF-TuMp. Based on these amino acid distinctions, we determined which of the amino acid changes in EF-TuMp might result in the loss of its Fn binding ability. As shown in Fig. 3, seven modified rEF-TuMp constructs were generated, among which one construct (QRT-EKS) had substitutions within the non-Fn-binding amino-terminal region (amino acids 1 to 192) and two constructs (QMN-EIK and MNE-IKT) had changes in the Fn binding region 1 of EF-Tu (amino acids 192 to 219). Four constructs were generated with substitutions in the carboxyl region, with three (TS-AT, SPTS-AAAT, and SPT-AAA) (Fig. 3) being specific to Fn binding region 2 (amino acids 314 to 394) (3). All recombinant modified EF-Tu proteins resolved around 45 kDa, similar to unaltered rEF-TuMp and rEF-TuMg proteins, and were recognized by immunoblotting (Fig. 4A) as well as by ELISA with rabbit anti-EF-Tu and mouse anti-His MAb (data not shown). Fn binding properties of mutagenized EF-Tu constructs. ELISAs were performed to determine the Fn binding property of each mutagenized rEF-Tu protein, which was compared to

VOL. 77, 2009


3537

FIG. 3. Schematic representation of amino acid changes between EF-TuMp and EF-TuMg and construction of mutagenized EF-TuMp-derived constructs. EF-TuMp and EF-TuMg differ by 13 amino acids. Amino acid residues that differ between EF-TuMp and EF-TuMg are represented as vertical dotted lines, with their numerical positions indicated. EF-TuMp-derived constructs and their amino acid substitutions are shown as horizontal lines, with vertical lines intercepting positions where they have been modified. Individual constructs are designated with single-letter representations of the amino acid residue changes from EF-TuMp to EF-TuMg, with the positions of these amino acids in parentheses. Fn interacting regions of EF-TuMp, designated Fn binding regions 1 and 2 (amino acids 192 to 219 and 314 to 394, respectively), are represented by gray boxes. Based on these regions, constructs were divided into three categories. The first includes changes in the non-Fn-binding amino-terminal region (QRT-EKS), and the other two categories have changes within the previously identified Fn binding region 1 (QMN-EIK and MNE-IKT) and region 2 (IDTS-VEAT, TS-AT, SPTS-AAAT, and SPT-AAA) (3). The IDTS-VEAT construct has only two of its four amino acid substitutions within Fn binding region 2. Synthetic peptides used for functional Fn blocking studies (Fig. 5) are represented by bold lines with amino acid residue positions in italics.

nonmutagenized rEF-TuMp and rEF-TuMg. Although a range of concentrations were tested, a 75 nM concentration of each recombinant protein was used because this concentration consistently demonstrated maximum binding to Fn (3). The construct with substitutions in the amino-terminal region (QRTEKS) exhibited binding similar to that of rEF-TuMp (Fig. 4B). Also, constructs with modifications within Fn binding region 1

(QMN-EIK and MNE-IKT) did not exhibit reductions in Fn binding under these experimental conditions. In contrast, modifications of amino acids within Fn binding region 2 (IDTSVEAT, TS-AT, SPTS-AAAT, and SPT-AAA) demonstrated significantly reduced Fn binding. More specifically, the SPTSAAAT and SPT-AAA constructs showed the most dramatic reductions (Fig. 4B).

FIG. 4. Site-directed mutagenized constructs and their Fn interactions. (A) Purification of recombinant proteins. All mutagenized proteins were cloned, expressed, and purified under native conditions, separated along with rEF-TuMp and rEF-TuMg by electrophoresis on 4 to 12% Nu-PAGE gels, and stained with Coomassie blue. Immunoreactivities of all modified proteins were tested by blotting with anti-EF-Tu antibodies (1:2,000) and anti-His MAb (1:10,000). (B) Comparison of Fn binding of different EF-Tu mutagenized constructs. Individual wells were coated with 0.1 ␮g/well Fn and incubated sequentially with a 75 nM concentration of recombinant His-tagged EF-Tu protein, anti-His MAb (1:2,000), and goat anti-mouse–AP antibodies (1:2,000), followed by pNPP substrate. Values represent the means for triplicate wells. Based on amino acid sequence distinctions between EF-TuMp and EF-TuMg proteins, constructs were generated as described in the legend to Fig. 3. QRT-EKS represents the construct with amino acid substitutions only in the amino-terminal region. QMN-EIK and MNE-IKT contain substitutions in Fn binding region 1. IDTS-VEAT contains two amino acid substitutions within Fn binding region 2 and two substitutions between regions 1 and 2; TS-AT, SPTS-AAAT, and SPT-AAA contain substitutions only in Fn binding region 2. OD, optical density.

3538


INFECT. IMMUN.

FIG. 5. Fn binding competition between EF-TuMp and EF-TuMg peptides located in Fn binding regions 1 and 2. Competitive assays were performed as described in Materials and Methods. Fn was incubated in the presence or absence of a 75 nM concentration of the indicated peptides for 2 h at RT prior to addition to ELISA wells coated with rEF-TuMp. Binding of Fn to rEF-TuMp in the absence of peptides served as a positive control and was considered 100% binding. The percent inhibition of each peptide was calculated based on the binding percentage.

Peptide inhibition assays. To further confirm the role of the implicated EF-Tu amino acids in Fn recognition, we performed competitive ELISAs with synthetic peptides corresponding to amino acids 192 to 219 (Fn binding region 1) and 340 to 358 (Fn binding region 2) of both EF-TuMp and EFTuMg (Table 2; Fig. 3). As shown in Fig. 5, both EF-TuMp 192-219 and EF-TuMp 340-358 peptides blocked Fn–rEF-TuMp interactions, by 22% and 62%, respectively. The corresponding M. genitalium peptides exhibited a markedly reduced ability to block Fn binding (Fig. 5). EF-TuMp 192-219 and EF-TuMp 340-358 peptides at a 75 nM concentration were also capable of blocking the binding of radiolabeled intact M. pneumoniae cells to Fn, by 20% and 38%, respectively. As expected, the corresponding EF-TuMg peptides did not have an effect (data not shown). Molecular model of EF-TuMp. Table 3 shows the statistics for the five top-scoring hits coming from the HHPRED analysis using the EF-TuMp amino acid sequence to query. EF-Tu from Thermus thermophilus scored highest for the query EF-

FIG. 6. Molecular model of EF-TuMp and its Fn binding residues. The EF-TuMp amino acid sequence was modeled on the structure of EF-Tu from T. thermophilus (PDB code 2c78) (40; see the text). Crystallographic and biochemical studies reveal that EF-Tu is organized into three domains, labeled domains 1, 2, and 3 (31). Domain 1 is shown in green, domain 2 is in purple, and domain 3 is in blue. The regions carrying amino acids 193 to 204 and 343 to 357, which are included within Fn binding regions 1 and 2, respectively, are shown in orange and yellow. Residues in these regions that differ from those in M. genitalium and are believed to participate in Fn binding are shown in ball-and-stick representation.

TuMp sequence and is 69% identical at the amino acid level. Figure 6 presents a molecular model of EF-TuMp, based on the T. thermophilus EF-Tu structure generated by the program MODELLER (42), highlighting the residues involved in Fn binding. Importantly, note that the key EF-Tu amino acids implicated in Fn binding (Fn binding regions 1 and 2) (Fig. 3; Table 2) are surface accessible. While domain 1 catalyzes GTP binding, domains 2 and 3 modulate EF-Tu interactions with macromolecular ligands (7, 30, 31).

TABLE 3. Top-scoring structures that can serve as templates for the EF-TuMp amino acid sequence in the program MODELLER, as identified by the program HHPRED Aligned residues Hit

PDB code (reference)

Protein

% Amino acid identity

Total scorea

Secondary structure score

No. of matched columnsb

1 2 3 4 5

2c78 (40) 1d2e (2) 1jny (53) 1f60 (1) 1zun (36)

Thermus thermophilus EF-Tu Bos taurus EF-Tu Sulfolobus solfataricus EF-Tu Saccharomyces cerevisiae EF-Tu Pseudomonas syringae ATP sulfurylase

69 56 36 32 25

714.7 687.1 672.8 671.0 626.7

39.1 40.0 37.5 37.3 34.3

393 383 376 379 372

a b

The total score column includes the score from the secondary structure comparison. Total number of matched columns in the query-template alignment.

Query HMM

Template HMM

2–394 10–392 9–392 8–394 9–391

1–405 (405) 1–385 (397) 3–427 (435) 3–441 (458) 21–434 (434)

VOL. 77, 2009


DISCUSSION In spite of being nearly identical (96%) to EF-TuMp, EFTuMg does not bind Fn. Since characterization of homologous genes from related organisms provides valuable information on conserved regions important for protein functions and interactions, we utilized this non-Fn-binding property of EFTuMg (Fig. 1B) to identify critical amino acids in EF-TuMp that facilitate Fn recognition. This could lead to important insights about EF-Tu “moonlighting” properties and mycoplasma tissue tropism. Therefore, we characterized EF-TuMg and its possible biological relevance as a surface membrane component by examining its location, using immunoblots of membrane preparations (Fig. 2A) and immunoelectron microscopy (Fig. 2B). It is clear that a subpopulation of EF-TuMg is membrane associated and surface exposed, like EF-TuMp. The unusual phenomenon of surface or membrane association of EF-Tu in microorganisms has been described in our previous publications (3, 11). As we discussed previously (11), a multitude of intrinsic and/or other physiological stress-related factors or posttranslational modifications could signal the translocation of a subpopulation of cytoplasmic EF-Tu to the microbial surface. It is worth noting that EF-Tu exists in multiple isoforms in both M. pneumoniae and M. genitalium (41, 47), suggesting that distinct, modified EF-Tu molecules could exhibit unanticipated biological functions, such as surface placement and Fn binding. While it could be argued that surface association of EF-Tu is due to the lysis of mycoplasma cells, we have consistently demonstrated that fewer than 1% of mycoplasmas are lysed during our experimental procedures (11), which would not account for the percentage of EF-Tu associated with mycoplasma membranes. Furthermore, incubation of M. pneumoniae cells with antibodies generated against rEF-TuMp did not lead to cell lysis, indicating that surface-associated EF-Tu permits advantageous moonlighting properties (3, 11). EF-TuMg differs from EF-TuMp by only 13 amino acids, among which 7 are located within specific regions of EF-TuMp that have already been implicated in Fn interactions (Fig. 3) (3). Based upon these observations, we generated three categories of EF-TuMp-derived constructs, i.e., those with changes in the non-Fn-binding amino-terminal region (amino acids 1 to 192), those with changes in Fn binding region 1 (amino acids 192 to 219), and those with changes in Fn binding region 2 (amino acids 314 to 394) (Fig. 3), and monitored their Fn interactions. Substitutions in the amino-terminal region of EFTuMp did not reduce Fn binding (Fig. 4B), reinforcing our previous report that only the carboxyl regions of EF-TuMp (amino acids 192 to 219 and 314 to 394) mediate Fn interactions (3). Interestingly, full-length constructs with amino acid changes within Fn binding region 1 did not show a reduction in binding, while modifications within Fn binding region 2 (amino acids 314 to 394), especially alanine substitutions at serine 343, proline 345, and threonine 357, markedly reduced Fn binding (Fig. 4B). These findings suggest that the subregion corresponding to amino acids 340 to 358 within Fn binding region 2 is critical for Fn binding. Synthetic peptides that corresponded to Fn binding region 1 (amino acids 192 to 219) and the subregion within Fn binding region 2 (amino acids 340 to 358) reduced rEF-TuMp binding to Fn by 22 and 62%, respectively

3539

(Fig. 5). The latter suggests that amino acids 340 to 358 within Fn binding region 2 contain the primary Fn interacting site. This could also explain why full-length recombinant EF-Tu proteins with substitutions only in Fn binding region 1 still retained Fn binding capacity. A molecular model of EF-TuMp is shown in Fig. 6, highlighting key amino acid residues within Fn binding regions 1 and 2. Consistent with this role, these amino acid residues are found on the surface of the EF-Tu molecule, where they are accessible for interactions with other molecules, such as Fn. Methionine 193, asparagine 194, and glutamic acid 204 are positioned on the exterior of the carboxy-terminal helix of domain 1 and in the linker connecting domains 1 and 2 (31). Serine 343, proline 345, and threonine 357 are positioned in a loop and ␤-strand at one end of the domain 3 ␤-barrel. There is a deep groove at the end of the ␤-barrel which is lined by these residues, which are all alanine in M. genitalium. We speculate that serine 343 and threonine 357 may participate in hydrogen bonding interactions with Fn, and further studies are needed to confirm this hypothesis. In this study, we further extended the EF-Tu-based phylogeny tree among sequenced mollicutes by including M. penetrans, along with M. pneumoniae, M. genitalium, and M. gallisepticum (data not shown). Comparisons of amino acids 340 to 358 of EF-Tu among these closely related mycoplasmas confirmed that serine 343 and proline 345 are unique to EF-TuMp. The other three Mycoplasma species do not have conserved or semiconserved amino acid substitutions at these positions. No protein of EF-Tu’s size (43 kDa) in M. penetrans and M. gallisepticum has been identified to bind Fn (13, 34). These observations reinforce and distinguish the unique functional moonlighting role of EF-TuMp as an Fn binding protein. Also, it appears that different proteins with unique Fn binding motifs exist in other mycoplasma species (13, 34). Many biological and morphological similarities and serological cross-reactivities are shared by M. pneumoniae and M. genitalium (19, 23, 26). However, although the major tip-associated adhesins of M. pneumoniae and M. genitalium exhibit sequence homologies and comparable immunological properties (25, 35), the exact mechanisms by which these pathogenic mycoplasmas are preferentially directed to either the respiratory or urogenital tract are still largely unknown. Differences in their predominant tissue tropisms could likely be determined by distinct adherence mechanisms. In this study, we identified the primary amino acids of EF-TuMp that mediate its interaction with Fn. We further showed that substitutions in these key amino acids dramatically alter its Fn binding properties. Furthermore, we provide evidence that these key amino acids are conformationally accessible to mediate interactions between EF-Tu and Fn. Our findings indicate that EF-Tu binding to Fn can serve as a possible biomarker for distinguishing tissue tropism among closely related pathogens, thus implicating the moonlighting activities of surface-associated metabolic enzymes as contributing factors to pathogen colonization and biological versatility.

ACKNOWLEDGMENTS This project was supported by the National Institute of Allergy and Infectious Diseases (awards U19AI070412 and UI9AI45429 to J.B.B.),

3540


The Kleberg Foundation (to J.B.B.), and The Robert A. Welch Foundation (to P.J.H.). The content of this study is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Allergy and Infectious Diseases or the National Institutes of Health. We thank Rose Garza for her assistance in finalizing the manuscript. REFERENCES 1. Andersen, G. R., L. Pedersen, L. Valente, I. Chatterjee, T. G. Kinzy, M. Kjeldgaard, and J. Nyborg. 2000. Structural basis for nucleotide exchange and competition with tRNA in the yeast elongation factor complex eEF1A: eEF1Balpha. Mol. Cell 6:1261–1266. 2. Andersen, G. R., S. Thirup, L. L. Spremulli, and J. Nyborg. 2000. High resolution crystal structure of bovine mitochondrial EF-Tu in complex with GDP. J. Mol. Biol. 297:421–436. 3. Balasubramanian, S., T. R. Kannan, and J. B. Baseman. 2008. The surfaceexposed carboxyl region of Mycoplasma pneumoniae elongation factor Tu interacts with fibronectin. Infect. Immun. 76:3116–3123. 4. Baseman, J. B. 1993. The cytadhesins of Mycoplasma pneumoniae and Mycoplasma genitalium, vol. 20. Plenum Press, New York, NY. 5. Baseman, J. B., R. M. Cole, D. C. Krause, and D. K. Leith. 1982. Molecular basis for cytadsorption of Mycoplasma pneumoniae. J. Bacteriol. 151:1514– 1522. 6. Baseman, J. B., S. F. Dallo, J. G. Tully, and D. L. Rose. 1988. Isolation and characterization of Mycoplasma genitalium strains from the human respiratory tract. J. Clin. Microbiol. 26:2266–2269. 7. Cetin, R., P. H. Anborgh, R. H. Cool, and A. Parmeggiani. 1998. Functional role of the noncatalytic domains of elongation factor Tu in the interactions with ligands. Biochemistry 37:486–495. 8. Chenna, R., H. Sugawara, T. Koike, R. Lopez, T. J. Gibson, D. G. Higgins, and J. D. Thompson. 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31:3497–3500. 9. Dallo, S. F., and J. B. Baseman. 2000. Intracellular DNA replication and long-term survival of pathogenic mycoplasmas. Microb. Pathog. 29:301–309. 10. Dallo, S. F., A. Chavoya, and J. B. Baseman. 1990. Characterization of the gene for a 30-kilodalton adhesion-related protein of Mycoplasma pneumoniae. Infect. Immun. 58:4163–4165. 11. Dallo, S. F., T. R. Kannan, M. W. Blaylock, and J. B. Baseman. 2002. Elongation factor Tu and E1 beta subunit of pyruvate dehydrogenase complex act as fibronectin binding proteins in Mycoplasma pneumoniae. Mol. Microbiol. 46:1041–1051. 12. Finlay, B. B., and S. Falkow. 1989. Common themes in microbial pathogenicity. Microbiol. Rev. 53:210–230. 13. Giron, J. A., M. Lange, and J. B. Baseman. 1996. Adherence, fibronectin binding, and induction of cytoskeleton reorganization in cultured human cells by Mycoplasma penetrans. Infect. Immun. 64:197–208. 14. Glass, J. I., N. Assad-Garcia, N. Alperovich, S. Yooseph, M. R. Lewis, M. Maruf, C. A. Hutchison III, H. O. Smith, and J. C. Venter. 2006. Essential genes of a minimal bacterium. Proc. Natl. Acad. Sci. USA 103:425–430. 15. Goulet, M., R. Dular, J. G. Tully, G. Billowes, and S. Kasatiya. 1995. Isolation of Mycoplasma pneumoniae from the human urogenital tract. J. Clin. Microbiol. 33:2823–2825. 16. Granato, D., G. E. Bergonzelli, R. D. Pridmore, L. Marvin, M. Rouvet, and I. E. Corthesy-Theulaz. 2004. Cell surface-associated elongation factor Tu mediates the attachment of Lactobacillus johnsonii NCC533 (La1) to human intestinal cells and mucins. Infect. Immun. 72:2160–2169. 17. Hansen, E. J., R. M. Wilson, and J. B. Baseman. 1979. Isolation of mutants of Mycoplasma pneumoniae defective in hemadsorption. Infect. Immun. 23: 903–906. 18. Hansen, E. J., R. M. Wilson, W. A. Clyde, Jr., and J. B. Baseman. 1981. Characterization of hemadsorption-negative mutants of Mycoplasma pneumoniae. Infect. Immun. 32:127–136. 19. Herrmann, R., and B. Reiner. 1998. Mycoplasma pneumoniae and Mycoplasma genitalium: a comparison of two closely related bacterial species. Curr. Opin. Microbiol. 1:572–579. 20. Himmelreich, R., H. Hilbert, H. Plagens, E. Pirkl, B. C. Li, and R. Herrmann. 1996. Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24:4420–4449. 21. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59. 22. Ho ¨o ¨k, M., L. M. Switalski, T. Wadstro¨m, and M. Lindberg. 1989. Interactions of pathogenic microorganisms with fibronectin. In D. E. Mosher (ed.), Fibronectin. Academic Press, Inc., New York, NY. 23. Hu, P. C., U. Schaper, A. M. Collier, W. A. Clyde, Jr., M. Horikawa, Y. S. Huang, and M. F. Barile. 1987. A Mycoplasma genitalium protein resembling the Mycoplasma pneumoniae attachment protein. Infect. Immun. 55:1126– 1131. 24. Inamine, J. M., T. P. Denny, S. Loechel, U. Schaper, C. H. Huang, K. F. Bott,

INFECT. IMMUN.

25.

26.

27.

28.

29.

30. 31. 32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42. 43.

44.

45. 46.

47.

48.

49.

50.

and P. C. Hu. 1988. Nucleotide sequence of the P1 attachment-protein gene of Mycoplasma pneumoniae. Gene 64:217–229. Inamine, J. M., S. Loechel, A. M. Collier, M. F. Barile, and P. C. Hu. 1989. Nucleotide sequence of the MgPa (mgp) operon of Mycoplasma genitalium and comparison to the P1 (mpp) operon of Mycoplasma pneumoniae. Gene 82:259–267. Jacobs, E., T. Watter, H. E. Schaefer, and W. Bredt. 1991. Comparison of host responses after intranasal infection of guinea-pigs with Mycoplasma genitalium or with Mycoplasma pneumoniae. Microb. Pathog. 10:221–229. Jensen, J. S. 2004. Mycoplasma genitalium: the aetiological agent of urethritis and other sexually transmitted diseases. J. Eur. Acad. Dermatol. Venereol. 18:1–11. Kamla, V., B. Henrich, and U. Hadding. 1996. Phylogeny based on elongation factor Tu reflects the phenotypic features of mycoplasmas better than that based on 16S rRNA. Gene 171:83–87. Kannan, T. R., and J. B. Baseman. 2006. ADP-ribosylating and vacuolating cytotoxin of Mycoplasma pneumoniae represents unique virulence determinant among bacterial pathogens. Proc. Natl. Acad. Sci. USA 103:6724–6729. Krab, I. M., and A. Parmeggiani. 2002. Mechanisms of EF-Tu, a pioneer GTPase. Prog. Nucleic Acid Res. Mol. Biol. 71:513–551. Krab, I. M., and A. Parmeggiani. 1998. EF-Tu, a GTPase odyssey. Biochim. Biophys. Acta 1443:1–22. Kunert, A., J. Losse, C. Gruszin, M. Huhn, K. Kaendler, S. Mikkat, D. Volke, R. Hoffmann, T. S. Jokiranta, H. Seeberger, U. Moellmann, J. Hellwage, and P. F. Zipfel. 2007. Immune evasion of the human pathogen Pseudomonas aeruginosa: elongation factor Tuf is a factor H and plasminogen binding protein. J. Immunol. 179:2979–2988. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson, and D. G. Higgins. 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23:2847–2948. May, M., L. Papazisi, T. S. Gorton, and S. J. Geary. 2006. Identification of fibronectin-binding proteins in Mycoplasma gallisepticum strain R. Infect. Immun. 74:1777–1785. Morrison-Plummer, J., A. Lazzell, and J. B. Baseman. 1987. Shared epitopes between Mycoplasma pneumoniae major adhesin protein P1 and a 140kilodalton protein of Mycoplasma genitalium. Infect. Immun. 55:49–56. Mougous, J. D., D. H. Lee, S. C. Hubbard, M. W. Schelle, D. J. Vocadlo, J. M. Berger, and C. R. Bertozzi. 2006. Molecular basis for G protein control of the prokaryotic ATP sulfurylase. Mol. Cell 21:109–122. Musatovova, O., C. Herrera, and J. B. Baseman. 2006. Proximal region of the gene encoding cytadherence-related protein permits molecular typing of Mycoplasma genitalium clinical strains by PCR-restriction fragment length polymorphism. J. Clin. Microbiol. 44:598–603. Mushegian, A. R., and E. V. Koonin. 1996. A minimal gene set for cellular life derived by comparison of complete bacterial genomes. Proc. Natl. Acad. Sci. USA 93:10268–10273. Ouaissi, M. A., D. Afchain, A. Capron, and J. A. Grimaud. 1984. Fibronectin receptors on Trypanosoma cruzi trypomastigotes and their biological function. Nature 308:380–382. Parmeggiani, A., I. M. Krab, S. Okamura, R. C. Nielsen, J. Nyborg, and P. Nissen. 2006. Structural basis of the action of pulvomycin and GE2270 A on elongation factor Tu. Biochemistry 45:6846–6857. Regula, J. T., B. Ueberle, G. Boguth, A. Gorg, M. Schnolzer, R. Herrmann, and R. Frank. 2000. Towards a two-dimensional proteome map of Mycoplasma pneumoniae. Electrophoresis 21:3765–3780. Sali, A., and T. L. Blundell. 1993. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234:779–815. Schaumburg, J., O. Diekmann, P. Hagendorff, S. Bergmann, M. Rohde, S. Hammerschmidt, L. Jansch, J. Wehland, and U. Karst. 2004. The cell wall subproteome of Listeria monocytogenes. Proteomics 4:2991–3006. Skerl, K. G., R. A. Calderone, E. Segal, T. Sreevalsan, and W. M. Scheld. 1984. In vitro binding of Candida albicans yeast cells to human fibronectin. Can. J. Microbiol. 30:221–227. So ¨ding, J. 2005. Protein homology detection by HMM-HMM comparison. Bioinformatics 21:951–960. So ¨ding, J., A. Biegert, and A. N. Lupas. 2005. The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Res. 33:W244–W248. Su, H. C., C. A. Hutchison III, and M. C. Giddings. 2007. Mapping phosphoproteins in Mycoplasma genitalium and Mycoplasma pneumoniae. BMC Microbiol. 7:63. Tatusova, T. A., and T. L. Madden. 1999. BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174: 247–250. Thomas, D. D., J. B. Baseman, and J. F. Alderete. 1985. Fibronectin mediates Treponema pallidum cytadherence through recognition of fibronectin cell-binding domain. J. Exp. Med. 161:514–525. Tully, J. G., D. L. Rose, J. B. Baseman, S. F. Dallo, A. L. Lazzell, and C. P. Davis. 1995. Mycoplasma pneumoniae and Mycoplasma genitalium mixture in synovial fluid isolate. J. Clin. Microbiol. 33:1851–1855.

VOL. 77, 2009 51. Tully, J. G., D. Taylor-Robinson, R. M. Cole, and D. L. Rose. 1981. A newly discovered mycoplasma in the human urogenital tract. Lancet 13:1288–1291. 52. Ueno, P. M., J. Timenetsky, V. E. Centonze, J. J. Wewer, M. Cagle, M. A. Stein, M. Krishnan, and J. B. Baseman. 2008. Interaction of Mycoplasma genitalium with host cells: evidence for nuclear localization. Microbiology 154:3033–3041. 53. Vitagliano, L., M. Masullo, F. Sica, A. Zagari, and V. Bocchini. 2001. The crystal structure of Sulfolobus solfataricus elongation factor 1alpha in complex with GDP reveals novel features in nucleotide binding and exchange. EMBO J. 20:5305–5311.

Editor: S. R. Blanke


3541

54. Waites, K. B., and D. F. Talkington. 2004. Mycoplasma pneumoniae and its role as a human pathogen. Clin. Microbiol. Rev. 17:697–728. 55. Wyler, D. J., J. P. Sypek, and J. A. McDonald. 1985. In vitro parasitemonocyte interactions in human leishmaniasis: possible role of fibronectin in parasite attachment. Infect. Immun. 49:305–311. 56. Yamada, K. M., L. H. Hahn, and K. Olden. 1980. Structure and function of the fibronectins. Prog. Clin. Biol. Res. 41:797–819. 57. Yavlovich, A., M. Tarshis, and S. Rottem. 2004. Internalization and intracellular survival of Mycoplasma pneumoniae by nonphagocytic cells. FEMS Microbiol. Lett. 233:241–246.