An endosymbiont Piriformospora indica reduces ...

Environmental and Experimental Botany 153 (2018) 89–99

Contents lists available at ScienceDirect

Environmental and Experimental Botany journal homepage: www.elsevier.com/locate/envexpbot

An endosymbiont Piriformospora indica reduces adverse effects of salinity by regulating cation transporter genes, phytohormones, and antioxidants in Brassica campestris ssp. Chinensis

T

Muhammad Khalida, Danial Hassania, Jianli Liaoa, Xin Xionga, Muhammad Bilalb, ⁎ Danfeng Huanga, a b

School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai, 200240, China State Key Laboratory of Microbial Metabolism, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Brassica campestris ssp. Chinensis Piriformospora indica Symbiotic colonization Enzyme activities Salt tolerance Gene expression

Pakchoi (Brassica campestris ssp. chinensis) is one of the most popular leafy vegetables, whose production is negatively affected by high NaCl concentration in the soil. In this study, the role of endosymbiont Piriformospora indica in counteracting salinity stress to Pakchoi plants was determined by studying physiological, biochemical, and molecular mechanisms. The physiological markers such as antioxidant enzymes, malondialdehyde (MDA), abscisic acid (ABA), salicylic acid (SA), ion analysis and electrolyte leakage as well as chlorophyll content were measured in pakchoi under two NaCl concentrations (100 and 200 mM) in inoculated and un-inoculated plants. In addition, the expression level of some well-known genes involved in Na+/K+ homeostasis was also elucidated in different plant tissues. P. indica co-cultivation significantly increased biomass of Pakchoi as well as antioxidant enzymes such as superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and augmented the level of Plant hormones (salicylic acid (SA)) and gibberellic acid (GA), assisting the plants to cope salinity stress. The salt tolerance mechanism of the experimental plant was studied at the cellular level by quantifying the gene expression level of salt overly sensitive (SOS) signaling pathway including, SOS1 and SOS2 as well as NHX-type Na+/H+ antiporter (NHX1) from the shoot and root samples. The gene expression analysis showed the higher expression level of the candidate genes in inoculated plants under the given salt concentration. In conclusion, the findings suggest that the symbiotic association of endosymbiont P. indica can help the plants to overcome the salinity stress.

1. Introduction Pakchoi (Brassica campestris ssp. Chinensis) is a leafy vegetable which has been widely cultivated and consumed worldwide due to its low calorific value, a large supply of macro and micronutrients, beneficial phytochemicals and fibers. However, its production is negatively affected in some regions by high salt (NaCl) concentration in soil (Harbaum et al., 2007). High salt concentration in soil is a major abiotic stress limiting the agriculture production in arid and semi-arid regions. Excessive ions accumulation in the soil cause injury to plant roots followed by disrupting several morphological, biochemical and physiological processes at cellular levels (Zeinalov and Maslenkova, 1999). Salinity is responsible for both hyperosmotic stresses which cause stomatal closure as well as the inhibition of leaf expansion and hyperionic stress that involves the building-up of ions in the shoot to toxic concentrations leading to stunted growth and reduced yield. High Na+ ⁎

Corresponding author. E-mail address: [email protected] (D. Huang).

https://doi.org/10.1016/j.envexpbot.2018.05.007 Received 13 April 2018; Received in revised form 2 May 2018; Accepted 8 May 2018 Available online 15 May 2018 0098-8472/ © 2018 Elsevier B.V. All rights reserved.

concentration alters the complete structure of soil by decreasing the soil porosity as well as the conductance of water and soil aeration leading to a reduction in soil water potential and hindering the mineral nutrient uptake (Porcel et al., 2012). Under normal conditions, plants contain between 60 and 100 mM of K+ and 1 to 10 mM of Na+ in their cytosol (Bassil et al., 2012). Excess of specific ions such as sodium and chloride imbalance the cytosolic Na+/K+ ratio, resulting in disruption of plants enzymes structure (Chen et al., 2007; Shabala and Cuin, 2008). Consequently, several biological functions such as respiration, and photosynthesis, as well as cellular organelles, are altered (Munns and Tester, 2008; Ruiz-Lozano et al., 2012). Higher concentration of salts in the soil will also lead to oxidative stress through the production of reactive oxygen species (ROS), which disrupt the normal function of cellular components such as proteins, lipids and nucleic acids (Ahmad, 2010; Ahmad et al., 2010; Ahmad et al., 2008). Evolutionary traits in plants have arisen several defense


M. Khalid et al.

including heavy metal toxicity, low temperature, salinity as well as biotic stresses (Oelmüller et al., 2009). Recently, salinity stress alleviating effect of P.indica has been reported in many host plants (Baltruschat et al., 2008; Jogawat et al., 2013; Sharma et al., 2017).The results from our former study (Published data) had also confirmed that P.indica can successfully colonize the roots of Pakchoi and enhance the synthesis of beneficial phytochemicals such as flavonoids and antioxidants (Khalid et al., 2017b). The present study extends our previous observations and intends to elucidate whether P.indica symbiosis, affects morphological and biochemical attributes, Na+ and K+ uptake, distribution and compartmentation within the plant tissues under salt stress. These data should also shed further light on the mechanisms involved in the enhanced salt tolerance in P.indica co-cultivated Brassica campestris ssp. Chinensis (Brassicaceae) as an economically important plant in china.

mechanisms at morphological, physiological and molecular level to counter low water potential and NaCl toxicity (Munns and Tester, 2008). The production of several constituents in plants such as glycine betaine, proline, sugar alcohols and soluble sugars are categorized as an effective physiological response which contributes to osmotic adjustment under stress conditions (Ahmad et al., 2014; Ahmad et al., 2011; Sánchez et al., 1998). Further, the concerted action of both enzymatic antioxidants such as catalase (CAT), superoxide dismutase (SOD), glutathione reductase (GR) as well as non-enzymatic antioxidants including tocopherols, phenols, ascorbic acid and thiols accompanied by phytohormones and secondary metabolites can also facilitate the plants in salt mitigation and developing salt-resistance (Hashem et al., 2015; Rasool et al., 2013). At molecular level, plants have evolved several genetic mechanisms which help them either by restriction of Na+ entry to plant via selective ion uptake or maximizing the efflux of Na+ back to the apoplastic spaces or to the growth medium. In either of these cases, plants would be able to sequester the internal Na+ to vacuoles and hinder its transmission to photosynthetic tissues (Cuin et al., 2011; Shi and Zhu, 2002; Zhu, 2003). The mechanism of sodium uptake restriction and its reverse transmission to the root is regulated with series of regulatory proteins which are synthesized via several pathways (Zhu et al., 1998). Salt overly sensitive (SOS) signaling pathway involves genes which are proposed to be Na+/H+ anti-porters, participating in the Na+ efflux to the apoplastic or exterior space. The higher expression of these genes in tissues surrounding xylem vessels suggests their Na+ redistributor role between roots and shoots (Olias et al., 2009; Shi et al., 2002). Previous studies reported the SOS pathway mediated ion homeostasis in Arabidopsis which is directed by three main proteins of this pathway including SOS1, SOS2, and NHX1 (Shi et al., 2000; Shi et al., 2002). Former reports of mutant lines of SOS family (SOS1, 2 and 3) genes have also suggested the hypersensitivity to NaCl (Wu et al., 1996). SOS1 is one of the major genes, which participates in SOS pathway and plays a crucial role in the translation of a plasma membrane Na +/H+ antiporter protein, discharging sodium as well as the regulation of its translocation from root to shoots (Shi et al., 2000; Shi et al., 2002). The SOS2 is a Ser/Thr protein kinase which participates in phosphorylation and activation of SOS1 (Qiu et al., 2002). The complex of SOS genes is involved in the inhibition of Na+ to reach photosynthetic tissues and thus play an important role in the reallocation of Na+ from root to shoot (Ji et al., 2013; Liu et al., 2000; Munns, 2005). The results from co-expression of these candidate genes in yeast cells have proven the more successful salt tolerance compared to expression of one or two SOS proteins (Quintero et al., 2002). The other protein which is participating in SOS pathway is NHX which is a Na+/H+ antiporter system and involved in sequestration of Na+ to the vacuole inside plants cell (Munns, 2005). Previous investigations confirmed that the cation transporters such as NHX, SOS1, SOS2 are candidate proteins which regulate Na+ in plant tissues and indirectly play a key role for K+ homeostasis (Asins et al., 2013). Overexpression of NHX1 has been reported to improve salt tolerance in Arabidopsis thaliana (Apse et al., 1999), Brassica napus (Zhang et al., 2001), tomato (Hong-Xia and Blumwald, 2001), rice (Ohta et al., 2002), cotton (He et al., 2005) and wheat (Xue et al., 2004). Beside intrinsic morpho-physiological and molecular protective systems, mutualistic symbiosis with endophytic or mycorrhizal fungi can confer salt tolerance in plants and promotes the overall yield of the crops (Rodriguez et al., 2004). Beneficial fungi are a suitable alternative to pyramid strategy and developing the salt-tolerant plants (Dodd and Pérez-Alfocea, 2012). Piriformospora indica (basidiomycete) is a filamentous axenically cultivable fungus, which can colonize the roots of a wide range of plants (monocot and eudicot) providing multifaceted amenities such as stress tolerance, nutrient uptake, disease resistance and growth-promotion (Unnikumar et al., 2013). Apart from growth promotion, it also increases tolerance to a number of abiotic stresses

2. Material and methods 2.1. Piriformospora indica culture and plant growth Periformospora indica (CBS 125645) was procured from “Fungal Biodiversity Centre, Institute of the Royal Netherland Academy of Arts and Sciences (KNAW)” and grown in Petri dishes with kaefer medium in a growth chamber at 25 °C. Uniform colonies of P. indica were subcultured in 500-ml Erlenmeyer flasks containing liquid kaefer medium at room temperature for 15 days at 50 rpm. The pots (top diameter 14 cm, bottom diameter 10 cm, height 12 cm) were wiped with ethanol and filled with 700 g of the autoclaved soil of known composition (pH 7.32, EC (dS/m) 0.14, Avail. N (ppm) 111.6, Avail. P (ppm) 181.7, Avail. K (ppm) 181.7, CEC (cmol(+)/kg) 306.8, NH4+ (ppm) 7.86, NO3− (ppm) 2.67, Total C (%) 1.92, Total N (%),0.19, Total K (ppm) 2063) and sand (autoclaved) in a ratio 3:1 (w/w). A previously described method (sandwich layer model) was followed to inoculate the soil in each pot according to the treatment design (Sahay and Varma, 1999; Varma and Schuepp, 1994). Pakchoi seeds were surface sterilized following the method as described earlier (Khalid et al., 2017a) and grown in Petri plates having wet filter paper. Three days after germination, half of the germinated seeds were shifted to P. indica inoculated pots and the other half was transferred to un-inoculated pots (3 plants/ pot). Each treatment contained 12 pots as replicates. Pots were placed randomly in greenhouse at a temperature regulated to around 22 °C at night and 26 °C during the day. Average relative humidity varies from 60 to 65% during day and night with natural light intensity and photoperiod. 2.2. Treatments Water was supplied every alternate day to avoid any drought effect. Seedlings were allowed to grow for 30 days to establish symbiosis with fungi. At the end of the 30th day, three different concentration of NaCl (0, 100 and 200 mM NaCl) for both inoculated and un-inoculated experimental plants (50 ml/Pot, four times per week) were applied for three weeks. 2.3. Parameters measured 2.3.1. Biomass production Plants were harvested after 52 days to perform morphological, physiological and molecular analyses. Morphological indices such as leaf number, leaf area, and fresh weight were measured manually at harvest, whereas the dry weight was determined after oven-drying at 75 °C for 72 h. 2.3.2. Root colonization assay Root colonization was assayed using the Typhan blue staining kit (Sangon Biotech Shanghai Co., Ltd.) as described earlier with slight 90


M. Khalid et al.

(−20 °C) in 5 ml extraction mixture water/methanol/formic acid (4/ 15/1, v/v, pH 2.5). The samples were centrifuged at 11430g for 15 min and supernatants were passed through an Sep-Pak plus C18 cartridge to remove interfering plant pigments and lipids. The samples were evaporated to remove organic solvent, re-dissolved in 5 ml of 1 M formic acid and applied to Ultra-performance liquid chromatography machine (ACQUITY UPLC) (Waters, Milford, MA, USA) coupled with a triple quadrupole mass spectrometer (SCIEX Selex ION Triple Quad™ 5500 System) (Applied Biosystems, AB SCIEX, Foster City, CA, USA) (UPLC3QMS). A UPLC BEH-C18 column (1.7 μm particle size, 2.1 9 × 100 mm i.d.) from (Milford, MA, USA) was used for separation at ambient temperature using (eluent A) 0.1/100 ml formic acid in water and (eluent B) 0.1/100 ml formic acid in CAN as the mobile phase at a constant flow rate of 0.4 ml min−1. Following was the gradient profile: time = 0 min: 90% A; 1 min: 50% A; 3.5 min: 0% A; 5 min: 0% A; 5.5 min: 90% A and for 7 min: 90% A to elute the derivatives, while 3 μl was the injection volume.Positive ion mode was functioned in the electron spray ionization (ESI) source, and its main working parameters were as follows: ion spray voltage, 5500; V curtain gas, 241,325 pa; collision gas, 55,160 pa; both GS1 (Nebulizer Gas) and GS2 (Heater Gas), 344,750 pa; and 500 °C was probe temperature. Entrance potential (EP), declustering potential (DP), collision energy (CE) and collision cell exit potential (CXP) values were used to carry out the selected reaction monitoring (SRM).

modifications (Dickson and Smith, 1998; Phillips and Hayman, 1970). The colonization percentage was determined by grid intersection method. Differentiated spores, arbuscule, vesicles, and hyphae were considered as the indicator of presence or absence of colonization. 2.3.3. Total chlorophyll assessment Total chlorophyll content in leaves was measured as reported previously (Hiscox and Israelstam, 1979). Dimethyl sulfoxide (DMSO) was used as a reference and optical density was determined spectrophotometrically (Unico Instrument Co., Ltd, UV-2102Ck, Shanghai China) at 645 and 663. 2.3.4. Leaf relative water content and electrolyte leakage Leaf relative water content (LRWC) was determined according to (Smart and Bingham, 1974). Fresh leaves were collected and immediately weighed (fresh mass, FM). In order to determine the turgid mass (TM), leaves were shifted to Petri dishes containing distilled water. After imbibition period, leaves were gently wiped with tissue paper and weighed periodically. Following the turgid mass determination, leaves were oven dried at 85 °C overnight and reweighed, in order to obtain dry mass (DM). All the mass measurements were made at a precision of 0.0001 g. Values of FM, TM and DM were used to calculate leaf RWC using the relation given in Eq. (1). LRWC (%) = FM − DM ÷ TM − DM

(1) 2.7. Mineral nutrients determination

For electrolyte leakage measurement, leaves (9 leaves, 1 leaf/pot) from the same position were used for each treatment as described earlier (Lutts et al., 1996). Leaf samples were washed with deionized water to remove any adhered surface electrolytes and placed in deionized water (15 ml) in closed vials. The vials were incubated at 25 °C on a rotary shaker for 24 h. The electrical conductivity of the solution (Lt) was measured at the completion of the incubation period, whereas the last electrical conductivity (L0) was determined after autoclaving the samples at 120 °C for 20 min. The electrolyte leakage was defined as follows:

Ions (P, K+, and Na+) were extracted from 0.2 g of dry leaves and roots. Acid digestion was carried out by mixing samples with 4 ml HNO3 + 1 ml HCLO4 (having concentration 97.2% and 70%) and heated to 220 °C for 20 min. The resulting mixture was extracted with 5 ml HNO3 and adjusted to the final volume of 250 ml of distilled water. The ions content (P, K+, and Na+) in samples were analyzed by inductively coupled plasma spectrometry (ICP, ThermoFisher, ICAP7600, USA). The unit of element contents was expressed as μmol/g FW. From each treatment, six different plants were used as replicates. Analyses were carried out by the Instrumental Analytical Center of Shanghai Jiao Tong University, Shanghai China.

Electrolyte leakage (%) = (Lt ÷ L0) × 100.

2.4. Efficiency of photosystem II

2.8. Total RNA extraction and cDNA synthesis

For the determination of photosynthetic performance, a non-invasive method was followed (Oxborough and Baker, 1997) using the Fluor Pen FP100 (Photon Systems Instruments, Brno, Czech Republic) by measuring chl a fluorescence. Photosystem II quantum yield was calculated as the ratio between fluorescence yield in the light-adapted state (FV′) and maximum fluorescence yield in the light-adapted state (FM′) by taking five plants for each treatment.

Fresh leaf samples were collected to extract total RNA using the kit (TaKaRa plant Mini kit) following the manufacture instructions. A Nanodrop-2000 spectrophotometer (Thermo Scientific, USA) was used to measure the concentration of extracted RNA, while agarose gel electrophoresis confirmed the quality of RNA. The samples were subjected to DNase treatment (TaKaRa, Japan) to remove any genomic DNA. cDNA was synthesized by reverse transcription of the extracted RNA, using the kit (TaKaRa Reverse Transcription) following the manufacturer instructions.

2.5. Antioxidant enzyme assay and malondialdehyde (MDA) estimation The free radical scavenging activity by the superoxide dismutase (SOD) was assayed using the kit (SOD-A001-1 by Nanjing Jiancheng Biotechnology Institute) spectrophotometrically at 550 nm. Activities of CAT and POD were also assayed using the kit (CAT-A007-1, POD-A0843 by Nanjing Jiancheng Biotechnology Institute) spectrophotometrically at 405 and 420, respectively. The Thiobarbituric acid (TBA) protocol (Bao et al., 2009) was used to extract oxidative stress biomarker malondialdehyde (MDA) and measured spectrophotometrically at 450, 532, and 600 nm.

2.9. Quantitative real-time PCR analysis The gene expression analysis of three candidate genes (SOS1, SOS2, and NHX3) from Pakchoi was carried out by quantitative real-time PCR (qRT-PCR) using a Light Cycler® real-time PCR system (96 version 1.1.0-.1320, Roche Diagnostics international Ltd.) with SYBR® Premix Ex Taq™(TaKaRa, Japan). The three sets of primers were designed (Table 1) by online Primer Design tool (https://www.genscript.com/ ssl-bin/app/primer) to amplify each gene. Six genes were nominated and verified to be used as the internal control (Table 2), evidenced in the relevant studies [22]. The gene expression was carried by Quantitative reverse transcription (qRT)-PCR in three independent experimental repeats using a 20 μl total volume, where at least 3 samples were considered for each experimental repeat. The amplification and assembly of the reaction mixture were carried out following the earlier

2.6. Determination of phytohormones by UPLC-3QMS To analyze abscisic acid (ABA) and salicylic acid (SA), samples were prepared as described earlier (Ghanem et al., 2008). Fresh leaf sample (1 g) was homogenized with liquid nitrogen, and incubated overnight 91


M. Khalid et al.

Table 1 List of the candidate genes primers for qPCR analysis. Gene ID

Forward primer (from 5′ to 3′)

Reverse primer (from 5′ to 3′)

Accession number

Gene function

Annealing Temp. (°C)

SOS1a

TTCTCAAACTCCTGCGTCCT

AACCGACGCTGTTGTAATCG

HQ848287.1

56

SOS1b SOS1c* SOS2a*

ACAGTGTGGAGACAAGAGCA TGTACCATCTCCTGCTGCAT AGGCTGTTGCAACCTCAATG

TTGACCCAATTGGCGATGAC CCAAATGCTCCGGTGTTGAA AATCCCTCGAGCCTTGTCTT

HQ848287.1 HQ848287.1 HQ848291.1

SOS2b SOS2c NHX1a

TGTCCACAGTGGTTCTCTGA TTGTTTCTCGAAGGGAGCCT CCAAATCCATCCCGATCCCT

CTGCACGGACATCATCCAAA GCGCGTATGAGCCCTAAAC TAGTGGGCCGTGTCAAGAAT

HQ848291.1 HQ848291.1 HQ848294.1

NHX1b NHX1c*

TTGTCGTTTCTTGCGGAGAC GAACATCAGTGGCAGTGAGC

GCTCACTGCCACTGATGTTC CTCATGAGACCAGACCACCA

HQ848294.1 HQ848294.1

Plasma membrane Na+/H+ antiporter. Na+ efflux to the growth medium or apoplastic spaces. Na+ redistribution between roots and shoots. Same as above. Same as above. Encodes a serine/threonine type protein kinase, which activates SOS1. Same as above. Same as above. Vacuolar (Na+, K + )/H+ antiporter. Na+ sequestration into vacuoles. Same as above. Same as above.

56 56 56 56 56 56 56 56

The selected pairs of primers have been bolded and labeled with *.

described method (Hassani et al., 2015). The best gene-specific primers and internal control for qRT-PCR were selected based on their electrophoresis profiling (Fig. 1). The relative expression level of the selected genes was assessed following the 2–ΔΔCT method (Livak and Schmittgen, 2001). 2.10. Statistical analysis of data All the analytic determinations were carried out at least in three times, and results are expressed as mean ± SD of triplicate samples. Data were statistically analyzed by one-way analysis of variance (ANOVA), followed by Duncan’s multiple range (DMR) tests (SPSS Inc., Chicago, IL, USA). Differences were denoted statistically significant at P < 0.05. Fig. 1. Electrophoresis profile of the cation transporter candidate genes. Salt overly sensitive (SOS1, 2), NHX-type Na+/H+ antiporter (NHX1). Actin as the housekeeping gene

3. Results 3.1. P. indica promoted B. campestris ssp. chinensis growth

any mycorrhizal structures in their primary and secondary roots, while P. indica and its extent of colonization was prominently detectable in the form of mycelia and a high number of piriform shaped chlamydospores were observed in all the plants which had received a P. indica treatment. Thus staining technique evidenced the root colonization by P. indica and its percentage among the given treatments has been illustrated in Fig. 2.

P. indica improved the biomass of Pakchoi both under non-saline (0 mM NaCl) and saline conditions (i.e., 100 and 200 mM NaCl). Fresh weight was increased by 16% at 0 mM NaCl, as compared to uninoculated control plants (S1 Fig). The fresh weight was enhanced by 36.19% and 30.39%, under salinity stress (100 nm and 200 nm NaCl) compared to un-inoculated stressed plants (Table 3). The leaf numbers were found to increase by 26.38% in inoculated plants which were not subjected to salinity stress. However, a significant improvement in leaf numbers was recorded (24.08% and 30.39%) for both 100 mM and 200 mM NaCl in inoculated plants. Dry weight measurement results showed an elevation in inoculated plants under non-saline and high salinity stress compared to un-inoculated stressed plants (Table 3).

3.3. P. indica increased leaf area and chlorophyll content P. indica elevated the leaf growth and chlorophyll content under non-saline conditions and reduced the adverse effects of salinity on these parameters under saline stressed conditions in relation to control plants (Table 3). A 1.08-fold increase in leaf area was recorded under non-saline conditions compared to corresponding un-inoculated control plants. P. indica increased the leaf area by 1.20 and 1.24-folds with 100 and 200 mM NaCl treatments, respectively.

3.2. P. indica root colonization/symbiotic development assay Plant roots (inoculated and un-inoculated) were assayed under a microscope by staining technique. Un-inoculated roots did not show Table 2 List of candidate housekeeping genes primers. Gene ID

Forward primer

Reverse primer

Ubiquitin NADS SAND Actin* Eft-a GAPDH

TCTGAGGCTTCGTGGTGGTA GATGCTTCTTGGGGCTTCTTGTT CAACATCCTTTACCCATTGACAGA AACCCGAAAGCTAACAGGGA GAACTGGGTGCTTGATAGGC TTCTCGTTGAGGGCTATTCCA

AGGCGTGCATAACATTTGCG CTCCAGTCACCAACATTGGCATAA GCATTTGATCCACTTGCAGATAAG AGGATAGCGTGAGGAAGAGC AACCAAAATATCCGGAGTAAAAGA CCACAGACTTCATCGGTGACA

*The selected primer has been bolded. 92


M. Khalid et al.

Table 3 Effects of NaCl on morphological attributes in Pakchoi plants inoculated with the fungus Piriformospora indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Treatment 0 mM NaCl P. indica Un-inoculated 100 mM NaCl P. indica Un-inoculated 200 mM NaCl P. indica Un-inoculated

Leaf number/plant

FW (g plant−1)

DW (g plant−1)

Leaf area (cm)

16 ± 2a 12.6 ± 1.5bc

19.5 ± 2.5a 16.8 ± 1.2b

1.05 ± 0.12a 0.74 ± 0.13b

19.6 ± 2.6a 18.4 ± 1.1ab

15.4 ± 0.57a 12.3 ± 0.47bc

14.3 ± 1.3bc 10.5 ± 0.8d

0.78 ± 0.15b 0.59 ± 0.14bc

16.9 ± 0.7bc 14.4 ± 0.4bc

13.3 ± 0.67b 11.4 ± 0.56c

13.3 ± 2c 10.2 ± 0.7d

0.78 ± 0.06b 0.49 ± 0.05c

13.7 ± 0.9c 11.003 ± 0.8d

FW—fresh weight; DW—dry weight; Within each column, means followed by the same letter do not differ significantly at P < 0.05 by Duncan’s test.

The salt levels applied reduced the chlorophyll content under all conditions, but P. indica inoculated plants exhibited comparatively higher chlorophyll content (Fig. 3). Thus a 1.1-fold enhancement was observed under non-saline conditions; comparatively to the un-inoculated control plants. P. indica also increased the foliar chlorophyll content by 1.3 and 1.7-folds with 100 and 200 mM NaCl treatments, respectively. 3.4. Electrolyte leakage, relative water content, and efficiency of photosystem II P. indica decreased the electrolyte leakage by 50% and 26% in comparison to un-inoculated plants under 100 and 200 mM NaCl treatments, respectively. Relative water content was observed higher with P. indica than the un-inoculated plants at whatever salt level assessed. A 28.54%, and 34.67% increase in relative water content was observed at 100 and 200 mM NaCl level as compared to un-inoculated salt-stressed plants, respectively (Table 4). The salt levels applied reduced the efficiency of photosystem II in un-inoculated plants at 200 mM NaCl. However, P. indica inoculation imparted a significant increase (P > 0.05) in the efficiency of photosystem II than the un-inoculated counterparts at whatever salinity level assessed (Table 4).

Fig. 3. Total chlorophyll content. Pakchoi plants were inoculated with beneficial fungus P. indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of five replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test.

salt levels assayed. However, similar effects were observed for POD activity in P. indica co-inoculated plants (Fig. 4).

3.5. P. indica improved the enzymatic activity under saline conditions

3.6. P. indica reduced leaf MDA content under saline conditions

The antioxidant enzyme activities of catalase (CAT), superoxide dismutase (SOD) and peroxidase (POD) were assayed after exposure of plants to given concentrations of salt and the results are depicted in Fig. 4A–C. The level of SOD and CAT were increased steadily with increasing salinity but their activities were considerably higher in inoculated plants compared to the control plants (un-inoculated). In contrast to SOD and CAT, the POD activity was not affected at the two

The inoculation of P. indica exponentially decreased the MDA content under saline conditions (Fig. 4D). However, no change was observed under non-saline condition over the control. P. indica prominently reduced the leaf MDA content by 52% and 57% at 100 and 200 mM NaCl concentration respectively, over the control. Thus, P. indica application favorably regulated the integrity of the cell membrane as represented by the biomarker, cell MDA content and oxidative

Fig. 2. Colonization of P. indica in roots of Pakchoi plants A) Control, B) Chlamydospores inside the root cells, C) Plant root infection rate by P. indica in given treatments. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test. 93


M. Khalid et al.

observed under saline and non-saline condition in inoculated plants than un-inoculated plants. SA increased by 58.4, 41.3 and 55.6% at 0, 100, and 200 mM NaCl concentration respectively, compared to their corresponding control plants. However under the un-inoculated condition, SA content increased at 100 mM NaCl concentration, while no notable effect was observed at a higher level (200 mM NaCl) of saline condition (Fig. 5B).

Table 4 Effects of NaCl on electrolyte leakage, relative water content (%) and efficiency of photosystem II in Pakchoi plants. Plants were inoculated with the fungus Piriformospora indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl).

0 mM NaCl P. indica Un-inoculated 100 mM NaCl P. indica Un-inoculated 200 mM NaCl P. indica Un-inoculated

Electrolyte leakage

Relative water content (%)

Efficiency PS II (r.u.)

14.57 ± 5.7d 19.67 ± 5.2d

96.21 ± 3.9a 82.92 ± 3.13ab

0.72 ± 0.01a 0.58 ± 0.04b

3.8. P. indica enhances the uptake of phosphorus and reduce sodium accumulation under saline conditions

21.39 ± 3.8d 32.22 ± 3.6c

91.77 ± 5.3a 71.39 ± 5.1b

0.75 ± 0.04a 0.61 ± 0.05b

44.48 ± 3.4b 56.35 ± 4.6a

74.89 ± 8.2b 55.61 ± 8.02c

0.53 ± 0.03bc 0.45 ± 0.04c

Fig. 6 portrays that all P. indica inoculated plants exhibited the higher phosphorus concentration at whatever given salinity level. Shoot phosphorus concentration was observed to be 34.5% higher than uninoculated control plants under non-saline condition. P. indica noticeably increased the phosphorus content by 56.4% and 63.9% at 100 and 200 mM NaCl compared to un-inoculated plants, respectively. The shoot phosphorus was reduced at higher salinity level (200 mM NaCl), though these plants retained higher phosphorus, respectively, relative to the plants exposed to the salinity alone (Fig. 6A–B). In order to test that whether P. indica co-application can alter the ion accumulation in pakchoi at whatever salinity level applied, endogenous ions (Na+ and K+) content were analyzed in the 0, 100 and 200 mM NaCl treatments (Fig. 7A–D). The K+ concentration was unaffected by co-application of P. indica, however, its accumulation gradually decreased with increasing salinity level which was similar in inoculated and un-inoculated plants. Nevertheless, a slight decrease in K+ accumulation was observed in roots at all the tested salinity levels. In contrast to K+, the accumulation of Na+ ions increased gradually with two levels of salt assayed. P. indica co-inoculation reduced the accumulation of endogenous Na+ ions in both shoot and root with 100 and 200 mM NaCl applied, respectively (Fig. 7C–D).

Within each column, means followed by the same letter do not differ significantly at P < 0.05 by Duncan’s test.

stress tolerance (Fig. 4D). 3.7. P. indica augmented abscisic acid (ABA) and salicylic acid (SA) concentration The phytohormonal regulation was analyzed during P. indica and stress application to Pakchoi plants. Analysis of stress-responsive ABA content showed that its concentration was significantly lower in inoculated plants compared to their corresponding control plants (Fig. 5A). Under P. indica application, control had 50% lower ABA content. The same observation was recorded for stress-responsive ABA under salinity stress by 37.14% and 32% at 100 and 200 mM NaCl, respectively, compared to un-inoculated corresponding control plants. Though the concentration of ABA content increased by saline treatments; this increase was not sharp in P. indica inoculated plants. Contrary to ABA content, an elevated SA concentration was

Fig. 4. Antioxidant enzyme (A–C) and MDA (D) concentrations; Pakchoi plants were inoculated with beneficial fungus P. indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of five replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test. 94


M. Khalid et al.

Fig. 5. Abscisic acid and salicylic acid content; Pakchoi plants were inoculated with beneficial fungus Piriformospora indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of five replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test.

Fig. 6. Shoot (a) and root (b) P concentrations. Pakchoi plants were inoculated with beneficial fungus Piriformospora indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of five replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test.

Fig. 7. Shoot (A, C) and root (B, D) K+ and Na+ concentrations; Pakchoi plants were inoculated with beneficial fungus Piriformospora indica or remained as uninoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of five replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test. 95


M. Khalid et al.

Fig. 8. Expression of SOS1, SOS2 and NHX1 in shoots of Pakchoi plants, Plants were inoculated with beneficial fungus Piriformospora indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test.

conditions (Fig. 8). The expression level of NHX was also higher in root tissues in inoculated plants at both saline and non-saline conditions, especially at a higher salinity level of 200 mM NaCl (Fig. 9).

3.9. Encoded ion transporter genes expression analysis Genes from SOS signaling pathway, first discovered in Arabidopsis and identification of NHX transporters (Cation/Proton exchanger family) has made a rapid understanding about the molecular mechanism of response to salt stress in plants (Rodríguez-Rosales et al., 2009; Yang et al., 2009). The expression level of SOS1 and SOS2, as well as NHX1 (The Na+/H+ antiporter), was analyzed in both shoot and root tissues. Gene accessions have been illustrated in Table 1. In shoot, the expression level of SOS1 and SOS2 remained un-altered in non-saline condition, while considerably up-regulated at both saline (100 and 200 mM NaCl) conditions (Fig. 8). In root tissues, the expression level of SOS1 and SOS2 was highly up-regulated under both non-saline and saline conditions, as compared to un-inoculated plants. However, at increasing salinity level (200 mM NaCl), the expression level of SOS1 was observed even higher in both shoot and root tissues, as compared to all other treatments (Figs. 8 and 9). In shoot tissues, NHX expression remained constant under the nonsaline condition, while considerably up-regulated at both saline

4. Discussion Beneficial fungi have the potential to promote the growth and development of numerous plant species via a high degree of symbiosis/ colonization, endophytically or in the form of mycorrhizal fungi (Rodriguez et al., 2009; Zuccaro et al., 2011). Under adverse environmental conditions such as salinity, drought, nutrient deficiency and pathogen attacks, plants have a tendency to develop a symbiotic relationship with the beneficial microorganisms (Lum and Hirsch, 2002). The positive role of beneficial fungi have been extensively studied in plant species such as Sweet Basil (Ocimum basilicum L.), wheat (Triticum aestivum L.), corn (Zea mays L.), soybean (Glycine max), rice (Oryza sativa) and barley (Hordeum vulgare L.) (Baltruschat et al., 2008; Daei et al., 2009; Elhindi et al., 2017; Miransari et al., 2009; Porcel et al., 2016; Sharifi et al., 2007). In this study, a beneficial fungus P. indica Fig. 9. Expression of SOS1, SOS2 and NHX1 in shoots of Pakchoi plants, Plants were inoculated with beneficial fungus Piriformospora indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test.

96


M. Khalid et al.

elucidated and further investigations are required. In this experiment, phosphate content was observed to be higher in inoculated plants under saline and non-saline conditions. Nevertheless, its concentration was detected to decrease in response to higher salinity level (200 mM NaCl) possibly as a result of salinity inference with the P uptake. Ions such as MgSO4, Na2SO4, MgCl2, CaSO4, Na2CO3, and KCl are abundant in the saline soil in the form of anion-cation pairs, but Na+ ions are highly accumulated in plants when subjected to salinity, which results in plants growth retardation. A diverse array of mechanisms by plants have been evolved to minimize sodium toxicity, among which, restriction of Na+ uptake and its reverse transmission from shoot to root is the most common. Induction of salinity tolerance by beneficial fungi in plants is attributed to selective uptake of nutrients and reduction of harmful ions in plant tissues (Evelin et al., 2013; Hammer et al., 2011). It has been proposed that beneficial fungi prevent the transfer of Na+ ions from root to shoot and store it in vesicles, inside vacuole of root cells or in intra-radical fungal hyphae (Evelin et al., 2013; Hammer et al., 2011). Same regulatory effects have been observed in fenugreek plants, such that there was an increase in the Na+ shoot to root ratio due to a saline condition in non-AM plants while in AM plants this ratio was prominently lower. These findings show that beneficial fungi can regulate root to shoot translocation of Na+ ions. In this study, P. indica reduced the accumulation Na+ ions in shoots of Pakchoi. Moreover, this study also shows that the ratio of shoot Na+ to root Na+ was significantly lower in inoculated plants than un-inoculated plants, approving that the translocation of Na+ ions from root to shoot was restricted by the endosymbiont partner (Zhu et al., 2015). The mechanism of sodium uptake restriction and its reverse transmission to the root is regulated with series of regulatory proteins which are synthesized via several pathways. Salt overly sensitive (SOS) signaling pathway involves proteins such as SOS2 which phosphorylates and activates SOS1, a Na+/H+ antiporter at the plasma membrane (Zhu, 2002). SOS1 is expressed in the root epidermal cells and xylem parenchyma cells, so that activated SOS1 can extrude Na+ into the soil solution and load Na+ into the xylem for long-distance transport to leaves by the trans-pirational stream (Shi et al., 2002; Zhu et al., 2015). Several reports have stated that SOS protein family functions are essential to maintain ions homeostasis by mediating cellular signaling under salt stress (Ji et al., 2013; Liu et al., 2000; Munns, 2005). Another protein NHX1, localized in the vacuole is suggested to be involved in sequestration of Na+ to the vacuole inside plants cell, mediating a Na +/H+ antiporter system (Asins et al., 2013; Munns, 2005). It was reported that, M. indicus plants, cultivated in the presence of NaCl, accumulated much less Na+ in roots as a consequence of its reverse transportation to the cultivation medium which can be associated to the higher expression of NHX1 and SOS pathway genes (Zahran et al., 2007).The results from our experiments revealed that the expression level of SOS1, SOS2 and NHX1 was found to be higher (Figs. 8 and 9) in inoculated plants which coincided with the ICP (ion analysis) results. However, the higher overexpression of these candidate genes in shoots of the experimental plants compared to the root along with results from Ion analysis, indicated that in our plants the genes were performing more anti-transportation role from root to the shoot rather than root to the medium. These results are supported by lower shoot to root ratio of Na+ ions (Fig. 10).Therefore it is concluded that P. indica regulated the expression level of these genes, which are involved in ion homeostasis, enhancing the plant tolerance to salinity. Thus current data suggest that beneficial fungus symbiosis can protect the photosynthetic tissues from the toxic effect of Na+ ions by limiting its distribution towards the shoot.

was co-cultivated with pakchoi in saline and non-saline conditions. The fungus showed a successful colonization by forming intracellular chlamydospores and extracellular hyphal mats. In accordance with our study, the symbiotic colonization by P. indica has been also documented in plants such as Hordeum vulgare, Arabidopsis thaliana, Oryza sativa, Zea mays and many other mono- and dicots (Gill et al., 2016). Improvement of plant growth and salt stress alleviation in co-cultivation with P. indica have been reported in many plants, such as barley and wheat and etc. (Baltruschat et al., 2008; Ghaffari et al., 2016; Sharma et al., 2017; Waller et al., 2005; Zarea et al., 2012). The symbiotic efficiency of P. indica was measured in terms of plant biomass production under salinity conditions which demonstrated its stimulating effect on the growth of pakchoi. The nutrient absorption and exchange capabilities of P. indica has enabled this endosymbiont to be categorized as a growth promoter of several plant species. Former studies reported that P. indica co-cultivated Arabidopsis and Tobacco cultured in growth medium, could have higher potential in up-taking and accumulation of nitrate in their shoot, leading to higher chlorophyll content (Sherameti et al., 2005). In current study, P. indica inoculation significantly improved the chlorophyll content which is directly linked to the rate of photosynthesis in plants (Ma et al., 2011). There are overwhelming evidences that P. indica can modulate the major antioxidant enzymes such as dehydroascorbate reductase, monodehydroascorbate reductase and other constituents of ROS- scavenging system (Hamilton et al., 2012; Sun et al., 2010; Vadassery et al., 2009; White and Torres, 2010). The establishment of a ROS-scavenging system by P. indica inoculation has conferred resistance to abiotic stresses including drought, salinity, heat and etc. (Kumar et al., 2009; Sun et al., 2010; Waller et al., 2005). P. indica also improved the antioxidant enzyme activities which help in defense and tolerance mediation against abiotic stresses. A major consequence of soil salinity is increasing the ROS level, leading to lipid peroxidation of cell membrane and elevation of leaf MDA content (Sun et al., 2010). Measurement of leaf MDA is a helpful tool for evaluating cell membrane damage in response to salinity and drought stresses. The results of this study suggested a reduced MDA content in salt treated plants, which were inoculated with P. indica compared to their corresponding controls. Stress-responsive ABA is very important for proper plant growth as it minimizes the stress damage, mainly through mediating the stomatal closure to reduce water loss and regulation of certain genes which respond to stress and induce stress tolerance in plants (Zhang et al., 2006). ABA concentration was reduced by P. indica inoculation with or without salt stress which corroborates with the previous studies (Jahromi et al., 2008; Khan et al., 2012), Whereas increasing ABA following the application of beneficial microbes has also been documented. Nevertheless, the effects may vary among the different plant species and different classes of the microorganism (Evelin et al., 2009; Yang and Crowley, 2000). On the other hand, SA ameliorates the plant performance in both abiotic and biotic stresses by triggering induced systemic resistance (Pozo and AzcónAguilar, 2007). In agreement with previous reports, a higher SA concentration was recorded in inoculated plants under different salinity levels (Hermosa et al., 2012; Van Wees et al., 2008). Phosphate is a key element in plants which make up 0.5% of the dry weight of the plant cell and plays a series of important roles such as energy transmission and other regulatory mechanisms (Balemi and Negisho, 2012). Higher phosphate uptake can maintains the cell membrane integrity under saline conditions, reduce electrolyte leakage, stabilize vacuolar membrane and help in Na+ compartmentalization within the vacuole of the plant cell (Evelin et al., 2012, 2013). Enhanced P uptake by P. indica inoculation (2–3 times higher) was reported in Arabidopsis thaliana and Zea mays. This mechanism has been hypothesized to be processed with series of transporter elements which firstly enable the phosphate efflux in the fungus to plants direction and secondly in phosphate uptake mediation by the plant (Shahollari et al., 2005; Yadav et al., 2010). However, this mechanism is not yet fully

Financial disclosure This research was supported in part by the Science and Technology Commission of Shanghai Municipality (16391904100); the Municipal Agricultural Commission, China (2017 1–3) and the earmarked fund for 97


M. Khalid et al.

Asins, M.J., Villalta, I., Aly, M.M., Olias, R., Álvarez De Morales, P., Huertas, R., Li, J., Jaime-Pérez, N., Haro, R., Raga, V., 2013. Two closely linked tomato HKT coding genes are positional candidates for the major tomato QTL involved in Na+/K+ homeostasis. Plant Cell Environ. 36, 1171–1191. Balemi, T., Negisho, K., 2012. Management of soil phosphorus and plant adaptation mechanisms to phosphorus stress for sustainable crop production: a review. J. Soil Sci. Plant Nutr. 12, 547–562. Baltruschat, H., Fodor, J., Harrach, B.D., Niemczyk, E., Barna, B., Gullner, G., Janeczko, A., Kogel, K.H., Schäfer, P., Schwarczinger, I., 2008. Salt tolerance of barley induced by the root endophyte Piriformospora indica is associated with a strong increase in antioxidants. New Phytol. 180, 501–510. Bao, A.-K., Wang, S.-M., Wu, G.-Q., Xi, J.-J., Zhang, J.-L., Wang, C.-M., 2009. Overexpression of the Arabidopsis H+-PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L.). Plant Sci. 176, 232–240. Bassil, E., Coku, A., Blumwald, E., 2012. Cellular ion homeostasis: emerging roles of intracellular NHX Na+/H+ antiporters in plant growth and development. J. Exp. Bot. 63, 5727–5740. Chen, Z., Zhou, M., Newman, I.A., Mendham, N.J., Zhang, G., Shabala, S., 2007. Potassium and sodium relations in salinised barley tissues as a basis of differential salt tolerance. Funct. Plant Biol. 34, 150–162. Cuin, T.A., Bose, J., Stefano, G., Jha, D., Tester, M., Mancuso, S., Shabala, S., 2011. Assessing the role of root plasma membrane and tonoplast Na+/H+ exchangers in salinity tolerance in wheat: in planta quantification methods. Plant Cell Environ. 34, 947–961. Daei, G., Ardekani, M., Rejali, F., Teimuri, S., Miransari, M., 2009. Alleviation of salinity stress on wheat yield, yield components, and nutrient uptake using arbuscular mycorrhizal fungi under field conditions. J. Plant Physiol. 166, 617–625. Dickson, S., Smith, S., 1998. Evaluation of Vesicular-arbuscular Mycorrhizal Colonisation by Staining, Mycorrhiza Manual. Springer, pp. 77–83. Dodd, I.C., Pérez-Alfocea, F., 2012. Microbial amelioration of crop salinity stress. J. Exp. Bot ers033. Elhindi, K.M., El-Din, A.S., Elgorban, A.M., 2017. The impact of arbuscular mycorrhizal fungi in mitigating salt-induced adverse effects in sweet basil (Ocimum basilicum L.). Saudi J. Biol. Sci. 24, 170–179. Evelin, H., Kapoor, R., Giri, B., 2009. Arbuscular mycorrhizal fungi in alleviation of salt stress: a review. Ann. Bot. 104, 1263–1280. Evelin, H., Giri, B., Kapoor, R., 2012. Contribution of Glomus intraradices inoculation to nutrient acquisition and mitigation of ionic imbalance in NaCl-stressed Trigonella foenum-graecum. Mycorrhiza 22, 203–217. Evelin, H., Giri, B., Kapoor, R., 2013. Ultrastructural evidence for AMF mediated salt stress mitigation in Trigonella foenum-graecum. Mycorrhiza 23, 71–86. Ghaffari, M.R., Ghabooli, M., Khatabi, B., Hajirezaei, M.R., Schweizer, P., Salekdeh, G.H., 2016. Metabolic and transcriptional response of central metabolism affected by root endophytic fungus Piriformospora indica under salinity in barley. Plant Mol. Biol. 90, 699–717. Ghanem, M.E., Albacete, A., Martínez-Andújar, C., Acosta, M., Romero-Aranda, R., Dodd, I.C., Lutts, S., Pérez-Alfocea, F., 2008. Hormonal changes during salinity-induced leaf senescence in tomato (Solanum lycopersicum L.). J. Exp. Bot. 59, 3039–3050. Gill, S.S., Gill, R., Trivedi, D.K., Anjum, N.A., Sharma, K.K., Ansari, M.W., Ansari, A.A., Johri, A.K., Prasad, R., Pereira, E., 2016. Piriformospora indica: potential and significance in plant stress tolerance. Front. Microbiol. 7. Hamilton, C.E., Gundel, P.E., Helander, M., Saikkonen, K., 2012. Endophytic mediation of reactive oxygen species and antioxidant activity in plants: a review. Fungal Divers. 54, 1–10. Hammer, E.C., Nasr, H., Pallon, J., Olsson, P.A., Wallander, H., 2011. Elemental composition of arbuscular mycorrhizal fungi at high salinity. Mycorrhiza 21, 117–129. Harbaum, B., Hubbermann, E.M., Wolff, C., Herges, R., Zhu, Z., Schwarz, K., 2007. Identification of flavonoids and hydroxycinnamic acids in pak choi varieties (Brassica campestris L. ssp. Chinensis var. communis) by HPLC-ESI–MS n and NMR and their quantification by HPLC-DAD. J. Agric. Food Chem. 55, 8251–8260. Hashem, A., Abd_Allah, E., Ahmad, P., 2015. Effect of AM fungi on growth physio-biochemical attributes, lipid peroxidation, antioxidant enzymes and plant growth regulators in Lycopersicon esculantum Mill. subjected to different concentration of NaCl. Pak. J. Bot. 47, 327–340. Hassani, D., Liu, H., Chen, Y., Wan, Z., Zhuge, Q., Li, S., 2015. Analysis of biochemical compounds and differentially expressed genes of the anthocyanin biosynthetic pathway in variegated peach flowers. Genet. Mol. Res. 14, 13425–13436. He, C., Yan, J., Shen, G., Fu, L., Holaday, A.S., Auld, D., Blumwald, E., Zhang, H., 2005. Expression of an Arabidopsis vacuolar sodium/proton antiporter gene in cotton improves photosynthetic performance under salt conditions and increases fiber yield in the field. Plant Cell Physiol. 46, 1848–1854. Hermosa, R., Viterbo, A., Chet, I., Monte, E., 2012. Plant-beneficial effects of Trichoderma and of its genes. Microbiology 158, 17–25. Hiscox, J.T., Israelstam, G., 1979. A method for the extraction of chlorophyll from leaf tissue without maceration. Can. J. Bot. 57, 1332–1334. Hong-Xia, Z., Blumwald, E., 2001. Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nat. Biotechnol. 19, 765. Jahromi, F., Aroca, R., Porcel, R., Ruiz-Lozano, J.M., 2008. Influence of salinity on the in vitro development of Glomus intraradices and on the in vivo physiological and molecular responses of mycorrhizal lettuce plants. Microb. Ecol. 55, 45. Ji, H., Pardo, J.M., Batelli, G., Van Oosten, M.J., Bressan, R.A., Li, X., 2013. The salt overly sensitive (SOS) pathway: established and emerging roles. Mol. Plant 6, 275–286. Jogawat, A., Saha, S., Bakshi, M., Dayaman, V., Kumar, M., Dua, M., Varma, A., Oelmüller, R., Tuteja, N., Johri, A.K., 2013. Piriformospora indica rescues growth diminution of rice seedlings during high salt stress. Plant Signal. Behav. 8, e26891.

Fig. 10. Shoot Na+/root Na+ ratio in experimental plants; Pakchoi plants were inoculated with beneficial fungus Piriformospora indica or remained as un-inoculated controls. Plants were cultivated in the absence of salinity for the entire experiment (0 mM NaCl) or were subjected to two levels of salinity (100 and 200 mM NaCl). Bars represent the means of five replicates ± standard error. Bars topped by the same letter do not differ significantly at P ≤ 0.05 by Duncan’s test.

Shanghai Modern Leaf-vegetable Industry Technology Research System (17Z113010001). Author’s contribution statement MK designed the study and carried out the experimental work. MK and DH interpreted the data and drafted the manuscript. JL, XX, and MB provided experimental resources and participated in data analysis as well as drafting the manuscript. All authors read and approved the final manuscript. All the research work was carried out under the supervision of DH (Principal Investigators of the project) who designed and coordinated the experiments. Conflicts of interest The authors declare that there is no conflict of interest to claim. Acknowledgements The authors are grateful to School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, China for providing financial and experimental facilities. The technical and analytical help provided by the Instrumental Analysis Center of Shanghai Jiao Tong University is also thankfully acknowledged. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at https://doi.org/10.1016/j.envexpbot.2018.05.007. References Ahmad, P., Sarwat, M., Sharma, S., 2008. Reactive oxygen species, antioxidants and signaling in plants. J. Plant Biol. 51, 167–173. Ahmad, P., Jaleel, C., Sharma, S., 2010. Antioxidant defense system, lipid peroxidation, proline-metabolizing enzymes, and biochemical activities in two Morus alba genotypes subjected to NaCl stress. Russ. J. Plant Physiol. 57, 509–517. Ahmad, P., Nabi, G., Ashraf, M., 2011. Cadmium-induced oxidative damage in mustard [Brassica juncea (L.) Czern: & Coss.] plants can be alleviated by salicylic acid. S. Afr. J. Bot. 77, 36–44. Ahmad, P., Ashraf, M., Hakeem, K.R., Azooz, M., Rasool, S., Chandna, R., Akram, N.A., 2014. Potassium starvation-induced oxidative stress and antioxidant defense responses in Brassica juncea. J. Plant Interact. 9, 1–9. Ahmad, P., 2010. Growth and antioxidant responses in mustard (Brassica juncea L.) plants subjected to combined effect of gibberellic acid and salinity. Arch. Agron. Soil Sci. 56, 575–588. Apse, M.P., Aharon, G.S., Snedden, W.A., Blumwald, E., 1999. Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285, 1256–1258.

98


M. Khalid et al.

protein accumulates in Triton X-100 insoluble plasma membrane microdomains. J. Plant Physiol. 162, 945–958. Sharifi, M., Ghorbanli, M., Ebrahimzadeh, H., 2007. Improved growth of salinity-stressed soybean after inoculation with salt pre-treated mycorrhizal fungi. J. Plant Physiol. 164, 1144–1151. Sharma, P., Kharkwal, A.C., Abdin, M., Varma, A., 2017. Piriformospora indica-mediated salinity tolerance in Aloe vera plantlets. Symbiosis 1–13. Sherameti, I., Shahollari, B., Venus, Y., Altschmied, L., Varma, A., Oelmüller, R., 2005. The endophytic fungus Piriformospora indica stimulates the expression of nitrate reductase and the starch-degrading enzyme glucan-water dikinase in tobacco and Arabidopsis roots through a homeodomain transcription factor that binds to a conserved motif in their promoters. J. Biol. Chem. 280, 26241–26247. Shi, H., Zhu, J.-K., 2002. SOS4, a pyridoxal kinase gene, is required for root hair development in Arabidopsis. Plant Physiol. 129, 585–593. Shi, H., Ishitani, M., Kim, C., Zhu, J.-K., 2000. The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. Proc. Natl. Acad. Sci. 97, 6896–6901. Shi, H., Quintero, F.J., Pardo, J.M., Zhu, J.-K., 2002. The putative plasma membrane Na +/H+ antiporter SOS1 controls long-distance Na+ transport in plants. Plant Cell 14, 465–477. Smart, R.E., Bingham, G.E., 1974. Rapid estimates of relative water content. Plant Physiol. 53, 258–260. Sun, C., Johnson, J.M., Cai, D., Sherameti, I., Oelmüller, R., Lou, B., 2010. Piriformospora indica confers drought tolerance in Chinese cabbage leaves by stimulating antioxidant enzymes, the expression of drought-related genes and the plastid-localized CAS protein. J. Plant Physiol. 167, 1009–1017. Unnikumar, K., Sree, K.S., Varma, A., 2013. Piriformospora indica: a versatile root endophytic symbiont. Symbiosis 60, 107–113. Vadassery, J., Ranf, S., Drzewiecki, C., Mithöfer, A., Mazars, C., Scheel, D., Lee, J., Oelmüller, R., 2009. A cell wall extract from the endophytic fungus Piriformospora indica promotes growth of Arabidopsis seedlings and induces intracellular calcium elevation in roots. Plant J. 59, 193–206. Van Wees, S.C., Van der Ent, S., Pieterse, C.M., 2008. Plant immune responses triggered by beneficial microbes. Curr. Opin. Plant Biol. 11, 443–448. Varma, A., Schuepp, H., 1994. Positive influence of arbuscular mycorrhizal fungus on in vitro raised hortensia plantlets. Angew. Bot. 68, 108–113. Waller, F., Achatz, B., Baltruschat, H., Fodor, J., Becker, K., Fischer, M., Heier, T., Hückelhoven, R., Neumann, C., von Wettstein, D., 2005. The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. Proc. Natl. Acad. Sci. U. S. A. 102, 13386–13391. White, J.F., Torres, M.S., 2010. Is plant endophyte-mediated defensive mutualism the result of oxidative stress protection? Physiol. Plant. 138, 440–446. Wu, S.-J., Ding, L., Zhu, J.-K., 1996. SOS1, a genetic locus essential for salt tolerance and potassium acquisition. Plant Cell 8, 617–627. Xue, Z.-Y., Zhi, D.-Y., Xue, G.-P., Zhang, H., Zhao, Y.-X., Xia, G.-M., 2004. Enhanced salt tolerance of transgenic wheat (Tritivum aestivum L.) expressing a vacuolar Na+/H+ antiporter gene with improved grain yields in saline soils in the field and a reduced level of leaf Na+. Plant Sci. 167, 849–859. Yadav, V., Kumar, M., Deep, D.K., Kumar, H., Sharma, R., Tripathi, T., Tuteja, N., Saxena, A.K., Johri, A.K., 2010. A phosphate transporter from the root endophytic fungus Piriformospora indica plays a role in phosphate transport to the host plant. J. Biol. Chem. 285, 26532–26544. Yang, C.-H., Crowley, D.E., 2000. Rhizosphere microbial community structure in relation to root location and plant iron nutritional status. Appl. Environ. Microbiol. 66, 345–351. Yang, Q., Chen, Z.-Z., Zhou, X.-F., Yin, H.-B., Li, X., Xin, X.-F., Hong, X.-H., Zhu, J.-K., Gong, Z., 2009. Overexpression of SOS (Salt Overly Sensitive) genes increases salt tolerance in transgenic Arabidopsis. Mol. Plant 2, 22–31. Zahran, H.H., Marín-Manzano, M.C., Sánchez-Raya, A.J., Bedmar, E.J., Venema, K., Rodríguez-Rosales, M.P., 2007. Effect of salt stress on the expression of NHX-type ion transporters in Medicago intertexta and Melilotus indicus plants. Physiol. Plant. 131, 122–130. Zarea, M., Hajinia, S., Karimi, N., Goltapeh, E.M., Rejali, F., Varma, A., 2012. Effect of Piriformospora indica and Azospirillum strains from saline or non-saline soil on mitigation of the effects of NaCl. Soil Biol. Biochem. 45, 139–146. Zeinalov, Y., Maslenkova, L., 1999. Estimation of the quantum efficiency of photosynthesis: I. Theoretical ground and experimental approaches. Bulg. J. Plant Physiol 25, 26–38. Zhang, H.-X., Hodson, J.N., Williams, J.P., Blumwald, E., 2001. Engineering salt-tolerant Brassica plants: characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. Proc. Natl. Acad. Sci. 98, 12832–12836. Zhang, J., Jia, W., Yang, J., Ismail, A.M., 2006. Role of ABA in integrating plant responses to drought and salt stresses. Field Crops Res. 97, 111–119. Zhu, J.-K., Liu, J., Xiong, L., 1998. Genetic analysis of salt tolerance in Arabidopsis: evidence for a critical role of potassium nutrition. Plant Cell Online 10, 1181–1191. Zhu, M., Shabala, L., Cuin, T.A., Huang, X., Zhou, M., Munns, R., Shabala, S., 2015. Nax loci affect SOS1-like Na+/H+ exchanger expression and activity in wheat. J. Exp. Bot. 67, 835–844. Zhu, J.-K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53, 247–273. Zhu, J.-K., 2003. Regulation of ion homeostasis under salt stress. Curr. Opin. Plant Biol. 6, 441–445. Zuccaro, A., Lahrmann, U., Güldener, U., Langen, G., Pfiffi, S., Biedenkopf, D., Wong, P., Samans, B., Grimm, C., Basiewicz, M., 2011. Endophytic life strategies decoded by genome and transcriptome analyses of the mutualistic root symbiont Piriformospora indica. PLoS Pathog. 7, e1002290.

Khalid, M., Hassani, D., Bilal, M., Liao, J., Huang, D., 2017a. Elevation of secondary metabolites synthesis in Brassica campestris ssp. Chinensis L. via exogenous inoculation of Piriformospora indica with appropriate fertilizer. PLoS One 12, e0177185. Khalid, M., Bilal, M., Hassani, D., Iqbal, H.M., Wang, H., Huang, D., 2017b. Mitigation of salt stress in white clover (Trifolium repens) by Azospirillum brasilense and its inoculation effect. Bot. Stud. 58, 5. Khan, A.L., Hamayun, M., Kang, S.-M., Kim, Y.-H., Jung, H.-Y., Lee, J.-H., Lee, I.-J., 2012. Endophytic fungal association via gibberellins and indole acetic acid can improve plant growth under abiotic stress: an example of Paecilomyces formosus LHL10. BMC Microbiol. 12, 3. Kumar, M., Yadav, V., Tuteja, N., Johri, A.K., 2009. Antioxidant enzyme activities in maize plants colonized with Piriformospora indica. Microbiology 155, 780–790. Liu, J., Ishitani, M., Halfter, U., Kim, C.-S., Zhu, J.-K., 2000. The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance. Proc. Natl. Acad. Sci. 97, 3730–3734. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2- ΔΔCT method. Methods 25, 402–408. Lum, M.R., Hirsch, A.M., 2002. Roots and their symbiotic microbes: strategies to obtain nitrogen and phosphorus in a nutrient-limiting environment. J. Plant Growth Regul. 21, 368–382. Lutts, S., Kinet, J., Bouharmont, J., 1996. NaCl-induced senescence in leaves of rice (Oryza sativa L.) cultivars differing in salinity resistance. Ann. Bot. 78, 389–398. Ma, Q., Yue, L.-J., Zhang, J.-L., Wu, G.-Q., Bao, A.-K., Wang, S.-M., 2011. Sodium chloride improves photosynthesis and water status in the succulent xerophyte Zygophyllum xanthoxylum. Tree Physiol. 32, 4–13. Miransari, M., Bahrami, H., Rejali, F., Malakouti, M., 2009. Effects of soil compaction and arbuscular mycorrhiza on corn (Zea mays L.) nutrient uptake. Soil Tillage Res. 103, 282–290. Munns, R., Tester, M., 2008. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 59, 651–681. Munns, R., 2005. Genes and salt tolerance: bringing them together. New Phytologist 167, 645–663. Oelmüller, R., Sherameti, I., Tripathi, S., Varma, A., 2009. Piriformospora indica, a cultivable root endophyte with multiple biotechnological applications. Symbiosis 49, 1–17. Ohta, M., Hayashi, Y., Nakashima, A., Hamada, A., Tanaka, A., Nakamura, T., Hayakawa, T., 2002. Introduction of a Na+/H+ antiporter gene from Atriplex gmelini confers salt tolerance to rice. FEBS Lett. 532, 279–282. Olias, R., Eljakaoui, Z., Li, J., De Morales, P.A., Marín-Manzano, M.C., Pardo, J.M., Belver, A., 2009. The plasma membrane Na+/H+ antiporter SOS1 is essential for salt tolerance in tomato and affects the partitioning of Na+ between plant organs. Plant Cell Environ. 32, 904–916. Oxborough, K., Baker, N.R., 1997. Resolving chlorophyll a fluorescence images of photosynthetic efficiency into photochemical and non-photochemical components-calculation of qP and Fv-/Fm-; without measuring Fo. Photosynth. Res. 54, 135–142. Phillips, J.M., Hayman, D., 1970. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Br. Mycol. Soc. 55, 158IN116–161IN118. Porcel, R., Aroca, R., Ruiz-Lozano, J.M., 2012. Salinity stress alleviation using arbuscular mycorrhizal fungi: a review. Agron. Sustainable Dev. 32, 181–200. Porcel, R., Aroca, R., Azcon, R., Ruiz-Lozano, J.M., 2016. Regulation of cation transporter genes by the arbuscular mycorrhizal symbiosis in rice plants subjected to salinity suggests improved salt tolerance due to reduced Na+ root-to-shoot distribution. Mycorrhiza 26, 673–684. Pozo, M.J., Azcón-Aguilar, C., 2007. Unraveling mycorrhiza-induced resistance. Curr. Opin. Plant Biol. 10, 393–398. Qiu, Q.-S., Guo, Y., Dietrich, M.A., Schumaker, K.S., Zhu, J.-K., 2002. Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proc. Natl. Acad. Sci. 99, 8436–8441. Quintero, F.J., Ohta, M., Shi, H., Zhu, J.-K., Pardo, J.M., 2002. Reconstitution in yeast of the Arabidopsis SOS signaling pathway for Na+ homeostasis. Proc. Natl. Acad. Sci. 99, 9061–9066. Rasool, S., Ahmad, A., Siddiqi, T., Ahmad, P., 2013. Changes in growth, lipid peroxidation and some key antioxidant enzymes in chickpea genotypes under salt stress. Acta Physiol. Plant. 35, 1039–1050. Rodríguez-Rosales, M.P., Gálvez, F.J., Huertas, R., Aranda, M.N., Baghour, M., Cagnac, O., Venema, K., 2009. Plant NHX cation/proton antiporters. Plant Signal. Behav. 4, 265–276. Rodriguez, R.J., Redman, R.S., Henson, J.M., 2004. The role of fungal symbioses in the adaptation of plants to high stress environments. Mitigation Adapt. Strat. Glob. Change 9, 261–272. Rodriguez, R., White Jr, J., Arnold, A., Redman, R., 2009. Fungal endophytes: diversity and functional roles. New Phytologist 182, 314–330. Ruiz-Lozano, J.M., Porcel, R., Azcón, C., Aroca, R., 2012. Regulation by arbuscular mycorrhizae of the integrated physiological response to salinity in plants: new challenges in physiological and molecular studies. J. Exp. Bot. 63, 4033–4044. Sánchez, F.J., Manzanares, M.A., de Andres, E.F., Tenorio, J.L., Ayerbe, L., 1998. Turgor maintenance: osmotic adjustment and soluble sugar and proline accumulation in 49 pea cultivars in response to water stress. Field Crops Res. 59, 225–235. Sahay, N., Varma, A., 1999. Piriformospora indica: a new biological hardening tool for micropropagated plants. FEMS Microbiol. Lett. 181, 297–302. Shabala, S., Cuin, T.A., 2008. Potassium transport and plant salt tolerance. Physiol. Plant. 133, 651–669. Shahollari, B., Varma, A., Oelmüller, R., 2005. Expression of a receptor kinase in Arabidopsis roots is stimulated by the basidiomycete Piriformospora indica and the

99