Anaerobic Degradation of Aromatic Compounds ... - Semantic Scholar

1 downloads 0 Views 168KB Size Report
spirillum represents the third genus of denitrifying bacteria capable of degrading aromatic compounds under anaerobic conditions, besides the genera Thauera.

Biosci. Biotechnol. Biochem., 69 (8), 1483–1491, 2005

Anaerobic Degradation of Aromatic Compounds by Magnetospirillum Strains: Isolation and Degradation Genes Yoshifumi S HINODA,1 Junya A KAGI,1 Yasumitsu U CHIHASHI,1 Akira H IRAISHI,2 Hideaki Y UKAWA,3 Hiroya Y URIMOTO,1 Yasuyoshi S AKAI,1 and Nobuo K ATO1; y 1

Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kyoto 606-8502, Japan Department of Ecological Engineering, Toyohashi University of Technology, Toyohashi 441-8580, Japan 3 Research Institute of Innovative Technology for the Earth, Soraku-gun, Kyoto 619-0292, Japan 2

Received February 8, 2005; Accepted May 7, 2005

Four Magnetospirillum strains degrading toluene, phenol, benzoate, and other aromatic compounds under anaerobic conditions were isolated from denitrifying enrichment cultures. One of the isolates, toluene-degrading strain TS-6, contained genes that are homologous to those encoding benzylsuccinate synthase (Bss) and benzoyl-CoA reductase (Bcr), two key enzymes of anaerobic toluene and benzoate degradation respectively in known denitrifying bacteria. Transcription of the genes was confirmed. It was controlled by growth substrates and oxygen conditions, but bcr genes were unexpectedly expressed in aerobic cells grown on benzoate. It was confirmed that the genus Magnetospirillum represents the third genus of denitrifying bacteria capable of degrading aromatic compounds under anaerobic conditions, besides the genera Thauera and Azoarcus. Key words:

Magnetospirillum sp.; aromatic compounds; anaerobic degradation; benzylsuccinate synthase; benzoyl-CoA reductase

Aromatic compounds form the second largest group of organic compounds in nature after carbohydrates. Various kinds of compounds such as lignin monomers (phenylpropane derivatives), amino acids, quinones, and flavonoids are produced, serving good substrates for many microorganisms. Since a large part of the natural environment has little or no access to atmospheric oxygen, anaerobic microorganisms must play an important role in the circulation of these compounds in the global carbon cycle. Degradation of aromatic compounds by anaerobic microorganisms has been studied extensively for facultative anaerobes. Only a limited number of genera contain such organisms, viz., Thauera, Azoarcus (denitrifying), and Rhodopseudomonas (phototrophic). According to these studies, degradation proceeds through two steps. First, various aromatic compounds y

are converted to several common intermediates such as benzoyl-CoA, resorcinol, and phloroglucinol via socalled peripheral pathways in which residues are CoAthioesterified, oxidized, and removed. Then these central intermediates are reductively dearomatized to alicyclic compounds and cleaved into aliphatic compounds.1–3) For example, toluene is first converted to benzylsuccinate by the addition of fumarate to the methyl group, catalyzed by benzylsuccinate synthase (Bss).4–6) Then benzylsuccinate is transformed to benzoylsuccinyl-CoA and cleaved to succinyl-CoA and benzoyl-CoA. The central intermediate, benzoyl-CoA, is dearomatized to cyclohex-1,5-diene-1-carboxyl-CoA by another key enzyme, benzoyl-CoA reductase (Bcr). After ring cleavage to a straight-chain carboxylic acid and -oxidation to acetyl-CoA, the pathway is connected to the TCA cycle. This benzoyl-CoA pathway is shared by the genera Thauera, Azoarcus, and Rhodopseudomonas with slight variations.1,4,7) On the other hand, strict anaerobic iron- and sulfatereducing and syntrophic bacteria have also been found to degrade aromatic compounds. Their degradation pathways are now being investigated. Benzoyl-CoA degradation is proposed to be different from that of facultative anaerobes.8–10) Understanding the diversity of these anaerobes and their pathways is important because it should lead to a better understanding of the global carbon cycle, which should be useful for restoration of soil and ground water contamination by substances containing aromatic compounds. In a previous paper,11) we reported the isolation of an anaerobic phenol-degrading strain most closely related to the genus Magnetospirillum. This was the first report of a denitrifying strain of  Proteobacteria degrading aromatic compounds. Here we report the isolation of four Magnetospirillum strains growing on toluene, phenol, or benzoate, and degradation genes of one of the strains. Isolation of a group of strains of this kind

To whom correspondence should be addressed. Tel/Fax: +81-75-753-6385; E-mail: [email protected]

1484

Y. S HINODA et al.

indicates that Magnetospirillum represents the third genus of denitrifying bacteria that degrade aromatic compounds under anaerobic conditions, in addition to Thauera and Azoarcus.

Mateials and Methods Enrichment and isolation. For enrichment and isolation of the strains, a medium of the following composition was used:12) 1.6 g of Na2 HPO4 , 1.0 g of KH2 PO4 , 0.5 g of NH4 Cl, 0.06 g of K2 SO4 , 0.025 g of CaCl2 2H2 O, 0.1 g of MgCl2 6H2 O, 0.42 g of NaHCO3 , 15 mg of EDTA 2Na, 0.028 mg of FeSO4 7H2 O, 6 mg of H3 BO3 , 2 mg of CuCl2 2H2 O, 0.5 mg of NaOH, 2 mg of Na2 SeO3 , 4 mg of Na2 WO4 2H2 O, 20 mg of vitamin B12 , 10 mg of D-biotin, 25 mg of D-calcium panthothenate, 50 mg of thiamine hydrochloride, 50 mg of paminobenzoic acid, 100 mg of nicotinic acid, and 250 mg of pyridoxine hydrochloride, in 1 liter of distilled water (pH 7.0 to 7.1). For cultivation of the isolated strains, the amount of FeSO4 7H2 O was raised to 1.5 mg/l (growth medium). For anaerobic cultivation, KNO3 (3 to 5 mM, 0.30 to 0.51 g/l) was added as the electron acceptor, and the medium was equilibrated in an anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) for more than two d before inoculation. Soils from damp ground and rice paddies were used as sources of the organisms. Approximately 5 g of soil samples was suspended into 50 ml of phosphate buffer (pH 7.0–7.1) and centrifuged, and the supernatant was discarded. This process was repeated several times to remove any soluble organic materials. Suspensions of the washed samples were inoculated into the enrichment medium in anaerobic culture tubes (Bellco Glass, Vineland, NJ) with either phenol (1 mM), benzoate (1 mM), or toluene (0.3 mM) as the sole carbon source, and nitrate (5 mM) as the electron acceptor. Cultures were incubated anaerobically, and those exhibiting growth were transferred to fresh medium several times. Cultures that were dominated by spiral-shaped bacteria were serially diluted in phosphate buffer, and aliquots were subjected to the pour-plate method13) by mixing them with enrichment medium containing 1% Noble agar (Difco Laboratories, Detroit, MI). Solidified plates were incubated in anaerobic jars (Becton Dickinson, Franklin Lakes, NJ) for two weeks. Phenol and benzoate were added directly to the media and toluene was supplied by vapor from a 1% (vol/vol) solution of toluene in hexadecane.14) Colonies that formed in the agar media were punched out with sterile Pasteur pipettes, transferred to fresh enrichment media, and incubated anaerobically. Cultures exhibiting growth and containing spiral-shaped bacteria were serially diluted again and spread onto nutrient agar medium (Difco Laboratories) containing 5 mM of KNO3 , and incubated aerobically for two weeks. Spiral-shaped bacterial strains were isolated by repeated cultivation on nutrient agar medium and in liquid enrichment media several times.

.

.

.

.

.

.

.

To check the range of growth substrates, various aromatic compounds (0.5 to 1.0 mM in concentration) were tested in a growth medium under aerobic and anaerobic denitrifying conditions. All cultivations were performed in duplicate and the results were judged by determining the optical density of each culture at 610 nm (OD610 ) during 10 to 14 d of incubation, compared with unamended controls. OD610 of more than 0.1 was defined as growth on the substrate. All cultivations were carried out at 30  C. Isolated strains were maintained on nutrient agar slants or stored as condensed liquid cultures with 15% (vol/vol) glycerol at 80  C. Phylogenetic analyses. 16S ribosomal DNA (rDNA) of each strain was amplified directly from the cells of each strain by PCR using oligodeoxynucleotide primers fD1 and rD1.15) Several clones of the PCR products were sequenced for both strands. Homology searches and alignment of the sequences were conducted using FASTA and CLUSTAL W respectively, in both cases through the DDBJ website (http://www.ddbj.nig.ac.jp/ Welcome-j.html). Phylogenetic trees were drawn using the Tree View program (version 1.6.6; Faculty of Biomedical and Life Sciences, University of Glasgow [http://taxonomy.zoology.gla.ac.uk/rod/treeview.html]). For genomic DNA extraction, each strain was cultivated aerobically in a growth medium with 6 mM succinate or acetate as the carbon source. Culture flasks of 500 ml volume containing 300 ml of medium were shaken reciprocally at 120 rpm. Genomic DNA was extracted from cells of each strain using hexadecyltrimethyl ammonium bromide (CTAB), according to the standard procedure.16) The G þ C content of the genomic DNA of strains was determined by quantitative analysis of Nuclease P1-hydrolyzed genomic DNA,17) prepared using a DNA-GC kit (Yamasa, Chiba, Japan). Isoprenoid quinones were extracted with chloroform– methanol (2:1, v/v) and dissolved in n-hexane, separated with Sep-Pak Vac cartridges (Waters, Milford, MA), and quantitated by reverse-phase high-performance liquid chromatography with a photodiode array detector. Standard quinones prepared from activated sludge and authentic bacterial strains were used for identification and quantification.18) Chemical analysis. Toluene was determined by gas chromatography with a flame ionization detector, using a G-100 column (40 m by 1.2 mm; Chemicals Inspection and Testing Institute, Tokyo), helium as the carrier gas (60 kPa), and column, injector, and detector temperatures of 70, 120, and 200  C respectively. Benzoate, phenol, toluene metabolites, nitrate, and nitrite were analyzed by high-performance liquid chromatography performed with a UV detector (model LC-10A type PIA; Shimadzu, Kyoto, Japan). Aromatic compounds were detected at 275 nm on a Wakosil 5C18 HG column (150 by 4.6 mm; Wako Pure Chemical Industries, Osaka,

Anaerobic Degradation of Aromatics by Magnetospirillum spp.

1485

Table 1. Primers Used in This Study Primer

Nucleotides

bss1prb-f bss1prb-r bss2inv-r bss2inv-f bss3dgn-f bss4prb-f bss4prb-r bss5inv-r bss5inv-f bcr1prb-f bcr1prb-r bcr2inv-f bcr2inv-r bssA-f bssA-r bcrB-f bcrB-r a

The The c The d The b

positions positions positions positions

in in in in

GenBank/EMBL/DDBJ GenBank/EMBL/DDBJ GenBank/EMBL/DDBJ GenBank/EMBL/DDBJ

Sequence a

TGGGTCAACGTGCTGTGCA GCCGGATACGCGCACGAT GCATGTCGGCGTAGGACCAG CACCTGGCACGACCTCAACA CCNTGGTGYCAYAAYCCNGARAC GGGTGTCCTTTGCGCTGTCCGTGGTGCCAC GAAGAATTCACAATTATTGCAACTGGTCAT GCCGGTGTCGACTAGGGTTGATGCCCCGGT GAAGCACGCCTCCGCCGGTGAGTTCATCGA GGNATHGACCTSGGSTCSACSACSACSAAG CCNAGNGCNCCNGTRTAGAT AAGGACCAGTTCACCTTCACCGGTGGCGTC GAGACGGGTGTCGATCAGCGCTTCCTGCTT ATGACCGCCAACGTCCTGGAATACCGTGGC TCAGAGGTCGCAATTCAGGAACTCGAGGTC ATGAGCAAGCCTGAAGCCGTCAAAGAGCCG TTACGCGGCCACGGTCTTGGAGCCGCCGCC

8009–8027 9034–9017a 3254–3235b 4015–4034b 5431–5453a 516–545b 1488–1459b 662–633b 1813–1842b 8854–8883c 10115–10096c 4713–4742d 3758–3729d 1661–1690b 4243–4214b 2281–2310d 3582–3553d Data Data Data Data

Library Library Library Library

accession accession accession accession

no. no. no. no.

AJ001848 AB167725 AJ224959 AB167726

Japan) at 30  C. The solvent system used was 0.1% H3 PO4 –methanol (1:1, v/v), at a flow rate of 1.0 ml/ min. Nitrate and nitrite concentrations were measured at 210 nm on a TSKgel IC-Anion PW column (50 by 4.6 mm; Tosoh, Tokyo) at 40  C. The eluent contained 1.3 mM potassium gluconate, 1.3 mM sodium tetraborate, 30 mM borate, 10% (vol/vol) acetonitrile, and 0.5% (vol/vol) glycerol. The flow rate was 1.2 ml/min. The culture fluid was centrifuged at 15;000  g for 10 min, and 10 ml of the diluted supernatant was analyzed. Cloning and sequencing of bss and bcr genes. The primers used in the following analyses of putative metabolic genes are listed in Table 1, and the positions of primers and gene fragments are depicted in Fig. 2. The oligonucleotide primers bss1prb-f and bss1prb-r, derived from the nucleotide sequence of bssA from T. aromatica K172 (accession no. AJ001848), were used for PCR amplification of an internal fragment of the putative benzylsuccinate synthase (bss) gene of strain TS-6 using its chromosomal DNA as a template. The 1.0-kb PCR product, designated bss1, was subsequently cloned and sequenced. The predicted amino acid sequence of bss1 showed 86% identity to that of bssA of strain K172 (data not shown). Bss1 was used as a probe for Southern blotting19) of strain TS-6 chromosomal DNA. A single signal was detected among the Sal I fragments with a size of 3.5 kb, which were amplified by the inverse-PCR method20) with primers bss2inv-r and bss2inv-f, derived from the nucleotide sequence of bss1. The resulting DNA fragment, designated bss2, was cloned and sequenced. The degenerate primer bss3dgn-f was designed on the basis of the nucleic acid sequences of the bssD genes of T. aromatica K172 and T1 (accession nos. AJ001848 and AF113168 respectively), and used with bss2inv-r for PCR to amplify the DNA

fragment next to bss2. The 2.7-kb PCR product, designated bss3, was cloned and sequenced. Part of bss3 was amplified with primers bss4prb-f and bss4prbr, designated bss4, and used as a probe for Southern blotting of strain TS-6 chromosomal DNA. A single signal detected among the 1.8 kb Sph I fragments was amplified by inverse-PCR with primers bss5inv-r and bss5inv-f. The resulting DNA fragment, bss5, was cloned and sequenced. As for the bcr genes, degenerate primers bcr1prb-f and bcr1prb-r were designed based on the nucleic acid sequences of bcrA of T. aromatica K172 and badF of Rhodopseudomonas palustris (accession nos. AJ224959 and U75363 respectively) and used for PCR amplification with chromosomal DNA from strain TS-6 as the template. The predicted amino acid sequence of the 1.2kb PCR product, designated bcr1, showed 73 and 70% identity to the bcrA and badF genes respectively (data not shown). Bcr1 was used as a probe for Southern blotting of strain TS-6 chromosomal DNA. A 4.8-kb Cla I fragment and a 2.5-kb Sac II fragment were detected as single signals among the restriction fragments, and were amplified by inverse-PCR with primers bcr2inv-f and bcr2inv-r, derived from the nucleotide sequence of bcr1. The resulting PCR fragments, designated bcr2 and bcr3 respectively, were cloned and sequenced. Southern hybridizations were carried out using AlkPhos Direct System (Amersham Biosciences, Piscataway, NJ) according to the manufacturer’s instructions. Nucleic acid sequences were determined on both strands using an automated DNA sequencer, Shimadzu DSQ-2000L (Shimadzu, Kyoto, Japan). Analyses of nucleic acid sequences were conducted using GENETYX software (version 6.1.5, GENETYX, Tokyo). Homology searches and phylogenetic analyses of the sequences were conducted as described above.

1486

Y. S HINODA et al.

Fig. 1. Phylogenetic Relationship of Newly Isolated Aromatic-Compound Degrading Strains (bold) and Previously Known Strains of Magnetospirillum Species, Based on 16S rDNA Sequence Comparisons. Representative  Proteobacteria strains are also included, and Escherichia coli is designated as the outgroup of the tree. CC-26 is the phenoldegrading strain previously reported.11) Bar, 1 nucleotide substitution per 10,000 nucleotides. Bootstrap values greater than 700 are shown.

Northern blot analysis. Total RNA of strain TS-6 was extracted from cells at early logarithmic phase, grown under aerobic and anaerobic conditions with toluene, benzoate, or succinate as the sole carbon source, using the NucleoSpin RNA II Mini kit (Macherey-Nagel, Du¨ren, Germany). Portions of the putative bssA and bcrB genes of strain TS-6 were obtained by PCR with specific primers bssA-f and bssA-r, and bcrB-f and bcrB-r, respectively, and were used as DNA probes for Northern blot hybridizations19) using AlkPhos Direct System (Amersham Biosciences). Nucleotide sequence accession numbers. The 16S rDNA sequences of six isolated strains and the nucleotide sequences of the putative bss and bcr genes have been deposited in the DDBJ database under accession nos. AB167719 to AB167726. The strain names and accession numbers of the 16S rDNA sequences used to determine the phylogenetic relationships of the strains are as follows: Aquaspirillum polymorphum, AB000481; Strain CC-26, AB033746; Dechlorospirillum sp. WD, AF170352; Roseospira mediosalina L1-66, AJ000989; Roseospirillum parvum 930I, AJ011919; Phaeospirillum fulvum NCIMB11762, D14433; Rhodobacter capsulatus ATCC11166, D16428; Magnetospirillum magneticum AMB-1, D17514; M. magneticum MGT-1, D17515; Rhodospirillum rubrum ATCC11170, D30778; Rhodopila globiformis DSM161, D86513; Rhodopseudomonas palustris DSM123, L11664; Phaeospirillum fulvum ATCC15798, M59065; Phaeospirillum molischianum

ATCC14031, M59067; Rhizobium leguminosarum bv. viciae USDA2501, U89830; M. gryphiswaldense MSR1, Y10109; M. magnetotacticum MS-1, Y10110; Magnetospirillum sp. MSM-3, Y17389; Magnetospirillum sp. MSM-4, Y17390; Magnetospirillum sp. MSM-6, Y17391; Azospirillum lipoferum, Z29619; Escherichia coli, V00348.

Results Enrichment and isolation of aromatic compounddegrading Magnetospirillum strains Four distinct spiral strains were isolated and determined to belong to the genus Magnetospirillum based on their 16S rDNA sequences. Strains PM1331 and PM2411 were isolated from enrichment cultures grown on phenol. Strains BM1232 and TS-6 were isolated from benzoate- and toluene-grown cultures respectively. A phylogenetic tree of these and related strains is shown in Fig. 1. The sequences are 99.2–99.9% identical among the strains isolated, and they were divided into two groups according to the comparison. Ubiquinone-10 was the major respiratory quinone in all tested strains grown under every condition, and only the aerobic cultures contained 1–3% ubiquinone-9, besides ubiquinone-10. This was in good agreement with the quinone profile of M. magnetotacticum, but different from those of M. gryphiswaldense21) and Phaeospirillum species.22) The G þ C content of strain TS-6 was 63.9%, i.e., close to those of the known Magnetospirillum strains.21,23) These

Anaerobic Degradation of Aromatics by Magnetospirillum spp.

1487

Fig. 2. Schematic Figures of the Putative Benzylsuccinate Synthase (bss) Genes (A) and Benzoyl-CoA Reductase (bcr) Genes Found in Strain TS-6. Only certain restriction sites are indicated above the arrows. Closed triangles indicate the approximate positions of the primers used (see Table 1). Bars below the arrows are gene fragments that were cloned and sequenced.

strains and formerly isolated Magnetospirillum sp. strain CC-26 were deposited in the Japan Collection of Microorganisms (JCM) (Saitama, Japan) under accession numbers JCM12775–12779. Successful isolation using low (0.028 mg/l) iron-ion enrichment medium is consistent with the difference in the growth of Azoarcus sp. strain CC-11 and Magnetospirillum sp. strain CC-26 under iron-limited conditions reported previously.11) Spiral-shaped bacteria did not dominate in the enrichment cultures using high (1.5 mg/l) iron-ion medium with the same soil samples (data not shown). The range of growth substrates differed among the strains, as shown in Table 2. Strains BM1232 and TS-6 grew on toluene anaerobically. Phenol supported anaerobic growth of the PM strains. Benzoate supported aerobic and anaerobic growth of all strains, but none of the strains grew on benzene, xylenes, or ethylbenzene.

The generation times of strain TS-6 growing anaerobically on 1 mM toluene and benzoate with 5 mM nitrate were 14.1 and 12.3 h respectively. The four strains did not show magnetotaxis even after several transfers in the microaerobic semisolid growth medium of M. magnetotacticum MS-1 with magnetic selection.24) Cells formed a thin layer in the semisolid media, indicating the microaerophilic nature of the strains. bss and bcr genes of strain TS-6 A 6.2 kb Sph I–Sal I fragment containing five open reading frames (ORFs) was obtained by genomic Southern blotting probed with part of the putative benzylsuccinate synthase (Bss) genes of strain TS-6 (Fig. 2A). Based on the similarity to the genes identified in T. aromatica K172, they were named bssD, bssC,

1488

Y. S HINODA et al. Table 2. Growth Substrates of Isolated Strains Growth ofa : Substrate

2-Aminobenzoate 3-Aminobenzoate 4-Aminobenzoate Benzaldehyde Benzene Benzoate o-Cresol m-Cresol p-Cresol Ethylbenzene 2-Hydroxybenzoate 3-Hydroxybenzoate 4-Hydroxybenzoate Phenol Phenylacetate Toluene o/m/p/-Xylene a

BM1232

TS-6

PM1331, PM2411

Aerobic conditions

Denitrifying conditions

Aerobic conditions

Denitrifying conditions

Aerobic conditions

Denitrifying conditions

     þ       þ  þ  

þ þ    þ   þ    þ  þ þ 

   þ  þ   þ   þ þ  þ  

þ þ  þ  þ  þ þ   þ þ   þ 

   þ  þ         þ  

þ þ  þ  þ   þ    þ þ þ  

þ, growth; , no growth

bssA, bssB, and bssE respectively, and were predicted to encode an activating enzyme, the , , and  subunits of benzylsuccinate synthase,25) and a putative chaperone,26) respectively. The predicted amino acid sequences of these genes showed 61.4–80.9% identity with those of the corresponding genes from T. aromatica K172.25) Important amino acid residues like the glycyl-radical and active site cysteine in BssA,4) the radical generator of the glycyl radical inserting activase,27) and the Fe–S cluster binding sites25) in BssD were conserved. A 6.1 kb Cla I–Sac II fragment containing six complete and one partial ORF was obtained by Southern blotting probed with putative benzoyl-CoA reductase (Bcr) genes of strain TS-6 (Fig. 2B). They were designated oah, dch, bcrC, bcrB, bcrA, bcrD, and fdx, and were predicted to encode 3-oxo-acyl-CoA hydrolase, dienoyl-CoA hydratase, the , , , and  subunits of benzoyl-CoA reductase, and ferredoxin respectively, based on homology to the genes of T. aromatica K172. The deduced amino acid sequences of these genes showed 60.5–74.7% identity to those of the corresponding genes of T. aromatica K172.28) The binding sites of [4Fe–4S] clusters, ATP binding sites, and adenosinebinding motifs were conserved in BcrA and BcrD.28,29) Expression of the bss and bcr genes The results of Northern blotting analysis (Fig. 3) showed that the putative bss and bcr genes of strain TS-6 were transcribed, and that their transcription was controlled by both the growth substrate and the existence of oxygen. Toluene-degrading bss genes were transcribed only in anaerobic toluene-grown cells, whereas benzoyl-CoA degrading bcr genes were transcribed not only in anaerobic toluene- and benzoate-

grown cells, but also in aerobic benzoate-grown cells. The low yield of bacteria prevented us from determining the lengths of the transcripts and the exact ratio of their amounts under these conditions, but transcription under these conditions was reproducibly detected.

Discussion The results of 16S rDNA sequence comparison indicate that the four strains belong to genus Magnetospirillum and are especially close to M. magnetotacticum MS-1, the type strain of the genus (Fig. 1). Their quinone profiles and G þ C content are consistent with this result. This shows it is not a single strain11) but a group of bacteria that belong to this phylogenetic position of  Proteobacteria and can degrade aromatic compounds under anaerobic denitrifying conditions. Recently, Barragan et al. predicted anaerobic benzoate degradation by M. magnetotacticum MS-1 from its genome sequence and proved it,30) supporting this conclusion. We confirmed the growth of strain MS-1 in microaerobic semisolid growth medium and anaerobic liquid medium with 1 mM of benzoate as the sole carbon source (data not shown). The generation time under anaerobic conditions was 21.2 h. While cells of strain MS-1 grown under these conditions exhibited magnetotaxis, i.e., swarmed to a magnet attached to the wall of the culture tube, the four isolates and formerly isolated strain CC-26 did not. Loss of magnetotaxis has been observed in studies on strain MS-1,24) and an 80 kb chromosomal deletion has been reported in the non-magnetic mutant of M. gryphiswaldense MSR-1.31) Since magnetotaxis is the most important feature of this genus, it is interesting to investigate whether these strains have the so-called magnetosome

Anaerobic Degradation of Aromatics by Magnetospirillum spp.

1489

Fig. 3. Northern Blot Analyses of the bss and bcr Genes Expressed in Strain TS-6 Grown under Aerobic and Anaerobic Conditions with Toluene, Benzoate, or Succinate as the Sole Carbon Source. The 16S rRNA band visualized with ethidium bromide is shown under each lane to show the relative amount of total RNA loaded.

island on their genome. Based on the conserved sequences and the transcriptional patterns, we conclude that the clusters of genes cloned from toluene-degrading strain TS-6 are responsible for the anaerobic toluene and benzoate metabolism of this strain. Genus Magnetospirillum is the fourth genus having the bcr gene, after genera Thauera, Azoarcus ( Proteobacteria), and Rhodopseudomonas ( Proteobacteria), and the fourth genus having the bss gene after Thauera, Azoarcus, and Geobaceter ( Proteobacteria). Anaerobic toluene degradation by a strain of  Proteobacteria has been reported only in a phototrophic Blastochloris strain.32) Expression of the bcr genes during aerobic growth on benzoate was unexpected since purified benzoyl-CoA reductase is highly oxygen-sensitive.33) However, these genes are reported to be translated in trace amounts in aerobically grown T. aromatica K172.34) Benzoyl-CoA has been proposed to be an intermediate of a novel aerobic benzoate oxidation pathway, and putative genes of this pathway have been found on the genome sequence of M. magnetotacticum MS-1.35) Since Magnetospirillum strains are microaerophilic and swarm to

an interface between aerobic and anaerobic environments,36) bcr genes might play an unknown role under aerobic conditions. Detection of the protein and the activity of the enzyme should clarify this point. Phylogenetic trees of currently known bss and bcr genes based on their deduced amino acid sequences are shown in Fig. 4A and B respectively. The genes of Magnetospirillum sp. TS-6 and M. magnetotacticum MS-1 form a distinct lineage among the groups, which supports the thesis that the genus Magnetospirillum forms a distinct third group of anaerobic aromaticdegrading denitrifying bacteria.

Acknowledgments We wish to thank M. Ue´ for experimental assistance, and M. Boll of Freiburg University and T. Matsunaga of Tokyo University of Agriculture and Technology for helpful discussion. This work was supported in part by 21st Century COE Program of the Japanese Ministry of Education, Culture, Sports, Science and Technology, and by grants from the Japanese Ministry of Economy, Trade, and Industry to N.K.

1490

Y. S HINODA et al.

Fig. 4. Phylogenetic Relationship of Known Benzylsuccinate Synthase (bssDCAB) (A) and Benzoyl-CoA Reductase (bcrCDAB) (B) Genes Based on Amino Acid Sequence Comparisons. The deduced amino acid sequence of each gene was connected to one continual sequence. Alignment and calculation of phylogenetic distance were performed with CLUSTALW. Bar, 1 amino acid substitution per 1,000 amino acids. Shortened branch corresponds to an evolutional distance of 1.87.

References 1)

2)

3)

4)

5)

6)

7)

8)

9)

10)

Harwood, C. S., Burchhardt, G., Herrmann, H., and Fuchs, G., Anaerobic metabolism of aromatic compounds via the benzoyl-CoA pathway. FEMS Microbiol. Rev., 22, 439–458 (1999). Heider, J., and Fuchs, G., Anaerobic metabolism of aromatic compounds. Eur. J. Biochem., 243, 577–596 (1997). Schink, B., Philipp, B., and Mu¨ller, J., Anaerobic degradation of phenolic compounds. Naturwissenschaften, 87, 12–23 (2000). Boll, M., Fuchs, G., and Heider, J., Anaerobic oxidation of aromatic compounds and hydrocarbons. Curr. Opin. Chem. Biol., 6, 604–611 (2002). Heider, J., Spormann, A. M., Beller, H. R., and Widdel, F., Anaerobic bacterial metabolism of hydrocarbons. FEMS Microbiol. Rev., 22, 459–473 (1999). Spormann, A. M., and Widdel, F., Metabolism of alkylbenzenes, alkanes, and other hydrocarbons in anaerobic bacteria. Biodegradation, 11, 85–105 (2000). Harwood, C. S., and Gibson, J., Shedding light on anaerobic benzene ring degradation: a process unique to prokaryotes? J. Bacteriol., 179, 301–309 (1997). Elshahed, M. S., and McInerney, M. J., Benzoate fermentation by the anaerobic bacterium Syntrophus aciditrophicus in the absence of hydrogen-using microorganisms. Appl. Environ. Microbiol., 67, 5520–5525 (2001). Elshahed, M. S., Bhupathiraju, V. K., Wofford, N. Q., Nanny, M. A., and McInerney, M. J., Metabolism of benzoate, cyclohex-1-ene carboxylate, and cyclohexane carboxylate by ‘‘Syntrophus aciditrophicus’’ strain SB in syntrophic association with H2 -using microorganisms. Appl. Environ. Microbiol., 67, 1728–1738 (2001). Peters, F., Rother, M., and Boll, M., Selenocysteinecontaining proteins in anaerobic benzoate metabolism of

11)

12)

13)

14)

15)

16)

17)

18)

19)

Desulfococcus multivorans. J. Bacteriol., 186, 2156– 2163 (2004). Shinoda, Y., Sakai, Y., Ue´, M., Hiraishi, A., and Kato, N., Isolation and characterization of a new denitrifying spirillum capable of anaerobic degradation of phenol. Appl. Environ. Microbiol., 66, 1286–1291 (2000). Tschech, A., and Fuchs, G., Anaerobic degradation of phenol by pure cultures of newly isolated denitrifying pseudomonads. Arch. Microbiol., 148, 213–217 (1987). Holt, J. G., and Krieg, N. R., Enrichment and isolation. In ‘‘Methods for General and Molecular Bacteriology’’, eds. Gerhardt, P., Murray, R. G. E., Wood, W. A., and Krieg, K. R., American Society for Microbiology, Washington, D.C., pp. 179–215 (1994). Evans, P. J., Mang, D. T., Kim, K. S., and Young, L. Y., Anaerobic degradation of toluene by a denitrifying bacterium. Appl. Environ. Microbiol., 57, 1139–1145 (1991). Weisburg, W. G., Barns, S., Pelletier, D. A., and Lane, D. J., 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol., 173, 697–703 (1991). Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K., ‘‘Current Protocols in Molecular Biology’’, John Wiley and Sons, New York (1987). Mesbach, M., Premachandran, U., and Whitman, W. B., Precise measurement of the G þ C content of deoxyribonucleic acid by high-performance liquid chromatography. Int. J. Syst. Bacteriol., 39, 159–167 (1989). Hiraishi, A., Ueda, Y., Ishihara, J., and Mori, T., Comparative lipoquinone analysis of influent sewage and activated sludge by high-performance liquid chromatography and photodiode array detection. J. Gen. Appl. Microbiol., 42, 457–469 (1996). Sambrook, J., Fritsch, E. F., and Maniatis, T., Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).

Anaerobic Degradation of Aromatics by Magnetospirillum spp.

20)

21)

22)

23)

24)

25)

26)

27)

Triglia, T., Peterson, M. G., and Kemp, D. J., A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucl. Acids Res., 16, 8186 (1988). Sakane, T., and Yokota, A., Chemotaxonomic investigation of heterotrophic, aerobic and microaerobic spirilla, the Genera Aquaspirillum, Magnetospirillum and Oceanospirillum. System. Appl. Microbiol., 17, 128– 134 (1994). Imhoff, J. F., Petri, R., and Suling, J., Reclassification of species of the spiral-shaped phototrophic purple nonsulfur bacteria of the alpha-Proteobacteria: description of the new genera Phaeospirillum gen. nov., Rhodovibrio gen. nov., Rhodothalassium gen. nov. and Roseospira gen. nov. as well as transfer of Rhodospirillum fulvum to Phaeospirillum fulvum comb. nov., of Rhodospirillum molischianum to Phaeospirillum molischianum comb. nov., of Rhodospirillum salinarum to Rhodovibrio salexigens. Int. J. Syst. Bacteriol., 48, 793–798 (1998). Matsunaga, T., Sakaguchi, T., and Tadokoro, F., Magnetite formation by a magnetic bacterium capable of growing aerobically. Appl. Microbiol. Biotechnol., 35, 651–655 (1991). Blakemore, R. P., Maratea, D., and Wolfe, R. S., Isolation and pure culture of a freshwater magnetic spirillum in chemically defined medium. J. Bacteriol., 140, 720–729 (1979). Leuthner, B., Leutwein, C., Schulz, H., Horth, P., Haehnel, W., Schiltz, E., Schagger, H., and Heider, J., Biochemical and genetic characterization of benzylsuccinate synthase from Thauera aromatica: a new glycyl radical enzyme catalysing the first step in anaerobic toluene metabolism. Mol. Microbiol., 28, 615–628 (1998). Hermuth, K., Leuthner, B., and Heider, J., Operon structure and expression of the genes for benzylsuccinate synthase in Thauera aromatica strain K172. Arch. Microbiol., 177, 132–138 (2002). Sofia, H. J., Chen, G., Hetzler, B. G., Reyes-Spindola, J. F., and Miller, N. E., Radical SAM, a novel protein superfamily linking unresolved steps in familiar biosynthetic pathways with radical mechanisms: functional characterization using new analysis and information visualization methods. Nucl. Acids Res., 29, 1097–1106 (2001).

28)

29)

30)

31)

32)

33)

34)

35)

36)

1491

Breese, K., Boll, M., AltMorbe, J., Schagger, H., and Fuchs, G., Genes coding for the benzoyl-CoA pathway of anaerobic aromatic metabolism in the bacterium Thauera aromatica. Eur. J. Biochem., 256, 148–154 (1998). Hans, M., Sievers, J., Muller, U., Bill, E., Vorholt, J. A., Linder, D., and Buckel, W., 2-hydroxyglutaryl-CoA dehydratase from Clostridium symbiosum. Eur. J. Biochem., 265, 404–414 (1999). Barragan, M. J. L., Diaz, E., Garcia, J. L., and Carmona, M., Genetic clues on the evolution of anaerobic catabolism of aromatic compounds. Microbiology, 150, 2018–2021 (2004). Schu¨bbe, S., Kube, M., Scheffel, A., Wawer, C., Heyen, U., Meyerdierks, A., Madkour, M. H., Mayer, F., Reinhardt, R., and Schu¨ler, D., Characterization of a spontaneous nonmagnetic mutant of Magnetospirillum gryphiswaldense reveals a large deletion comprising a putative magnetosome island. J. Bacteriol., 185, 5779– 5790 (2003). Zengler, K., Heider, J., Rossello-Mora, R., and Widdel, F., Phototrophic utilization of toluene under anoxic conditions by a new strain of Blastochloris sulfoviridis. Arch. Microbiol., 172, 204–212 (1999). Boll, M., and Fuchs, G., Benzoyl-coenzyme A reductase (dearomatizing), a key enzyme of anaerobic aromatic metabolism. ATP dependence of the reaction, purification and some properties of the enzyme from Thauera aromatica strain K172. Eur. J. Biochem., 234, 921–933 (1995). Heider, J., Boll, M., Breese, K., Breinig, S., EbenauJehle, C., Feil, U., Gad’on, N., Laempe, D., Leuthner, B., Mohamed, M. E., Schneider, S., Burchhardt, G., and Fuchs, G., Differential induction of enzymes involved in anaerobic metabolism of aromatic compounds in the denitrifying bacterium Thauera aromatica. Arch. Microbiol., 170, 120–131 (1998). Gescher, J., Zaar, A., Mohamed, M., Schagger, H., and Fuchs, G., Genes coding for a new pathway of aerobic benzoate metabolism in Azoarcus evansii. J. Bacteriol., 184, 6301–6315 (2002). Spormann, A. M., and Wolfe, R. S., Chemotactic, magnetotactic and tactile behaviour in a magnetic spirillum. FEMS Microbiol. Lett., 22, 171–177 (1984).

Suggest Documents