Microbiology (2004), 150, 2221–2227
DOI 10.1099/mic.0.27000-0
Ancient genes of Saccharomyces cerevisiae P. Veiga-Crespo, M. Poza, M. Prieto-Alcedo and T. G. Villa Department of Microbiology, Faculty of Pharmacy, University of Santiago de Compostela, A Corun˜a, Spain
Correspondence T. G. Villa
[email protected]
Received 22 December 2003 Revised 17 March 2004 Accepted 24 March 2004
Amber is a plant resin mainly produced by coniferous trees that, after entrapping a variety of living beings, was subjected to a process of fossilization until it turned into yellowish, translucent stones. It is also one of the best sources of ancient DNA on which to perform studies on evolution. Here a method for the sterilization of amber that allows reliable ancient DNA extraction with no actual DNA contamination is described. Working with insects taken from amber, it was possible to amplify the ATP9, PGU1 and rRNA18S ancient genes of Saccharomyces cerevisiae corresponding to samples from the Miocene and Oligocene. After comparison of the current genes with their ancient (up to 35–40 million years) counterparts it was concluded that essential genes such as rRNA18S are highly conserved and that even normal ‘house-keeping’ genes, such as PGU1, are strikingly conserved along the millions of years that S. cerevisiae has evolved.
INTRODUCTION In the last two decades, studies with fossil DNA have increased considerably as molecular biology techniques have become available in the different fields of enquiry. These studies, however, are subject to serious potential drawbacks because ancient DNA may very easily become contaminated with current DNA and because it is normally degraded. Moreover, studies are often hampered by the uniqueness of the specimens, which evidently cannot be destroyed by DNA extraction. Ancient DNA – although more resistant than RNA – is subject to the degradative action of different exogenous agents (Cano, 1996; Henwood, 1993; Poinar, 1994, 2002; Service, 1996), water being the most important one, plus the action of free radicals and UV light; base conversion phenomena due to hydrolytic deamination are also common. Amber is a mixture of terpenes, organic acids, alcohols and sugars secreted by higher plants (mostly conifers) and has been subject to polymerization and fossilization for millions of years, this affording what is known as amber or retinite. During this process, micro-organisms, pollen, or insects are entrapped and remain in a ‘frozen’ state up until now, as widely reported in the literature (Cano et al., 1992; Cano & Poinar, 1993; DeSalle et al., 1993; Schultz, 2000). The relationships between insects and micro-organisms have been also addressed (Wier et al., 2002).
It is possible to differentiate the origin of amber stones according to their resin composition (Lambert & Poinar, 2002). Thus, conifers are the oldest amber-producing fossils found in Central Europe, whereas members of the Leguminosae produced the amber from Mexico and the Dominican Republic in the Americas (Poinar & Brown, 2002). Recently, new techniques based on NMR have allowed the unambiguous geographic characterization of amber samples (Lambert & Poinar, 2002). The high level of sugars in amber provides a hyperosmotic medium and hence induces sample dehydration. The development of specific procedures for molecular biology such as PCR has to a large extent facilitated studies with ancient DNA in a field already known as ‘molecular palaeontology’. As recovered from amber, ancient DNA is already degraded to a certain extent but this, in turn, facilitates the detection of contamination with current DNA because it is difficult to obtain long-chain amplicons (Handt et al., 1994). ‘JumpingPCR’ may represent another drawback in this type of study (DeSalle et al., 1993; Handt et al., 1994; Taylor, 1996). The inhibitory action of some amber compounds, such as tannic substances, may be overcome by the addition of bovine serum albumin (Pa¨a¨bo, 1990). Initial studies addressed the direct cloning of fossil DNA, but this soon fell into disuse and was replaced by PCR, thus avoiding the undesired DNA repair that occurs in direct cloning (Pa¨a¨bo et al., 1989).
METHODS Amber samples. The present work was carried out with two types
The GenBank accession numbers for the sequences reported in this paper are AY484433, AY484434, AY484435, AY484436 and AY484437.
0002-7000 G 2004 SGM
Printed in Great Britain
of amber stones: (i) amber collected in the Santiago de Los Caballeros Mountains (Dominican Republic), stratigraphically dated as ~15–30 million years old, and (ii) amber collected in Poland and dated as ~40–50 million years old (Poinar, 1992). 2221
P. Veiga-Crespo and others
Table 1. Oligonucleotides used in the present work Gene (source) ATP9 (S. cerevisiae) Fragment I PGU1 (S. cerevisiae) Fragment II PGU1 (S. cerevisiae) Fragment III PGU1 (S. cerevisiae) rRNA18S (S. cerevisiae) Fragment I ATP5 (S. cerevisiae) Fragment II ATP5 (S. cerevisiae) RCBL (Pinus edulis) ODA4 (C. reinhardtii) rRNA16S (Wolbachia spp.) CYTB (mammals)
GenBank accession no.
Forward primer
Reverse primer
Temp (6C)
AF114937
ATGCAATTAGTATTAGCAGC
TTATACACCGAATAATAATAAG
55
NC_001142
ATGATTTCTGCTAATTCACTTATT
AACCCATCCGTATTATGTCCAC
55
NC_001142
AAGCAGTGGTACTACTGTTACG
TTAACAGCTTGCACCAGATCCA
64
NC_001142
AAGCAGTGGTACTACTGTTACG
AACCCATCCGTATTATGTCCAC
54
NC_001144
TATCTGGTTGATCCTGCCAGT
TCCTTGGATGTGGTAGCCGT
65
NC_001136
ATGTTTAATAGAGTCTTTACC
GGAAAGACCTTCAATAGG
54
NC_001136
GAAAATAACAGACTGGGATG
TTAAATGCTGTCCTCTAAGA
57
X58137
ATGTCACCAAAAACAGAGAC
CCATATTTGTTCAATTTATCTC
56
U02963
TGCCTGTGCATCACGCCCCT
GCGGTTGAACTCGTCGAAGCA
64
AJ422184
CGTAGGCGGATTAGTAAGTTAAA
CACGACACGAGCTGACGACA
64
Universal primers CCATCCAACATCTCAGCATGATGAAA GCCCCTCAGAATGATATTTGTCCTCA
Sterilization and opening of the amber. The accomplishment
of surface sterilization and the opening of the amber were generally as recommended by Lambert et al. (1998). Sterilization was accomplished by a thorough surface wash with sterile water. Then, the samples were maintained in 2 % glutaraldehyde (Merck) at 40 uC for 48 h and subjected to periodic ultrasonic treatment (30 min). Following this, the stones were incubated in the presence of 10 % CaCl2 (Merck) at 25 uC for 24 h and also ultrasonicated. Finally, they were incubated in 70 % ethanol (Merck) at 22 uC for 24 h and again subjected to ultrasonication. Once frozen in liquid N2, the stones were ground in a sterile mortar. The powder was resuspended in liquid brain heart infusion (BHI) broth (Pronadisa), aliquotted and stored at 280 uC until use.
55
1 cycle of 5 min at 94 uC, 35 cycles of 1 min at 94 uC, 30 s at X uC (where X depended on the oligonucleotide pair) and 1 min at 72 uC. The process was completed with one cycle of 10 min at 72 uC. For each amplification cycle, the appropriate controls were conducted using each primer alone. Extraction of PCR products and sequence analyses. PCR
products were purified using the Wizard PCR Purification Systems Kit (Promega) and sequence analyses were performed using the BLAST 2.0 application (Altschul et al., 1997) from the National Center for Biotechnology Information. Phylogenetic relationships, specific rates of nucleotide substitution, and alignments were established with the CLUSTALW program included in the VectorNTI Advanced v. 9.0 (Informax) program.
DNA extraction. DNA from S. cerevisiae was prepared using the
Wizard Genomic DNA Purification System (Promega). DNA from Chlamydomonas reinhardtii was prepared as indicated at www. biology.duke.edu/chlamy/methods/dna.html and DNA from Pinus edulis was extracted with the DNeasy Plant Mini Kit (Qiagen). Fossil DNA from amber stones was prepared using the Ancient DNA Kit (GeneClean; Bio 101). The powdered stones were resuspended in 10 ml 0?5 M EDTA (Merck), 200 ml 10 % SDS (Merck) and 200 ml Proteinase K (20 mg ml21; Fluka) and kept at 37 uC for 15 h. After this, the kit instructions were followed. Oligonucleotides and amplification techniques. The oligo-
nucleotides used to amplify ancient DNA are listed in Table 1. The amplification reaction mixture was as follows: 1 U Taq polymerase (Takara Shuto), 2 ng BSA ml21 (Promega), 0?5 mM each oligonucleotide (Invitrogen), 2 mM MgCl2 (Takara Shuto), 0?2 mM dNTPs mix (Takara Shuto), 50 ng fossil DNA, Taq polymerase buffer (Takara Shuto) and deionized sterile water to a final volume of 50 ml. When the ODA4 gene was to be amplified, the MgCl2 concentration was 1?5 mM. The reaction was carried out using a Robocycler Gradient 96 (Stratagene) and the programme was: 2222
Controls of contamination. Working surfaces were periodically treated with ethanol (70 %) and before and after each work session they were treated with 10 % sodium hypochlorite (Merck). All culture media were maintained for 15 days at 21, 30 and 37 uC before use. All solutions used to sterilize the amber stone surfaces were previously filtered through 0?22 mm membranes (three times) that had been treated against microbial contamination. Before stone grinding, the samples were incubated in liquid BHI medium and subjected to the same temperature cycle to discard any possible contamination. After grinding, microbial contamination was investigated again. The solutions used in DNA extraction and PCR were periodically controlled for fortuitous contamination. Throughout the process, particular care was taken to not use glassware or equipment that had previously been in contact with current DNA.
RESULTS AND DISCUSSION PCR-gene amplification in ancient samples such as those found in fossil amber must be accompanied by Microbiology 150
Ancient genes of S. cerevisiae
strict sterilization procedures from the very beginning of stone manipulation right up to the final DNA amplification to avoid contamination with present-day DNA (Handt et al., 1994; Taylor, 1996). Here, the
procedure described by Lambert et al. (1998), modified as specified in Methods, was adopted throughout and yielded the best results as regards control of contamination.
Fig. 1. DNA alignments between ancient and current gene sequences. (a) ATP9 alignment; (b) rRNA18S alignment; (c) fragment III of PGU1 alignment. http://mic.sgmjournals.org
2223
P. Veiga-Crespo and others
Six powdered aliquots were prepared from each amber stone and one of them was used to test the sterilization status by inoculation in both BHI broth and solid medium. Although Austin et al. (1997) have reported different methods suitable for amber DNA extraction, in our hands the commercial kit for fossil DNA extraction was very effective, affording samples of fair purity and also avoiding problems during amplification. Extraction efficiency was about 20 ng DNA ml21 and purity (A260/A280) was 1?6; although both these parameters varied from stone to stone, it was observed that younger samples yielded more DNA than older ones. The approaches to sequence validity must be established a priori and must not be changed during the course of the work. In this case, the following criteria were adopted: (i) DNA was extracted only from stones that had passed all the contamination checks; (ii) samples from the same stones had to show similar results; (iii) ancestral sequences had to show homology with current ones and had to display phylogenetic coherence; and (iv) large DNA fragments (longer than 1 kb) had to be discarded to avoid either sample contamination with current DNA or jumping-PCR phenomena. Based on direct observation of the stones employed in the present work, the entrapped insects strongly resembled ants. As happens in today’s insects, yeast cells are mainly associated with the legs and possibly the lower parts of the body, hence being transported from plant to plant. Other yeast strains detected here were probably indigenous to the plant. All these yeast strains plus the insects were finally entrapped and subjected to amberization. Genes essential for the organisms were chosen as a means to ensure pressure through natural selection, so that the amplified DNA could be easily recognized in comparison with present-day genes. It was not possible to amplify whole genes, except for ATP9 from S. cerevisiae. For the remaining genes, intra-ORF oligonucleotides had to be synthesized. Thus, for the rRNA18S gene from S. cerevisiae, the oligonucleotides flanked the coding region 1–420 bp. For the ATP5 gene of this yeast, two oligonucleotide couples were synthesized flanking coding regions from nt 1 to 330 (fragment I) and from nt 331 to the end of the coding region (fragment II). For the PGU1 gene of S. cerevisiae, three oligonucleotide couples were used: fragment I (from nt 1 to 542 of the coding region), fragment II (from nt 192 to the end of the coding region) and fragment III (an internal sequence that goes from nt 192 to 542 of the coding region). The oligonucleotides for the RCBL gene (large subunit of RuBisCo) of Pinus edulis flanked nucleotides 1–500 of the coding region and the oligonucleotides of the rRNA16S gene of Wolbachia sp. flanked nucleotides 501–1000 of the coding region. In the case of the gene ODA4 from C. reinhardtii, the oligonucleotides were synthesized to specifically amplify the region encoding the GK4 region of the dynein heavy bchain. This is a highly conserved and small sequence (Mitchell & Brown, 1994). The oligonucleotides reported by Kocher et al. (1989) for mammal cytochrome c were used. 2224
All the oligonucleotides described above are shown in Table 1. It was possible to amplify the complete S. cerevisiae ATP9 mitochondrial gene (230 bp) in samples both from the Dominican Republic and from Poland. It was not possible, however, to amplify the whole PGU1 gene but, instead, fragments I, II and III in younger samples; older samples only allowed the amplification of fragment III. Regarding the rRNA18S genes from S. cerevisiae and RCBL from Pinus edulis (data not shown), it was only possible to amplify 500 bp and always in the youngest samples (i.e. amber from the Dominican Republic). It was not possible to amplify the nuclear ATP5 gene from S. cerevisiae, the GK region of ODA4 from C. reinhardtii, or the mammalian CYTB and
Table 2. Similarity (%) between present-day and fossil DNA sequences (a) ATP9 from S. cerevisiae
Current ATP9 Miocene ATP9 Oligocene ATP9
Current ATP9
Miocene ATP9
Oligocene ATP9
100
59 100
40 74 100
(b) Rebuilt Miocene PGU1 gene Actual PGU1
Miocene PGU1
100
69 100
Actual PGU1 Miocene PGU1
(c) Fragment III of PGU1 gene
Current fragment III PGU1 Miocene fragment III PGU1 Oligocene fragment III PGU1
Current fragment III PGU1
Miocene fragment III PGU1
Oligocene fragment III PGU1
100
43
32
100
39 100
(d) rRNA18S gene
Current rRNA18S (500 bp) Miocene rRNA18S
Current rRNA18S (500 bp)
Miocene rRNA18S
100
65 100
Microbiology 150
Ancient genes of S. cerevisiae
rRNA16S from Wolbachia. Although we cannot categorically rule out the (remote) possibility of contamination with current fungal DNA, we are confident that the controls introduced along the sterilization process were sufficient for us to be able to disregard such a notion. Consensus sequences were elaborated with all these ancient sequences (GenBank accession nos: AY484433, AY484434, AY484435, AY484436 and AY484437). At least six different amplicons had to be collected to obtain good sequence resolution. Thus, it was possible to establish a consensus sequence for the ATP9 gene of S. cerevisiae for both the Miocene and Oligocene. Length variation in the sequences was not taken into account because the end portions of the
sequences were completely discarded, not only since they showed a high variation index but also because they showed a high sequence indetermination index. Next, the consensus sequences of ancient genes were compared with those of current genes to see the degree of similarity and coherence (Fig. 1). In this sense, ancient ATP9 from the Miocene exhibited 59 % similarity as compared to the current gene whereas the fragment from the Oligocene showed 40 % similarity. Upon comparing both ancient sequences, a similarity of 74 % was observed (Table 2a). In the case of the ancient PGU1 gene, it was possible to rebuild almost the complete gene sequence from the Miocene samples by assembling fragments I, II and III. The sequences showed 69 % homology with the present-day one (Table 2b).
Fig. 2. Phylogenetic trees. (a) ATP9 gene; (b) PGU1 gene; (c) rRNA18S gene. http://mic.sgmjournals.org
2225
P. Veiga-Crespo and others
Fragment III from the Oligocene had 32 and 39 % homology with the current one and Miocene one, respectively (Table 2c). The consensus sequences for the Miocene rRNA18S gene from S. cerevisiae showed 65 % homology with the present-day one (Table 2d). The next step was to perform a phylogenetic analysis (Fig. 2) using the neighbour-joining method with the lowest possible number of evolutionary events. Ambiguous residues were resolved as ‘gaps’ and greater importance was given to nucleotide substitution (especially transversion) than insertion/deletion events. After that analysis, it was concluded that the variability of the S. cerevisiae ATP9 gene is greater between the current and Miocene sequences than between the Oligocene and the Miocene sequences (Table 2a). When the phylogenetic tree was plotted (Fig. 2a), it was seen that the sequences corresponding to different Saccharomyces species were all clustered on the same branch and were clearly differentiated from other organisms. In the case of PGU1 (Fig. 2b), the ancient genes are clustered on the same branch and chronologically and logically grouped together with the current gene; the origin of this gene for both plants and Saccharomyces must be sought in an ancestor older than our Oligocene samples. The rRNA18S phylogenetic tree (Fig. 2c) again revealed that the branch grouping S. cerevisiae and the Miocene sequence appeared separated from the rest, thus suggesting an older origin, except for Pichia segobiensis, Tetrapisispora nanseiensis and Arxiozyma telluris. The degree of gene sequence conservation was not the same for the different genes studied (Table 2). In the case of S. cerevisiae, a higher conservation value for the ATP9 and rRNA18S genes than for the PGU1 gene should be expected; the first two are assumed to have been subjected to greater evolutionary pressure than the latter. The results, however, were the opposite (Table 2). One explanation for this could be that the PGU1 and rRNA18S genes are nuclear while ATP9 is located mitochondrially and the specific mutation rate is different in both genomes (higher for mitochondrial genes). Traditional studies propose either 2 % genomic variation per million years for two lineages separated by less than 10 million years, or 161028 nucleotide substitution per nucleotide site per year for mitochondrial DNA (Avise, 1994). Thus, the tendency in the specific mutation rates for these extranuclear genomes is exponential, after which a plateau is reached (the genome is saturated in the variable substitution sites). These assumptions apply mainly for organisms with long doubling times, although they also seem to apply for S. cerevisiae, which has a short generation time. The highest intersequence divergences occurred during the last 10 million years and the highest homology would lie among the older sequences. This phenomenon may be ascribed to the fact that the amber samples were from different geoclimatic regions of the planet. It is now quite 2226
clear that work done with fossil DNA extracted from amber, such as described here, may shed light onto the precise aspects involved in the genetic differentiation of species. Future research will include an expansion of the number of genes studied in S. cerevisiae – both nuclear and mitochondrial – in more closely related (both in time and space) amber samples.
ACKNOWLEDGEMENTS The authors wish to express their gratitude to the Ramon Areces Foundation of Madrid and Dr J. Barros for the CYTB primers. They also thank Dr J. Civis from Salamanca University for helping with stone dating.
REFERENCES Altschul, S. F., Madden, T. L., Scha¨ffer, A. A., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids Res 25, 3389–3402. Austin, J. J., Ross, A. J., Smith, A. B., Fortey, R. A. & Thomas, R. H. (1997). Problems of reproducibility – does geologically ancient DNA
survive in amber-preserved insects? Proc R Soc Lond B Biol Sci 264, 467–474. Avise, J. C. (1994). Molecular Markers, Natural History and Evolution. New York: Chapman & Hall. Cano, R. J. (1996). Analysing ancient DNA. Endeavour 20, 162–167. Cano, R. J. & Poinar, H. N. (1993). Rapid isolation of DNA from
fossil and museum specimens suitable for PCR. BioTechniques 15, 432–436. Cano, R. J., Poinar, H. N. & Poinar, G. O., Jr (1992). Isolation and
partial characterisation of DNA from the bee Proplebeia dominicana (Apidae: Hymenoptera) in 25–40 million year old amber. Med Sci Res 20, 249–251. DeSalle, R., Barcia, M. & Wray, C. (1993). PCR jumping in clones of
30-million-year-old DNA fragments from amber preserved termites (Mastotermes electrodominicus). Experientia 49, 906–909. Handt, O., Hoss, M., Krings, M. & Pa¨a¨bo, S. (1994). Ancient DNA:
methodological challenges. Experientia 50, 524–529. Henwood, A. (1993). Recent plant resins and the taphonomy of
organisms in amber: a review. Mod Geol 19, 35–59. Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Pa¨a¨bo, S., Villablanca, F. X. & Wilson, A. C. (1989). Dynamics of mitochondrial
DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci U S A 86, 6196–6200. Lambert, J. B. & Poinar, G. O., Jr (2002). Amber: the organic
gemstone. Acc Chem Res 35, 628–636. Lambert, L. H., Cox, T., Mitchell, K., Rossello-Mora, R. A., Del Cueto, C., Dodge, D. E., Orkand, P. & Cano, R. J. (1998).
Staphylococcus succinus sp. nov., isolated from Dominican amber. Int J Syst Bacteriol 48, 511–518. Mitchell, D. R. & Brown, K. S. (1994). Sequence analysis of the
Chlamydomonas alpha and beta dynein heavy chain genes. J Cell Sci 107, 635–644. Pa¨a¨bo, S. (1990). Amplifying ancient DNA. In PCR Protocols.
A Guide to Methods and Applications, pp. 159–166. Edited by Microbiology 150
Ancient genes of S. cerevisiae M. A. Innis, D. Gelfand, J. Sninsky & T. White. San Diego: Academic Press.
Poinar, H. N. (2002). The genetic secrets some fossils hold. Acc Chem
Res 35, 676–684.
Pa¨a¨bo, S., Higuchi, R. G. & Wilson, A. C. (1989). Ancient DNA
Service, R. F. (1996). Just how old is that DNA, anyway? Science
and the polymerase chain reaction. The emerging field of molecular archaeology. J Biol Chem 264, 9709–9712.
272, 810.
Poinar, G. O., Jr (1992). Life in Amber. Stanford: Stanford University
Press. Poinar, G. O. (1994). The range of life in amber: significance and
implications in DNA studies. Experientia 50, 536–542.
Schultz, T. R. (2002). In search of ant ancestors. Proc Natl Acad Sci U S A 97, 14028–14029. Taylor, P. G. (1996). Reproducibility of ancient DNA sequences from extinct Pleistocene fauna. Mol Biol Evol 13, 283–285.
Poinar, G. O., Jr & Brown, A. E. (2002). Hymenaea mexicana sp. nov.
Wier, A., Dolan, M., Grimaldi, D., Guerrero, R., Wagensberg, J. & Margulis, L. (2002). Spirochete and protist symbionts of a termite
(Leguminosae: Caesalpinoideae) from Mexican amber indicates Old World connections. Bot J Linn Soc 139, 125–132.
(Mastotermes electrodominicus) in Miocene amber. Proc Natl Acad Sci U S A 99, 1410–1413.
http://mic.sgmjournals.org
2227
