Eur J Nutr DOI 10.1007/s00394-012-0449-7
ORIGINAL CONTRIBUTION
Calcitriol [1, 25[OH]2 D3] pre- and post-treatment suppresses inflammatory response to influenza A (H1N1) infection in human lung A549 epithelial cells Drirh Khare • Nachiket M. Godbole • Shailesh D. Pawar • Vishwa Mohan • Gaurav Pandey • Sushil Gupta • Deepak Kumar Tapan N. Dhole • Madan M. Godbole
•
Received: 29 April 2012 / Accepted: 14 September 2012 Ó Springer-Verlag Berlin Heidelberg 2012
Abstract Purpose Influenza viruses infect airway epithelial cells, causing respiratory distress. Immune defense is maintained by chemokine/cytokine secretions from airway epithelial cells. While moderate inflammatory response protects from ill effects, hyper-inflammatory response promotes the pathogenesis. High circulating levels of vitamin D are known to mitigate effects of infectious diseases, including respiratory infectious diseases. The question whether and how vitamin D treatment pre-/post-viral exposure modulates inflammatory response is not clear. The present study was undertaken to understand autophagy/apoptosis balance and chemokine/cytokine response to influenza A (H1N1) infection by pre- and post-1, 25-dihydroxyvitamin D3 (1,25[OH]2 D3)[calcitriol] treatment of human lung A549 epithelial cells. Methods Influenza A (H1N1) virus was propagated in A549 cell line, titrated using hemagglutination assay, and was used to assess effect of calcitriol. After confirming that 100 nM of calcitriol fails to clear virus, A549 cells were
D. Khare V. Mohan G. Pandey S. Gupta M. M. Godbole (&) Department of Endocrinology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014, India e-mail:
[email protected] N. M. Godbole T. N. Dhole Department of Microbiology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014, India S. D. Pawar National Institute of Virology, Pune 411021, India D. Kumar Department of Immunology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014, India
either pre-treated (16 h) with 100 nM or post-treated with 30 nM of 1,25[OH]2 D3 of virus inoculation (1 h). Cells after incubation at 37 °C under 5 % CO2 for 48 h were collected and subjected to RNA and protein extraction. Measurements of viability, influenza M protein, and molecular parameters of cell death and inflammatory response were performed. Results We report that treatment of these cells with 100/30 nM of 1,25[OH]2 D3 prior to/or post-H1N1 exposure does not affect viral clearance but significantly reduces autophagy and restores increased apoptosis seen on H1N1 infection back to its constitutive level. However, it significantly decreases the levels of H1N1-induced TNF-a (tumor necrosis factor-alpha), IFN-b (interferon-beta), and IFN-stimulated gene-15 (ISG15). 1,25[OH]2 D3 treatment prior to/or post-H1N1 infection significantly down-regulates IL-8 as well as IL-6 RNA levels. These results demonstrate that calcitriol treatment suppresses the H1N1induced transcription of the chemokines RANTES and IL-8 in epithelial cells. Conclusion The findings provide support for the initiation of vitamin D supplementation program to VDD populations in reducing the severity of influenza. Keywords Vitamin D Influenza A (H1N1) Cytokines Chemokines Inflammatory response
Introduction Worldwide epidemics of influenza A and B occur regularly and affect large segments of the world’s population. Influenza A viruses cause yearly epidemics due to antigenic drift, punctuated by infrequent pandemics following antigenic shift [1]. H1N1 subtype of swine influenza
123
Eur J Nutr
lineages has continued to circulate in humans and raised severe concerns about pandemic developments [2]. Highly pathogenic avian influenza (HPAI) A (H5N1) viruses continue to pose a serious threat to global public health [3]. The significant role of H1N1 subtype in the evolution of new viruses with pandemic potential is well known [4]. Its replication is mainly restricted to epithelial cells in the respiratory tract with the lung being the major target organ [5]. H1N1 influenza manifests itself with an incubation period of 1–3 days, followed by recovery period limited to 6 or 7 days after infection [6]. During the acute phase of the disease, H1N1 subtype induces an overwhelming and simultaneous pro-inflammatory cytokines in the lungs of infected animals [7]. During influenza infection, proinflammatory cytokines such as IL-1, TNF-a, and IFN-b are secreted by infected cells and immune cells to sustain inflammatory response [8]. However, uncontrolled inflammation can have detrimental consequences in the form of pulmonary edema and often death. The synergy between TNF-a and IFN-b results in a more pronounced IFN and pro-inflammatory cytokine response after H5N1/ H1N1 infection, and the massive up-regulation of these cytokines tips the balance in favor of a hyper-inflammatory response [9]. The response to both viruses is characterized by a strong chemokine/cytokine response, inflammation, a response to viral RNA, the involvement of TNF superfamily signaling pathways, and apoptosis, but the response elicited by H5N1 was greater than that induced by H1N1 virus. One of the prevention goals of influenza infection is to suppress hyper-inflammatory response. Anti-viral response to influenza is mounted by chemokines such as RANTES that act on immature monocytes and T cells circulating in the bloodstream, recruiting them to the site of infection. The monocyte differentiation-inducing (MDI) factor, for example interleukin (IL)-6, tumor necrosis factor (TNF)-a, and interferon (IFN)-b, acts on the recruited monocytes, resulting in differentiation into well-matured activated macrophages capable of phagocytosing apoptotic cell debris resulting from the viral infection [10]. Vitamin D is increasingly recognized as a pluripotent hormone that can modulate immune responses with functions that extend beyond its classical role in calcium homeostasis [11]. Epidemiologic studies have suggested a correlation between vitamin D concentrations and the incidence of respiratory infections, including influenza [12, 13]. There are well-documented seasonal variations in 25-hydroxyvitamin D (vitamin D) concentrations [14, 15]. The winter predominance of influenza correlates with a decrease in circulating vitamin D levels and explains seasonal variation in the incidence of viral respiratory tract infections like influenza [14, 16]. In case of respiratory syncytial virus, vitamin D has been found to inhibit NF-kB signaling, which could result in decreased viral
123
clearance, lessened inflammatory responses via inhibition of type I IFN signaling and chemokines, or both [11]. However, the question whether the supplementation of vitamin D can modulate the inflammatory response to H1N1 influenza infection to bring its beneficial effects is yet to be resolved. The present study was undertaken in A549 human lung carcinomatous epithelial cells that express low levels of 1a-hydroxylase to look at the modulatory effects of pre- and post-supplementation of 1, 25-OH vitamin D supplementation on strong chemokine/ cytokine response to H1N1 infection. A549 cells are used instead of type II alveolar epithelial cells due to former’s ability to adhere, retain phenotype during multiple passages, and express MHC-I at its surface. The study results suggest that both pre- and post-supplementation of 1, 25-OH vitamin D lessens the hyper-inflammatory response through down-regulation of chemokine/cytokine expression.
Materials and methods Reagents 1, 25 Dihydroxyvitamin D3 (1,25[OH]2 D3) was obtained from Sigma-Aldrich (St. Louis, MO). IFN-b was purchased from PBL Interferon Source (Piscataway, NJ, USA). ELISA kits for TNF-a, IL-1b, and IL-6 were procured from BD Bioscience Pharmigen, San Diego, CA (no. 550610, 559111, 550799, and 550999, respectively). The following primary antibodies were obtained from the cell signaling technology: beclin; 3738S, and beta actin; 4967. Vitamin D stock solution: 1, 25[OH]2 D3 (SigmaAldrich) was dissolved in ethanol to make a working stock at a concentration of 20 lM. For experiments in a 6-well plate, 235 ll of 1, 25[OH]2 D3 stock was added to 3 ml of culture medium to give a final concentration of 10 lM. Cells and cell culture conditions The human alveolar epithelial cell line A549 and the Madin– Darby canine kidney (MDCK) cell line were purchased from the National Centre for Cell Sciences (NCCS), Pune, India. A549 cells and MDCK cells were cultured in minimal essential medium (MEM) (Sigma) supplemented with 10 % FBS, 1 % pen/strep, 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (Gibco) and 0.2 % bovine serum albumin faction V (BSA) (Gibco). Cells were grown in T-75 tissue culture flasks (Corning) at 37 °C with 5 % CO2. Cells with passage number between 3 and 10 were used for experiments.
Eur J Nutr
Virus propagation
Vitamin D pre- and post-treatment in A549 cell line
The ability to isolate and propagate influenza virus is essential for studies, such as antigenic and antiviral sensitivity analyses. Madin–Darby canine kidney (MDCK) cells, however, have proved to be the easiest to handle, the most sensitive, and the most reliable cell line and remain the standard cell line for influenza virus propagation. Influenza A H1N1 virus strain was isolated in the year 2009, which is similar to A/Brisbane/59/2007 kindly provided by the National Institute of Virology, Pune, India. This virus was grown in [90 % confluent MDCK cells. A volume of 200 ll influenza virus was inoculated and incubated for 1 h at 37 °C under 5 % CO2 for adsorption of virus to cells. Tissue culture flasks containing virus inoculum and 5 ml of DMEM containing 2 lg/ml of tosyl phenylalanyl chloromethyl ketone (TPCK)-treated trypsin without calf serum were then incubated at 37 °C for 4–6 days. The flasks were observed daily for cytopathic effect (CPE). Cell cultures were harvested when *75 % of the total cells in the monolayer showed CPE. The tissue culture supernatants (TCF) were tested by hemagglutination (HA) assay using 0.5 % fowl red blood cells (RBCs) [17]. The TCF was aliquoted and stored at -70 °C and was used as virus stock for further experiments.
The A549 cells were checked in inverted microscope at 40 X magnification. After the confluent growth of A549 cells (75–90 %) in 96-well plates [for (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT) assay)], cells were incubated with 100 nM 1, 25[OH]2 D3 for 16 h before virus inoculation, and for post-treatment of 30 nM 1, 25[OH]2 D3, were added after 1-h virus adsorption. The dosage of 100 and 30 nM of 1, 25[OH]2 D3 for cell treatment was based on earlier findings [18] showing inverse relationship of circulating vitamin D (25(OH)D) levels and prevalence of acute respiratory diseases (ARD) in Indian children wherein it was shown that less than 5 % children suffer from ARD if the levels of 25(OH)D C 50 nM. Higher dose of 100 nM was used for priming the cells prior to infection, while lower dose of 30 nM was used to treat in already infected cells to overcome the deficiency. For virus adsorption, a volume of 500 ll of 1:10 time diluted influenza virus (H1N1) of 64 HAU titer, was inoculated and incubated for 1 h at 37 °C under 5 %. After 1 h, the virus containing medium was removed, and infected cells were maintained in minimal essential media without FBS. Cells were incubated at 37 °C under 5 % CO2 for 48 h. Cells grown in 96-well plates after washing were used to perform MTT assay. Based on MTT assay results, the above treatment modality was repeated in separate experiments conducted in T-25 or T-75 culture flasks using only 100 nM of 1, 25[OH]2 D3 for pre-treatment and 30 nM of 1, 25[OH]2 D3 for post-infection of cells. Cells were incubated at 37 °C under 5 % CO2 for 48 h. Media collected after incubation were used for estimation of secreted cytokines (IL6, IL1-b, and TNF-a). The washed cells were used for extraction of protein and RNA. These were used for performing Western blotting and real-time PCR, respectively. The cells obtained from similar experiments performed in 6-well plates were used to analyze sub-G1 peak by flow cytometry.
Hemagglutination (HA) assay A549 cells were grown in 96-well flat-bottom plates to obtain monolayer of 80 % confluency. Cells are then inoculated with 1/10 dilution of virus stock maintained at 1/64 HA unit. Unabsorbed virus is removed, and cells are washed with serum-free medium. 1, 25[OH]2 D3 stock was serially diluted in serum-free culture medium to prepare working stock solution. Two hundred microliter of diluted 1, 25[OH]2 D3 was added to each well to give a final concentration of 1,000 nM and serially down to 0.1 nM. After 72 h, 100 ll media is removed from each well, and HA assay was performed. Briefly, 50 ll of PBS was taken in all wells of the microtiter plates. U-bottom plates were used for the HA assays. In the first row, 50 ll of the test sample was taken and serially diluted by transferring 50 ll from the first well to the successive well and so on. Fifty microliter of the 0.75 % of type ‘‘O’’ human erythrocyte suspension was added to each well on the plate. Cell control and virus control were kept in the same plate. Plate was incubated at room temperature (RT). Titers were read after 60 min. Hemagglutination units (HAU) were expressed as the reciprocal of the maximum dilution of virus that resulted in complete agglutination [17].
MTT assay MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a yellow tetrazole) is reduced to purple formazan in living cells. MTT reagent (Sigma-Aldrich) was used according to the manufacturer’s instructions. MTT solution was stored at - 20 °C and thawed prior to the assay. A total of 10,000 A549 cells were seeded per 200 ll per well of a 96-well flat-bottom plate. It was observed for 48 h till 90 % confluency was achieved. H1N1 influenza stock was diluted tenfold with serum-free MEM. Fifty microliter of respective virus dilutions were added to each
123
Eur J Nutr
well pre-treated with 1, 25[OH]2 D3. Vitamin D was also added to virus-infected cells after 1 h of infection for post-treatment analysis. After 48 h of virus infection for pretreatment and 48 h of 1, 25[OH]2 D3 treatment for postinfection, 100 ll of MTT reagents were added. After 1- to 1.5-h incubation at 37 °C, 100 ll of acidic isoproponal was added to each well to stop the reaction. The light absorbance at 570 nm was measured by a 96-well plate reader. RNA extraction and real-time PCR Total RNA was isolated from the A549 cells after washing twice with phosphate-buffered saline (PBS) and harvested with TRIzol reagent (Invitrogen, San Diego, CA, USA) according to the supplier’s protocol. RNA quality and quantity were determined by gel electrophoresis and photometry. Total RNA (2 lg) was reverse-transcribed to cDNA using Thermo Script RT–PCR kit. Briefly, RNA was reverse-transcribed in cDNA with oligo (dT) primers and 200 U of Superscript II (Invitrogen) following manufacturer’s instructions. Real-time analysis for RANTES, IL-6, IL-8, IFN-b, IkB, ISG15, VDR, inf-M, and normalizing gene HPRT was performed using SYBR Green Master Mix as per the manufacturer’s instruction (Applied Biosytems). This technique continuously monitors the cycle-by-cycle accumulation of fluorescently labeled PCR product. Briefly, cDNA corresponding to 100 ng of RNA served as a template in a 20-ll reaction mixture containing 4 mM MgCl2, 0.2 nM (each) primer, and 10 ll FastStart DNA Master SYBR Green mix (ABI). Samples were loaded into 96-well plate format and incubated in the Table 1 Primer sequences for quantitative PCR
Cellular protein Whole-cell protein extracts were prepared by lysis of cell monolayers in harvested in T75 flasks. Lysis buffer, besides other ingredients, contained protein and phosphatase inhibitors (50 mM Tris [pH 7.4], 50 mM NaCl, 0.5 mM EDTA, 1 mM EGTA, 0.1 %SDS, and 1 % Triton-x100, 0.2 % protease inhibitor cocktail, 1 mM PMSF, 2 mM NaF, and 2.5 mM sodium pyrophosphate). The harvested cells were collected and treated with 20 ul of lysis buffer and vortexed. The lysates were sonicated for 20 s and kept at 4 °C for 30 min. After 5 min of centrifugation (3,000 rpm at 4 °C), the supernatant was saved as a whole-cell lysate. BD OptEIA ELISA Human inflammation marker ELISA kit (BD Biosciences, San Diego, CA, USA) was used to estimate IL-6, TNF-a, and IL-1b according to the manufacturer’s instruction manual. In brief, required numbers of wells were coated
Target gene
Direction
Sequence
RANTES
Forward
50 GGCACGCCTCGCTGTCATCCTCA30
Reverse
50 CTTGATGTGGGCACGGGGCAGTG30
Forward
50 GTGTGAAGGTGCAGTTTTGCCAAGG30
Reverse
50 GCACCCAGTTTTCCTTGGGGTCC30
Forward
50 TCCACAAGCGCCTTCGGTCCAG30
Reverse
50 CTCAGGGCTGAGATGCCGTCG30
Forward
50 TGGGAGGCTTGAATACTGCCTCAA30
Reverse
50 TCCTTGGCCTTCAGGTAATGCAGA30
Forward
50 AACCTGCAGCAGACTCCACT30
Reverse
50 TCCTGAGCATTGACATCAGC30
Forward
50 CTGAGAGGCAGCGAACTCATCTTT30
Reverse
5’AATCTTCTGGGTGATCTGCGCCTT30
Forward
50 TGAAGCGGAAGGCACTATTCACCT30
Reverse
50 ACTCCTTCATCATGCCGATGTCCA30
Influenza A Matrix (M)
Forward Reverse
50 ATGAGYCTTYTAACCGAGGTCGAAACG30 50 TGGACAAANCGTCTACGCTGCAG30
HPRT
Forward
50 GCAGACTTTGCTTTCCTTGG30
Reverse
50 AAGCAGATGGCCACAGAACT30
IL8 IL6 IFNb IkBa ISG15 VDR
123
fluorescence thermocycler 7500 (ABI System). Initial denaturation at 95 °C for 10 min was followed by 45 cycles, each cycle consisting of 95 °C for 15 s, touchdown of 1 °C/ cycle from the primer-specific starting to ending annealing temperatures for 5 s, and 60 °C for 10 s. The primer sequences used for specific genes are listed in Table 1. All quantifications were normalized to the housekeeping HPRT gene, which showed a very stable expression in A549 cells. Fold changes in gene expression were calculated using 2-DDCT method.
Eur J Nutr
with 100 ll of capture antibody in coating buffer, and plates were sealed and incubated overnight at 4 °C. Next day, liquid phase from plates was aspirated, and wells were washed three times with 300 ll/well wash buffer. Residual wash solution was removed by inverting the plates on blotting paper. Wells were incubated at room temperature (RT) for 1 h after addition of 200 ll of blocking solution; then, wash steps as above were repeated thrice. Hundred microliter each of pre-diluted standards, controls, and supernatant media from cell culture were pipetted in duplicate in respective wells and incubated at RT for 2 h. After repeating washing step, 100 ll of working detector (specific enzyme labeled antibody conjugate) is added to each well, and sealed plates are incubated at RT for 1 h. After repeating wash step, 100 ll of substrate solution is added to each well, and sealed plates are incubated for 30 min at RT in the dark followed by addition of 50 ll of stop solution. After 30 min, absorbance is first measured first at 570 nm and then at 450 nm wavelength. 570 nm readings are subtracted from 450 nm reading, and a standard curve is plotted. The amount of cytokine in the culture medium sample was calculated from the standard curve generated by the human inflammation standards. The sensitivities and linear ranges of the cytokine OptEIA human ELISA were as follows: IL-6, sensitivity 10 pg/ml, range 4.7–300 pg/ml; TNF-a, sensitivity 20 pg/ml, range 7.8–500 pg/ml; and IL-1b sensitivity, 15.0 pg/ml range 3.9–250 pg/ml. Western blot analysis Fifty microgram of whole-cell lysate proteins were resolved on 12 % sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto nitrocellulose membrane in electro-transblot apparatus (Amersham Biosciences, Buckinghamshire, UK). Membranes were incubated with primary antibody. Rabbit polyclonal anti-beclin-1 antibody and b-actin antibodies were from Cell Signaling Technology. The bands were detected by using horseradish peroxidaseconjugated secondary antibodies to primary immunoglobulin using enhanced chemiluminescence system (Amersham Biosciences). Densitometry analysis was performed using Image J software. Statistical analysis When two groups were compared, we used a two-tailed Student’s t-test. To compare three or more groups, we used repeated measures ANOVA followed by Bonferroni’s method to control for multiple comparisons. Data are presented as mean ± SEM. p values of, 0.05 were considered statistically significant.
Results Phase contrast picture of A549 cells (10X) demonstrates cytopathic effect after 48 h of infection with H1N1 (1/64 HA unit) (Fig. 1a). Influenza A (H1N1) virus grew in A549 cell lines and titers of 64 HA units were obtained. The effect of various vitamin D concentrations on ability of H1N1 growth/replication was estimated using HA assays. HA titers of H1N1 virus with various concentrations of vitamin D were monitored. The results show that vitamin D dosage had effects on viral replication only at dose of 1,000 nM (Fig. 1b). Since this anti-viral concentration of 1,25[OH]2 D3 represents an un-physiological dose, we thought it not prudent to test higher dose of 1,25[OH]2 D3 but to focus on ascertaining the effects of physiological dosage of 1,25[OH]2 D3 on inflammatory response. We also checked for the effect of vitamin D treatment on viability of A549 cells when infected with H1N1 virus. While a significant reduction in cell viability was observed in H1N1-infected cells as compared to non-infected cells, vitamin D-treated cells both prior to and post-infection did not alter the cell viability that occurs in absence of vitamin D-treated cells (Fig. 1c). Since influenza M protein directly reveals to virus replication and recent report showed influenza M protein to be essential for inflammasome activation [19], we checked the effect of vitamin D treatment on influenza M protein mRNA levels. The results showed a significantly reduced level of mRNA expression on treatment with vitamin D (Fig. 1d). Much more significant down-regulation was observed when the cells were exposed to vitamin D prior to H1N1 infection as compared to post-treatment H1N1-infected cells. We also checked whether vitamin D treatment affects mode of cell death and whether it shifts the balance in favor of apoptotic cell death from autophagy. Though results from Western blot does show significant decrease in beclin-1 levels on vitamin D pre- or post-treatment and significantly altered Sub G1 peak (Fig. 2a, b), the results taken in totality indicate that vitamin D treatment does restore constitutive apoptosis seen in uninfected cells. Decrease in influenza M protein levels on prior to and post-treatment of cells on infection indicated that vitamin D may modulate immune response of cells rather than affecting its clearance. The significant increase in levels of stimulatory cytokines TNF-a, IL-6, and IL-1b on H1N1 infection was observed indicating hyper-responsiveness to H1N1 (Fig. 3a–c). Significant down-regulation of the stimulatory cytokines was observed when cells were either pre-treated with vitamin D or cells exposed to vitamin D post-infection with H1N1. It indicates down-regulation of hyper-responsiveness toward H1N1 infection.
123
Eur J Nutr
Fig. 1 a Phase contrast picture of A549 cells (10X) after 48 h of infection with H1N1 (1/64 HA unit) demonstrates cytopathic effect. b HA titer shows that dose of 1, 25[OH]2 D3 up to 500 nM fails to clear the virus. c Viability of H1N1-infected cells by MTT analysis shows significant reduction compared to uninfected cells. Reduction is unaffected by either dose or mode of vitamin treatment. d Influenza
M mRNA measured in A549 cells after pre- or post-treatment of 1, 25[OH]2 D3. HPRT was used as internal controls for target gene expression, and data are expressed as mean of triplicate samples ± S.E. Significant down-regulation in expression of influenza M in both vitamin pre- and post-treatment was observed
Significant increase in stimulatory cytokines like TNF-a and IL-6 may lead to enhancement of IFN-b and its target gene ISG15. Since ISG15 participates in augmentation of cell defense via cytokines and chemokines like RANTES and IL-8, we assessed the effect of H1N1 infection and effect of vitamin D treatment on A549 cells. The present study results showed significant fold rise in mRNA expression of these cytokines/chemokines on H1N1
infection of A549 cells (Fig. 4). More than twofold reduction of RANTES, IL-6, and IL-8 mRNA levels on treatment of either infected cells with vitamin D or postinfection treatment of these cells with vitamin D was observed (Fig. 4a–c). Similarly, enhancement of IFN-b and its target gene ISG15 showed significant reduction in 1, 25[OH]2 D3 pre-treated cells (Fig. 4d, e). However, enhanced levels of IFN-b and ISG15 registered further
123
Eur J Nutr
Fig. 2 a Autophagy inhibiting property of 1, 25[OH]2 D3. Expression levels of beclin-1 was measured by Western blot in A549 cellular protein after pre- or post-treatment of 1, 25[OH]2 D3. b-Actin was used as internal control for expression, and data are expressed as mean of triplicate samples ± S.E. While vitamin treatment alone has
no effect, significant down-regulation in expression of beclin-1 in both vitamin pre- and post-treatment was observed in H1N1-infected cells. b Flow cytometry analysis of Sub G1 peak using propidium iodide staining indicates that a significant increase in H1N1 infection is reduced to constitutive level seen in uninfected A549 cells
Fig. 3 Anti-inflammatory properties of 1, 25[OH]2 D3. Expression levels of a IL-6, b TNF-a, and c IL-1b were measured by ELISA in A549 cellular protein after pre- or post-treatment of 1, 25[OH]2 D3.
Data are expressed as mean of triplicate samples ± S.E. Significant down-regulation in expression of IL-6, TNF-a, and IL-1b in both vitamin pre- and post-treatment was observed in H1N1-infected cells
123
Eur J Nutr
Apart from tight control of viral replication/survival, it is well documented that modulation of inflammatory response through treatment with anti-inflammatory agent can effectively reduce clinical complications and optimize
recovery in virus-infected patients. Adequate immune response launched either through enhanced circulating cytokine/chemokine or external therapeutic agents can help to arrest viral replication and clearance. A weak nutritional profile is known to result in elicitation of hyper-inflammatory response and poor clearance of viral load leading to morbidity and death [20]. In past, poor immune response improvement by supplementation with a combination of multiple vitamin/trace element formula has been reported [21]. Following reports that influenza epidemics have a correlation with seasonal vitamin D-deficient states [22] and its supplementation has a potential to augment the lung host defense against RSV [23, 24], attention has now been focused on improvising vitamin D nutrition to downsize the inhibiting inflammatory response. The results of present study show that calcitriol (1, 25[OH]2 D3) treatment either prior to or post-infection of lung A549 epithelial cells with H1N1 modulates the inflammatory response without altering the anti-viral status or cell death. Our results show that calcitriol treatment neither alters viral level nor affects
Fig. 4 Anti-inflammatory properties of 1, 25[OH]2 D3. Expression levels of mRNA depicted for a RANTES, b IL-6, c IL-8, d IFN-b, e ISG15, and f VDR were measured in A549 cells after pre- or posttreatment of 1, 25[OH]2 D3. HPRT was used as internal controls for target gene’s mRNA expression, and data are expressed as mean of
triplicate samples ± S.E. Significant down-regulation in expression of RANTES, IL-6, IL-8, and VDR in both vitamin pre- and posttreatment was observed. Expression for IFN-b and ISG15 was significantly up-regulated only under post-vitamin treatment condition
significant increase when post-infection cells are treated with 1, 25[OH]2 D3 (Fig. 4d, e). This enhanced level IFNb and ISG15 in post-treatment situation is reflected in greater degree of fall in inflammatory cytokines RANTES, IL-6, and IL-8 compared to pre-treatment group (Fig. 4a–c). The finding that VDR mRNA levels register a significant decrease on pre- or post-1, 25[OH]2 D3 treatment is contrary to its known effect in humans (Fig. 4f). In summary, the present study indicated that H1N1infected cells responded to vitamin D treatment to reduce the hyper-inflammatory response during infection without affecting the viral clearance or cell death in any manner.
Discussion
123
Eur J Nutr
cell viability on H1N1 infection. These results are similar to the one reported for RSV infection [23, 24]. Since host defense is related to autophagy, apoptosis, and the influenza virus M2 protein [25, 26], we examined the relationship between influenza M proteins and beclin-1. The results show significant induction of influenza M protein mRNA on H1N1 infection of A549 cells. Both pre-treatment and post-infection treatment with calcitriol in infected cells show a significant decrease in both influenza M proteins mRNA and beclin-1 protein expression level on treatment with calcitriol. However, calcitriol pre- and posttreatment fails to completely abolish beclin-1 protein and indicates a partial inhibition of autophagy. Sub G1 peak analysis indicates that apoptosis is significantly increased by H1N1 infection. It is reduced by calcitriol treatment to constitutive level seen in uninfected A549 cells. The results suggest that calcitriol treatment does not conclusively shift the balance in favor of apoptosis in spite of reduction in autophagy. It may explain unaltered viral levels and cell viability. This cell death response to influenza virus may be cell type specific [27]. Seeing the down-regulation of influenza M protein on treatment with calcitriol, we then focused attention on quantifying inflammatory response components. The result of present study indicates sustained up-regulation of TNF-a, IL-6, IL-8, IL-1 b, and interferon (IFN-b) in A549 cells infected with H1N1. This correlates well with comparative gene expression profiles in A549 cells as well primary human macrophages after infection with H5N1 and H1N1 virus wherein it is reported that infection elicits a quantitatively synergistic stronger host inflammatory response including type I interferon (IFN) and tumor necrosis factor (TNF)-a genes [2, 4]. We further show that pre-treatment with calcitriol significantly decreases IFN-b and TNF-a expression levels when A549 cells exposed to H1N1 infection (Figs. 3, 4). We also examined its effect on TNFa-mediated enhanced production of IL-6, a cytokine of innate immunity, its principal targets being the liver cells, the b cells, and the naı¨ve T cells [28], and found a significant down-regulation of this cytokine in A 549 cells on calcitriol treatment. Despite the apparently beneficial role that macrophages play in controlling early viral replication, several reports have demonstrated a more deleterious effect of these cells in influenza A viral infections by excessive inflammation in the lung attributed to IL-6 and TNF-a [29]. IL-8 is a chemokine of innate immunity. The chemokine’s principal biologic effect is chemotaxis, being a major chemokine for neutrophil activation, and migration into tissues [30]. It was found that calcitriol treatment significantly down-regulated IL-8 mRNA expression in A 549 cells. Delayed clearance of viral load and marked cytokine activation in severe cases of pandemic H1N1 2009 influenza virus infection have been recently reported [31]. Increased
severity and higher mortality have also been correlated with enhanced levels of IL-6 and IL-8 [32]. Examination of cytokine/chemokine production in A549 epithelial cells infected with influenza A/H1N1 virus (PR-8) suggests that TNF-a may regulate RANTES production followed by increase in IL-6, IL-8, and MCP-1 and IFNs levels in the initial step [33]. Significantly, calcitriol down-regulates whole cascade of this hyper-inflammatory response. Proinflammatory chemokine RANTES has been reported to play a crucial role in the progression of chronic inflammation in airway after viral infection. Herein, we found that vitamin D supplementation significantly inhibited H1N1induced RANTES accumulation in A549 cells without any obvious harmful effect on cell viability and did not directly possess antiviral activity (Fig. 4). Significant RANTES inhibitory effect was found on both prior to and postinfection status of cells. The role of vitamin D in innate immunity is increasingly recognized. Locally produced vitamin D is believed to have important immuno-modulatory effects. The studies reported here examine the antiviral host response in A549 cells to H1N1 infection and the role of 1, 25-dihydroxyvitamin in modulating this response. These alveolar epithelium cells have lost the ability to activate vitamin D but retain the immune response machinery [34]. Drugs that prevent leukocyte invasion by interfering with RANTES secretion may serve as potential agents for interrupting the pathogenesis after viral infection [35]. One important IFN-stimulated gene that encodes an ubiquitin-like protein is IFN-stimulated gene-15 (ISG15). Our results indicate that while vitamin D sufficiency obtained by cells prior to H1N1 infection significantly reduces expression of both IFN-b and ISG15, however, post-infection vitamin D treatment further significantly increased both IFN-b and ISG15 levels. Enhanced level of IFN-b and ISG15 in post-treatment situation is in consonance with greater degree of fall in inflammatory cytokines RANTES, IL-6, and IL-8 compared to pre-treatment group. This can also be explained by the fact that ISG15 is one of the earliest ISG induced by type I IFN and has been shown to target several components of the antiviral signaling pathway [36]. Since many actions of vitamin D are perceived to be through its nuclear receptor, we estimated alterations of VDR mRNA levels. The findings of significant increase in VDR mRNA in response to H1N1 infection and its subsequent decrease on treatment with 1, 25[OH]2 D3 were quite surprising, especially the latter one in view of its known up-regulatory role in expression of VDR both in vivo and in vitro [37]. H1N1 infection resulting in VDR rise can be explained by similar rise seen in early monocyte hyper-responsiveness through first-line defense provided by Toll-like receptors. Vitamin D3 has been shown to down-regulates monocyte TLR expression and triggers
123
Eur J Nutr
hyporesponsiveness to pathogen-associated molecular patterns [38]. Thus, VDR down-regulation may be one of the ways to ensure hyporesponsiveness to pathogens. How 1, 25[OH]2 D3 effects this down-regulation of VDR is not known. Such down-regulation of VDR in response to 1, 25[OH]2 D3 has also been seen in ROS 17/2.8 cells as well as rat tibial chondrocytes under some stressful conditions and has been shown to be mediated by PTH [39, 40]. The possibility that some of the cytokines released as first-line response to H1N1 may mediate down-regulation of VDR in a manner similar to PTH to reduce hyper-responsiveness may be a possibility that needs to be tested. Notably, these studies were performed using A549 cells, type II alveolar cells that represent the distal bronchiolar and alveolar epithelium of human to evaluate the host cell response to H1N1 infection. Thus, these findings have important implications in understanding the mechanisms linked to H1N1 disease pathogenesis and treatment. A recent prospective cohort study strongly suggests that maintenance of a 25-hydroxyvitamin D serum concentration of 38 ng/ml or higher should significantly reduce the incidence of acute viral respiratory tract infections and the burden of illness caused thereby, at least during the fall and winter in temperate zones [41]. Clinical vitamin D deficiency (manifested by rickets and osteomalacia) and subclinical deficiency (without such skeletal phenotypes) afflict a large number of individuals at all ages globally. Vitamin D deficiency has been widely reported in South Asian countries where infectious diseases are prevalent. Thus, there could be a causal link between the vitamin D deficiency and vulnerability to infectious diseases. The findings of the present study provide direction for and call for future interventional studies examining the efficacy of vitamin D supplementation in reducing the incidence and severity of specific viral infections, including influenza, in the general population and in subpopulations with lower 25-hydroxyvitamin D concentrations, such as pregnant women, dark skinned individuals, and the obese. The study results support the advocacy of vitamin D fortification to eradicate the widespread deficiency of this pluripotent nutrient as a means to tip the balance in favor of a downsizing the hyper-inflammatory response to infections in general and influenza in particular. It is needless to add that in vivo proof of concept in mice adapted to H1N1 is required for making a definite recommendation in this regard. Acknowledgments We wish to acknowledge Dr. R. Deolankar for initiation of study, and Dr. A. C. Mishra and Dr. M. S. Chadha for supply of influenza strain (both from National Institute of Virology, Pune). The study was supported by Life Science Research Board, DRDO, Government of India grant (MMG) No.LSRB/212/2010-2011. Conflict of interest interest.
123
None of the authors had any conflicts of
References 1. Rao BL, Yeolekar LR, Kadam SS, Pawar MS, Kulkarni PB, More BA, Khude MR (2005) Influenza surveillance in Pune, India, 2003. Southeast Asian J Trop Med Public Health 36:906–909 2. Geiss GK, Salvatore M, Tumpey TM, Carter VS, Wang X, Basler CF, Taubenberger JK, Bumgarner RE, Palese P, Katze MG, Garcia-Sastre A (2002) Cellular transcriptional profiling in influenza A virus-infected lung epithelial cells: the role of the nonstructural NS1 protein in the evasion of the host innate defense and its potential contribution to pandemic influenza. Proc Natl Acad Sci USA 99:10736–10741 3. Chakrabarti AK, Pawar SD, Cherian SS, Koratkar SS, Jadhav SM, Pal B (2009) Characterization of the Influenza A H5N1 Viruses of the 2008–09 Outbreaks in India Reveals a Third Introduction and Possible Endemicity. PLoS ONE 4(11):e7846 4. Li Y, Zhou H, Wen Z, Wu S, Huang C, Jia G, Chen H, Jin M (2011) Transcription analysis on response of swine lung to H1N1 swine influenza virus. BMC Genom 12:398 5. Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team. Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, Garten RJ, Gubareva LV, Xu X, Bridges CB, Uyeki TM (2009) Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med 360:2605–2615 6. Kyriakis CS, Olsen CW, Carman S, Brown IH, Brookes SM, Doorsselaere JV, Reeth KV (2010) Serologic cross-reactivity with pandemic (H1N1) 2009 virus in pigs, Europe. Emerg Infect Dis 16(1):96–99 7. Loving CL, Brockmeier SL, Vincent AL, Palmer MV, Sacco RE, Nicholson TL (2010) Influenza virus co-infection with Bordetella bronchiseptica enhances bacterial colonization and host responses exacerbating pulmonary lesions. Microb Pathog 49:237–245 8. Jo SK, Kim HS, Cho SW, Seo SH (2007) Pathogenesis and inflammatory responses of swine H1N2 influenza viruses in pigs. Virus Res 129:64–70 9. Ghosh S, May MJ, Kopp EB (1998) NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 16:225–260 10. Lee SM, Gardy JL, Cheung CY, Cheung TKW, Hui KPY, Ip NY, Guan Y, Hancock REW, Peiris JS (2009) Systems-level comparison of host-responses elicited by avian H5N1 and seasonal H1N1 influenza viruses in primary human macrophages. PLoS ONE 4(12):e8072 11. Uchide N, Toyoda H (2011) Antioxidant therapy as a potential approach to severe influenza-associated complications. Molecules 16:2032–2052 12. Hansdottir S, Monick MM, Hinde SL, Lovan N, Look DC, Hunninghake GW (2008) Respiratory epithelial cells convert inactive vitamin D to its active form: potential effects on host defense. J Immunol 181:7090–7099 13. Hansdottir S, Monick MM, Lovan N, Powers L, Gerke A, Hunninghake GW (2010) Vitamin D decreases respiratory syncytial virus induction of NF-kappaB-linked chemokines and cytokines in airway epithelium while maintaining the antiviral state. J Immunol 184:965–974 14. Grant WB (2008) Variations in vitamin D production could possibly explain the seasonality of childhood respiratory infections in Hawaii. Pediatr Infect Dis J 27:853 15. Ginde AA, Mansbach JM, Camargo CA (2009) Association between serum 25-hydroxyvitamin D level and upper respiratory tract infection in the Third National Health and Nutrition Examination Survey. Arch Intern Med 169:384–390 16. Cannell JJ, Vieth R, Umhau JC, Holick MF, Grant WB (2006) Epidemic influenza and vitamin D. Epidemiol Infect 134: 1129–1140
Eur J Nutr 17. Ziegler T, Hall H, Sanchez-Fauquier A, Gamble WC, Cox NJ (1995) Type- and subtype-specific detection of influenza viruses in clinical specimens by rapid culture assay. J Clin Microbiol 33:318–321 18. Wayse V, Yousafzai A, Mogale K, Filteau S (2004) Association of subclinical vitamin D deficiency with severe acute lower respiratory infection in Indian children under 5 y. Eur J Clin Nutr 58:563–567 19. Ichinohe T, Pang IKS, Iwasaki A (2010) Influenza virus activates inflammasomes via its intracellular M2 channel. Nat Immunol 11(5):404–410 20. Cunningham-Rundles S, McNeeley DF, Moon A (2005) Mechanisms of nutrient modulation of the immune response. J Allergy Clin Immunol 115:1119–1128 21. Allsup SJ, Shenkin A, Gosney MA (2002) Difficulties of recruitment for a randomized controlled trial involving influenza vaccination in healthy older people. Gerontology 48:170–173 22. Cannell JJ, Zasloff M, Garland CF, Scragg R, Giovannucci E (2008) On the epidemiology of influenza. Virol J 5:29 23. Hansdottir S, Monick MM, Hinde SL, Lovan N, Look DC, Hunninghake GW (2008) Respiratory epithelial cells convert inactive vitamin D to its active form: potential effects on host defense. J Immunol 181:7090–7099 24. Hansdottir S, Monick MM, Lovan N, Powers L, Gerke A, Hunninghake GW (2010) Vitamin D decreases respiratory syncytial virus induction of NF-kappaB-linked chemokines and cytokines in airway epithelium while maintaining the antiviral state. J Immunol 184:965–974 25. Rossman JS, Lamb RA (2009) Autophagy, apoptosis, and the influenza virus M2 protein. Cell Host Microbe 6:299–300 26. Zhou Z, Jiang X, Liu D, Fan Z, Hu X, Yan J, Wang M, Gao GF (2009) Autophagy is involved in influenza A virus replication. Autophagy 5(3):321–328 27. Gannage M, Dormann D, Albrecht R, Dengjel J, Torossi T, Ra¨mer PC, Lee M, Strowig T, Arrey F, Conenello G, Pypaert M, Andersen J, Garcı´a-Sastre A, Mu¨nz C (2009) Matrix protein 2 of influenza A virus blocks autophagosome fusion with lysosomes. Cell Host Microbe 6:367–380 28. Korn T, Oukka M, Kuchroo V, Bettelli E (2007) Th17 cells: effector T cells with inflammatory properties. Semin Immunol 19:362–371 29. McGill J, Heusel JW, Legge KL (2009) Innate immune control and regulation of influenza virus infections. J Leukoc Biol 86:803–812 30. Miossec P, Korn T, Kuchroo VK (2009) Interleukin-17 and Type 17 helper T cells. N Engl J Med 361:888–898 31. To KK, Hung IF, Li IW, Lee KL, Koo CK, Yan WW, Liu R, Ho KY, Chu KH, Watt CL, Luk WK, Lai KY, Chow FL, Mok T,
32.
33.
34.
35.
36. 37.
38.
39.
40.
41.
Buckley T, Chan JF, Wong SS, Zheng B, Chen H, Lau CC, Tse H, Cheng VC, Chan KH, Yuen KY (2010) Pandemic H1N1 Study Group. Delayed clearance of viral load and marked cytokine activation in severe cases of pandemic H1N1 2009 influenza virus infection. Clin Infect Dis 50:850–859 Hagau N, Slavcovici A, Gonganau DN, Oltean S, Dirzu DS, Brezoszki ES, Maxim M, Ciuce C, Mlesnite M, Gavrus RL, Laslo C, Hagau R, Petrescu M, Studnicska DM (2010) Clinical aspects and cytokine response in severe H1N1 influenza A virus infection. Crit Care 14:203 Phung TT, Sugamata R, Uno K, Aratani Y, Ozato K, Kawachi S, Nguyen LT, Nakayama T, Suzuki K (2011) Key role of RANTES (regulated upon activation normal T-cell expressed and secreted), nonstructural protein1 and myeloperoxidase in cytokine storm induced by influenza virus PR-8(A/H1N1) infection in A549 bronchial epithelial cells. Microbiol Immunol 55:874–884 Uchide N, Toyoda H (2011) Antioxidant therapy as a potential approach to severe influenza-associated complications. Molecules 16:2032–2052 Mark NK, Leung CY, Wei XY, Shen XL, Wong RNS, Leung KN (2004) Inhibition of RANTES expression by indirubin in influenza virus infected human bronchial epithelial cells. Biochem Pharmacol 67:167–174 Kunzi MS, Pitha PM (2003) Interferon targeted genes in host defense. Autoimmunity 36:457–461 Healy KD, Vanhooke JL, Prahl JM, DeLuca HF (2005) Parathyroid hormone decreases renal vitamin D expression in vivo Proc. Natl Acad Sci USA 102:4724–4728 Sadeghi K, Wessner B, Laggner U, Ploder M, Tamandl D, Friedl J, Zu¨gel U, Steinmeyer A, Pollak A, Roth E, Boltz-Nitulescu G, Spittler A (2006) Vitamin D3 down-regulates monocyte TLR expression and triggers hyporesponsiveness to pathogen-associated molecular patterns. Eur J Immunol 36:361–370 Reinhardt TA, Horst RL (1990) Parathyroid hormone downregulates 1,25-dihydroxyvitamin D receptors (VDR) and VDR messenger ribonucleic acid in vitro and blocks homologous up-regulation of VDR in vivo. Endocrinology 127:942–948 Klaus G, May T, Hu¨gel U, Von EB, Rodriguez J, Fernandez P, Reichrath J, Ritz E, Mehls O (1997) Parathyroid hormone prevents 1,25 (OH)2D3 induced down-regulation of the vitamin D receptor in growth plate chondrocytes in vitro. Kidney Int 52: 45–51 Sabetta JR, DePetrillo P, Cipriani RJ, Smardin J, Burns LA, Landry ML (2010) Serum 25-hydroxyvitamin D and the incidence of acute viral respiratory tract infections in healthy adults. PLoS ONE 5(6):e11088
123
