Androgen Control of Gene Expression in the ... - Semantic Scholar

Androgen Control of Gene Expression in the Mouse Meibomian Gland Frank Schirra,1,2 Tomo Suzuki,1,2 Stephen M. Richards,1 Roderick V. Jensen,3 Meng Liu,1,2 Michael J. Lombardi,3 Patricia Rowley,3 Nathaniel S. Treister,1,4 and David A. Sullivan1,2 PURPOSE. In prior work, it has been found that the meibomian gland is an androgen target organ, that androgens modulate lipid production within this tissue, and that androgen deficiency is associated with glandular dysfunction and evaporative dry eye. This study’s purpose was to test the hypothesis that the androgen control of the meibomian gland involves the regulation of gene expression. METHODS. Meibomian glands were obtained from orchiectomized mice that were treated with placebo or testosterone for 14 days. Tissues were processed for the analysis of differentially expressed mRNAs by using gene bioarrays, gene chips, and real-time PCR procedures. Bioarray data were analyzed with GeneSifter software (VizX Labs LLC, Seattle, WA). RESULTS. The results show that testosterone influenced the expression of more than 1590 genes in the mouse meibomian gland. This hormone action involved a significant upregulation of 1080 genes (e.g., neuromedin B), and a significant downregulation of 518 genes (e.g., small proline-rich protein 2A). Some of the most significant androgen effects were directed toward stimulation of genes associated with lipid metabolism, sterol biosynthesis, fatty acid metabolism, protein transport, oxidoreductase activity, and peroxisomes. CONCLUSIONS. These findings demonstrate that testosterone regulates the expression of numerous genes in the mouse meibomian gland and that many of these genes are involved in lipid metabolic pathways. (Invest Ophthalmol Vis Sci. 2005;46: 3666 –3675) DOI:10.1167/iovs.05-0426

R

ecently, researchers have demonstrated that androgens regulate the meibomian gland,1–3 which is the primary tissue involved in maintaining tear film stability and preventing tear film evaporation.4 – 6 Androgens modulate meibomian gland function, improve the quality and/or quantity of lipids produced by this tissue, and promote the formation of the tear film’s lipid layer.1,7,8 Moreover, androgen deficiency, such as occurs during menopause, aging, Sjo ¨ gren’s syndrome, com-

From the 1Schepens Eye Research Institute, and the 2Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts; the 3 Department of Physics, University of Massachusetts, Boston, Massachusetts; and the 4Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts. Supported by Grants EY05612, K16, and EY12523; Allergan, Inc., (Irvine, CA), and German Research Society (Deutsche Forschungsgemeinschaft) Grants SCHI 562/1-1 and 1-2. Submitted for publication April 4, 2005; revised May 25, 2005; accepted August 15, 2005. Disclosure: F. Schirra, None; T. Suzuki, Allergan, Inc. (F); S.M. Richards, None; R.V. Jensen, None; M. Liu, Allergan, Inc. (F); M.J. Lombardi, None; P. Rowley, None; N.S. Treister, None; D.A. Sullivan, Allergan, Inc. (C, F) The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact. Corresponding author: David A. Sullivan, Schepens Eye Research Institute, 20 Staniford Street, Boston, MA 02114; [email protected].

3666

plete androgen insensitivity syndrome, and the use of antiandrogen medications,9 –11 is associated with meibomian gland dysfunction, altered lipid profiles in meibomian gland secretions, tear film instability, and evaporative dry eye.2,3,12–14 These findings are very significant, given that scant information exists concerning the physiological control of this tissue and that meibomian gland dysfunction is the major cause of evaporative dry eye syndromes throughout the world.15 However, the mechanism(s) underlying this androgen influence on meibomian gland lipogenesis and function is unknown. It is possible that the hormonal regulation of this tissue is analogous to that of sebaceous glands, given that the meibomian gland is a large sebaceous gland and that androgens control the development, differentiation, and lipid production of these glands throughout the body.16,17 Androgen effects on sebaceous glands are mediated primarily through hormone binding to androgen receptors within acinar cell nuclei.17–19 This receptor interaction leads to increased gene transcription and the elaboration of proteins that stimulate the synthesis and secretion of lipids.17–20 In many sebaceous glands, androgen activity is also enhanced by, or dependent on, the presence of 5␣-reductase, an enzyme that converts testosterone into the potent androgen, 5␣-dihydrotestosterone.17 Consistent with this possibility are the findings that meibomian glands of males and females contain androgen receptor mRNA, androgen receptor protein within acinar epithelial cell nuclei, and the mRNAs for both types 1 and 2 5␣-reductase.21,22 Given these observations, we hypothesized that the androgen control of the meibomian gland, as with other sebaceous glands, involves the regulation of gene expression. The purpose of the present study was to test this hypothesis.

MATERIALS

AND

METHODS

Animals and Hormone Treatment Young adult BALB/c mice (n ⫽ 5–22/group), which had been orchiectomized at 8 to 9 weeks of age by veterinary surgeons, were purchased from Taconic Laboratories (Germantown, NY). Animals were housed in constant-temperature rooms with fixed light– dark intervals of 12 hours. Mice were allowed to recover from surgery for at least 9 days, were anesthetized intraperitoneally with ketamine and xylazine, and received subcutaneous implants of placebo (cholesterol, methyl cellulose, lactose)- or testosterone (10 mg)-containing pellets in the subscapular region. These pellets were obtained from Innovative Research of America (Sarasota, FL) and were designed for the slow, but continual, release of vehicle or physiological amounts of hormone over a 21-day period. After 2 weeks of treatment, mice were killed by CO2 inhalation, and the upper- and lower-lid meibomian glands were removed under direct visualization with a biomicroscope and immediately frozen in liquid nitrogen. All studies with experimental animals were approved by the Institutional Animal Care and Use Committee of The Schepens Eye Research Institute and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Molecular Biological Procedures To determine the effect of testosterone on meibomian gland gene expression, total RNA was isolated from tissues by using TRIzol reagent Investigative Ophthalmology & Visual Science, October 2005, Vol. 46, No. 10 Copyright © Association for Research in Vision and Ophthalmology

Androgen Control of the Meibomian Gland

IOVS, October 2005, Vol. 46, No. 10 (Invitrogen Corp., Carlsbad, CA). When indicated, samples were also exposed to RNase-free DNase (Invitrogen), analyzed spectrophotometrically at 260 nm to determine concentration and examined on 6.7% formaldehyde/1.3% agarose (Gibco/BRL, Grand Island, NY) gels to verify RNA integrity. The RNA samples were then processed by utilizing several different technical approaches. The principle method to evaluate differential gene expression involved the use of CodeLink Uniset Mouse I Bioarrays (⬃10,000 genes; Amersham, Piscataway, NJ). Before array studies, the integrity of glandular RNA preparations was further assessed with a RNA 6000 Nano LabChip with an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). The RNA samples were then processed for CodeLink Bioarray hybridization, as previously described.23 Briefly, cDNA was synthesized from RNA (2 ␮g) with a CodeLink Expression Assay Reagent Kit (Amersham) and isolated with a QIAquick purification kit (Qiagen, Valencia, CA). After sample drying, cRNA was generated with a CodeLink Expression Assay Reagent Kit (Amersham), recovered with an RNeasy kit (Qiagen) and quantified with an UV spectrophotometer. Fragmented, biotin-labeled cRNA was incubated and agitated (300 rpm shaker) on a CodeLink Bioarray at 37°C for 18 hours. The Bioarray was then washed and exposed to streptavidin-Alexa 647. Bioarrays were scanned by using ScanArray Express software and a ScanArray Express HT scanner (Packard BioScience, Meriden, CT) with the laser set at 635 nm, laser power at 100%, and photomultiplier tube voltage at 60%. Scanned image files were examined by using CodeLink image and data analysis software (Amersham), which generated both raw and normalized hybridization signal intensities for each array spot. The ⬃10,000

3667

spot intensities on the microarray image were standardized to a median of 1. Normalized data, with signal intensities exceeding 0.50, were analyzed with GeneSifter software (VizX Labs LLC, Seattle, WA; vizxlabs.com). This program also produced gene ontology and z-score reports. These ontologies, which were organized according to the guidelines of the Gene Ontology Consortium (http://www.geneontology. org/GO.doc.html),24 included biological processes, molecular functions and cellular components. Statistical analysis of individual gene expression data was conducted with Student’s t-test (two-tailed, unpaired). Data were evaluated with and without log transformation. The data from the individual Bioarrays (n ⫽ 6) are accessible for downloading through the National Center for Biotechnology Information’s Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) via series accession number GSE1582. The data will also be available for evaluation through GeneSifter (http://genesifter.net/datacenter/). Differentially expressed mRNAs were also analyzed by using GEM 1 (⬎8,000 genes) and GEM 2 (⬎9,500 genes) gene chips (Incyte Genomics, Inc., St. Louis, MO). Poly(A) mRNA was isolated from meibomian gland RNA samples by using the MicroPoly(A) Pure mRNA Isolation Kit (Ambion, Inc., Austin, TX). The mRNA concentration was determined with a RiboGreen RNA Quantitation Kit (Molecular Probes, Eugene, OR), according to Incyte’s protocol. After designating mRNA samples (800 ng) for use with either cy3 or cy5 probes, preparations were suspended in TE buffer, placed in siliconized RNase-Free Microfuge Tubes (Ambion) and shipped on dry ice to Incyte for hybridization. Microarray data were sent electronically to the Harvard Center for Genomic Research (Cambridge, MA) and results were downloaded into

TABLE 1. Oligonucleotide Primers for Real-Time PCR Confirmation of Selected Genes Accession No.

mRNA

Y15733*

17␤-hydroxysteroid dehydrogenase 7

NM_013454

Abca1

NM_008991

Abcd3

S78355

Cyclin D1

NM_007703

Elongation of very long chain fatty acids-like 3

AF127033

Fatty acid synthase

AF072759

Fatty acid transport protein 4

BC049235

Glutathione peroxidase 3†

M32599

Glyceraldehyde-3-phosphate dehydrogenase

NM_010512

Insulin-like growth factor 1

NM_011844

Monoglyceride lipase

BC028490

Neuromedin B

Y10971

Odorant-binding protein Ia

AF323080

Resistin†

AK007928

Small proline-rich protein 2A

NM_019756

Tubulin, ␦1

Orientation

Nucleotide Sequence (5ⴕ33ⴕ)

Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense

TTTGTAAATGCGCTCACTGTGA TTTTGGCCCGTGACGTAATT CCCTGCTTCCGTTATCCAACT GGACCTTGTGCATGTCCTTAATG CAGTCGCCCCTTCCTAGATCT TCACGCCCAGCCAAAACTATAC CTGACACCAATCTCCTCAACGA CTCACAGACCTCCAGCATCCA CTATGAAGGCTGCCAAACTGAAG TTGTTGTGTGGCATCCTTTCTC TCCTGGAACGAGAACACGATCT GAGACGTGTCACTCCTGGACTTG GGTGTTGAGGTGCCAGGAACT GCAAGAAGCGCAGGAAGATG GTTCCAAATGAGCCCAAAGG TAGTGTGGGCATGTGGGAGAT CATGGCCTTCCGTGTTCCTA CTGGTCCTCAGTGTAGCCCAA ACCTCAGACAGGCATTGTGGAT TGAGTCTTGGGCATGTCAGTGT GCTCCCCTGAAGCAGTGAAAC GGCCCTCCGTAAAGATAGAAGTG GGGACAGCACCCCCTAACA TTTCTTTCGCAGGAGGATCCT ACAATCACTGGGTATTTGCAAGAAG TCAGCTCTGTCCACGTTCTCA GCCACCCGTTCCTGTAGCT GGATTCGCGCACGTGAGT CATGCCCTCCTGTGCAATTT CACTTCCCCTGTTCCTGATGA GGAACGGGTGAGGTCATTGT TGAATGAGAAGGGCATCTGAAG

The accession number refers to the sequence identity of the gene fragment used on the gene chip or bioarray. This sequence, which is listed in the nucleotide database of NCBI, served as the basis for primer design. The primers were used to determine mRNA levels with real-time PCR by the relative standard curve method or the comparative CT Method. * Also identified with Unigene cluster code of Mm.12882. Additional names for these mRNAs include: elongation of very long chain fatty acids-like 3 is (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 (Elovl3), cold inducible glycoprotein 30 is CIN-2, Cig30; Abca1 is ATP-binding cassette, sub-family A member 1; Abcd3 is ATP-binding cassette, sub-family D member 3. † Comparative CT method.

3668

Schirra et al.

IOVS, October 2005, Vol. 46, No. 10

TABLE 2. Androgen Influence on Gene Expression Ratios in the Mouse Meibomian Gland Accession Number

Gene

Ratio

P

Neuromedin B Tocopherol (␣) transfer protein Neurofibromatosis 2 Glutathione peroxidase 3 Calcitonin receptor Cytochrome P450, family 2, subfamily b, polypeptide 20 FK506-binding protein 5 Trans-prenyltransferase Haptoglobin Neuronal d4 domain family member Ectonucleoside triphosphate diphosphohydrolase 1 Copine VI Dermatan sulphate proteoglycan 3 Hydroxysteroid 11-␤ dehydrogenase 1 Dipeptidase 3 SA rat hypertension-associated homolog

3.2 3.0 2.6 2.5 2.3 2.3

0.0105 0.0024 0.0013 0.0036 0.0063 0.0001

Signal transduction Fat-soluble vitamin metabolism Phosphate metabolism Response to biotic stimulus Signal transduction Electron transport

2.3 2.2 2.2 2.1 2.1

0.0032 0.0003 0.0274 0.0003 0.0018

Protein metabolism Isoprenoid biosynthesis Response to biotic stimulus Transcription Ribonucleotide catabolism

2.1 2.1 2.1 2.1 2.0

0.0106 0.0322 0.0123 0.0089 0.0030

Lipid metabolism Extracellular space Steroid metabolism Protein catabolism Carboxylic acid metabolism

4.0 3.3 2.7

0.0418 0.0094 0.0148

Morphogenesis Response to biotic stimulus Ribonuclease activity

2.4 2.4 2.3

0.0027 0.0136 0.0468

Transcription Receptor binding Programmed cell death

AF250135

Small proline-rich protein 2A Chemokine (C-X-C motif) ligand 15 Eosinophil-associated, ribonuclease A family, member 1 Cyclin T2 Resistin Cytotoxic granule–associated RNA binding protein 1 Splicing factor, arginine/serine-rich 2

2.2

0.0066

NM_011478 NM_008476

Small proline-rich protein 3 Keratin complex 2, basic, gene 6a

2.2 2.1

0.0263 0.0251

RNA splicing, via transesterification reactions Structural molecule activity Cytoplasm organization and biogenesis

Testosterone ⬎ placebo NM_026523 AF218416 NM_010898 NM_008161 NM_007588 NM_009998 NM_010220 NM_019501 NM_017370 NM_013874 NM_009848 NM_009947 NM_007884 NM_008288 AK006085 NM_016870 Placebo ⬎ testosterone NM_011468 NM_011339 NM_007894 AK013634 NM_022984 NM_011585

Ontology

Relative ratios were determined by comparing the degree of gene expression in meibomian glands from placebo and testosterone-treated orchiectomized mice. Genes listed had a comparative P ⬍ 0.05 (between glands) and a known identity. These ratios, which were generated from nontransformed data, were analogous to those found after log transformation. the Resolver Gene Expression Data Analysis System, version 3.1 (Rosetta Inpharmatics, Kirkland, WA). This system displayed the sequence identification and description of all chip nucleotides, the signal strength of the treatment (i.e., testosterone) and control (i.e., placebo) channels, the relationship between the two channels in terms of ratio and fold change, the comparative P-value and information concerning various quality control fields. In addition, this system determined the error-weighted average ratios for each chip, and normalized data across chips, thereby permitting the combination of GEM 1 and 2 microarray results to achieve a stronger analysis of gene expression. The error model applied by Rosetta Resolver on Incyte’s microarrays has been described in the addenda of recent literature reports.25,26 To verify the differential expression of selected mRNAs, quantitative real-time PCR (qPCR) was utilized. cDNAs were transcribed from mRNA samples by employing SuperScript II Reverse Transcriptase (Invitrogen) and oligo dT priming (Promega, Madison, WI). Primers were designed by using Primer Express Software, version 1.5 (Applied Biosystems, Inc., Foster City, CA). Specificity of the primers was verified by performing BLASTn searches on all relevant NCBI nucleotide databases. Particular focus was placed on identifying primers with a 16to 40-bp length, 20% to 80% GC content, and a melting temperature between 58°C and 60°C, that would generate amplicons between 140 bp and 160 bp. The qPCR was performed by utilizing the specific primers at optimal concentrations (Table 1) and Applied Biosystems’ SYBR Green PCR Master Mix, MicroAmp Optical 96-Well Reaction Plate, ABI PRISM Optical Adhesive Covers and GeneAmp 5700 Sequence Detection System, according to the manufacturer’s protocol. The instrument’s dissociation protocol did not show any secondary PCR products in any of the amplifications. Gene expression was determined by using either the Relative Standard Curve Method or the

Comparative CT Method27 and standardizing levels to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or tubulin, ␦1 mRNA.

RESULTS To determine the effect of testosterone on meibomian gland gene expression, tissues were obtained from placebo- and androgen-treated, orchiectomized mice (n ⫽ 7/group/experiment) and processed for analysis (CodeLink Uniset Mouse I Bioarrays, GE Healthcare; GeneSifter software, VizX Labs). Evaluation of non- and log-transformed data from three separate experiments demonstrated that testosterone influenced the expression of more than 1590 genes in the mouse meibomian gland. This hormonal action involved a significant upregulation of 1080 genes (e.g., neuromedin B) and a significant downregulation of 518 genes (e.g., small proline-rich protein 2A; Table 2). Of particular interest was the finding that androgen treatment increased the activity of genes encoding various steroid receptors (e.g., types of estrogen, progesterone, and retinoic acid-binding sites), steroidogenic enzymes (e.g., 17␤-hydroxysteroid dehydrogenase 7), and endocrine factors (e.g., insulin-like growth factor 1; Table 3). Moreover, testosterone altered the expression of several immune-associated genes (e.g., caspase 7; Table 3). Overall, testosterone treatment had a considerable impact on a diverse array of biological processes, molecular functions, and cellular components in meibomian tissue. Androgen influence extended to such processes as cell growth, metabolism, communication and transport, binding, catalytic activity, signal



3669

TABLE 3. Testosterone Regulation of Various Endocrine- and Immune-Related Genes in the Meibomian Gland Upregulation Endocrine Estrogen receptor 2 (␤) Membrane progestin receptor ␣ Progesterone receptor membrane component 1 Progesterone receptor membrane component 2 Retinoic acid receptor, ␣ Retinoid X receptor ␥ Insulin-like 6 Insulin-like growth factor 1 Insulin receptor Insulin-degrading enzyme Thyroid hormone receptor–associated protein 2 Arginine vasopressin receptor 1B Arginine vasopressin receptor 2 Cholecystokinin Cholecystokinin A receptor Hydroxysteroid (17-␤) dehydrogenase 7 Retinol dehydrogenase 11 Retinol dehydrogenase 6 Immune IL-5 IL-12b IL-21 IL-1 receptor-like 1 ligand Chemokine (C-C motif) receptor 4 Chemokine-binding protein 2

Downregulation

IL-1 receptor, type I IL-4 receptor, ␣ IL-6 signal transducer IL-10 receptor, ␤ IFN regulatory factor 1 IFN-␥ receptor Caspase 7 Chemokine (C-C motif) ligand 5 Chemokine (C-C motif) ligand 19 Chemokine (C-X3-C motif) ligand 1 Chemokine (C-X-C motif) ligand 16

The selected genes were significantly (P ⬍ 0.05) up- or downregulated by testosterone.

transduction, and receptor activity (data not shown). Most notable were the effects of testosterone on genes related to lipid dynamics (e.g., monoglyceride lipase, stearoyl-coenzyme A desaturases), protein transport (e.g., adaptor protein complexes), and intracellular vesicles (e.g., peroxisomal biogenesis factors; Table 4). Indeed, as shown by z-score analyses, androgen exposure led to the up (1)- and down (2) regulation of numerous genes associated with lipid metabolism (461, 142), lipid transport (81, 12), sterol biosynthesis (51, 12), fatty acid metabolism (161, 42), intracellular protein transport (311, 102), oxidoreductase activity (691, 162), peroxisomes (151, 02), mitochondria (761, 132), and early endosomes (51, 02; Tables 4, 5). For comparison, testosterone’s effects were least directed toward processes such as cell adhesion, actin binding, and cytoskeleton (Table 5). In contrast, the meibomian gland gene ontologies with the highest z-scores in the placebo-treated group were those related to mRNA metabolism, cell growth, endonuclease activity, and the cytoskeleton. The lowest scores were associated with processes such as proteolysis, G protein signaling, transport, and mitochondrial activity (Table 5). To verify in part the bioarray (CodeLink; GE Healthcare) results, additional meibomian gland mRNA samples (n ⫽ 22 mice/group/experiment) were processed for gene chip (GEM 1 and 2; Incyte Genomics, Inc.) analyses. The gene chips and bioarrays have 4717 sequences in common. This approach showed that 474 genes were up (n ⫽ 319)- or downregulated (n ⫽ 155) by testosterone on both the bioarrays (P ⬍ 0.05) and gene chips (androgen/placebo ratio ⫽ ⬎ or ⬍0; data not shown). If comparisons were restricted to those gene-chip genes that had expression ratios ⬎1.5 (1 or 2), then 83 genes

were identified as being similarly influenced by androgen on both platforms (e.g., Table 6). For further partial verification of bioarray and gene chip results, selected genes were analyzed by qPCR. As shown in Table 7, this method confirmed the androgen-induced differential expression of several meibomian gland genes, including those identified by both bioarrays and gene chips (i.e., 17␤hydroxysteroid dehydrogenase 7, Abcd3, elongation of very long chain fatty acids-like 3, fatty acid transport protein 4, insulin-like growth factor 1, and monoglyceride lipase) or by GEM chips alone (i.e., Abca1, fatty acid synthase, cyclin D1, and odorant-binding protein Ia).

DISCUSSION Our results demonstrate that androgens regulate the expression of numerous genes in the mouse meibomian gland. Testosterone administration to orchiectomized mice led to a significant increase in the transcriptional products of 1080 genes, including those related to lipid metabolism, sterol biosynthesis, fatty acid metabolism, protein transport, oxidoreductase activity, and peroxisomes. Androgen exposure also suppressed the levels of 518 mRNAs in this glandular tissue. These findings support our hypothesis that the androgen control of the meibomian gland involves the regulation of gene expression. The mechanism by which testosterone influences meibomian gland gene expression undoubtedly involves an association with saturable, high-affinity, and steroid-specific receptors in acinar epithelial cell nuclei. Androgen receptors are members of the steroid/thyroid hormone/retinoic acid family of

3670

Schirra et al.


TABLE 4. Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components Upregulation Lipid metabolism 1-Acylglycerol-3-phosphate O-acyltransferase 3 3-Hydroxy-3-methylglutaryl-coenzyme A reductase Acetyl-coenzyme A dehydrogenase, medium chain Acyl-CoA synthetase long-chain family member 4 Acyl-CoA synthetase long-chain family member 5 Acyl-coenzyme A oxidase 3, pristanoyl Adipose differentiation-related protein Alcohol dehydrogenase 5 (class III), ␹ polypeptide Cellular nucleic acid–binding protein 1 Colipase, pancreatic Cytochrome P450, 51 Cytosolic acetyl-CoA hydrolase Cytosolic acyl-CoA thioesterase 1 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 Elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 Emopamil binding protein-like Hydroxysteroid 17-␤ dehydrogenase 7 Hydroxysteroid 11-␤ dehydrogenase 1 Gastric lipase Longevity assurance homolog 4 (S. cerevisiae) Membrane-interacting protein of RGS16 Monoglyceride lipase NAD(P) dependent steroid dehydrogenase-like Oxysterol binding protein-like 1A Peroxisome proliferator activator receptor ␦ Phosphatidylserine synthase 2 Phospholipase A2, group IIC Phospholipase A2, group IIE Phospholipase A2, group IIF Phospholipase A2, group XIIA Phospholipase C, ␤3 Phospholipase C, ␤4 Phytanoyl-CoA hydroxylase SA rat hypertension-associated homolog Sodium channel, voltage-gated, type XI, alpha polypeptide Sphingomyelin phosphodiesterase 1, acid lysosomal StAR-related lipid transfer (START) domain containing 5 Stearoyl-coenzyme A desaturase 1 Stearoyl-coenzyme A desaturase 2 Stearoyl-coenzyme A desaturase 3 Sterol carrier protein 2, liver Sterol-C4-methyl oxidase-like Sulfotransferase family 1A, phenol-preferring, member 1 Triosephosphate isomerase 1 Lipid transport Adipose differentiation-related protein Apolipoprotein A-V Apolipoprotein E Niemann pick type C1 Oxysterol binding protein-like 1A Phosphatidylcholine transfer protein StAR-related lipid transfer (START) domain containing 5 Sterol carrier protein 2, liver Intracellular protein transport Adaptor protein complex AP-1, ␮2 subunit Adaptor protein complex AP-1, ␴1 Adaptor-related protein complex 3, ␤1 subunit Adaptor-related protein complex 3, ␮1 subunit Adaptor-related protein complex 3, ␴2 subunit Adaptor-related protein complex AP-4, ␴1 ADP-ribosylation factor 5 B-cell receptor-associated protein 29 Cathepsin B Choroidermia Coatomer protein complex, subunit ␧ Epimorphin Histocompatibility 47

Downregulation

3-hydroxy-3-methylglutaryl-coenzyme A synthase 2 Acetyl-coenzyme A dehydrogenase, long chain Aldehyde dehydrogenase family 1, subfamily A3 Arachidonate 12-lipoxygenase, 12R type Arachidonate 5-lipoxygenase-activating protein Copine III Fatty acid desaturase 2 Glucosamine Glycerol phosphate dehydrogenase 2, mitochondrial GM2 ganglioside activator protein Peroxiredoxin 6 Protein kinase, cAMP dependent regulatory, type II beta RIKEN cDNA 5133401H06 gene Sortilin-related receptor, LDLR class A repeats-containing Sphingosine phosphate lyase 1

Sortilin-related receptor, LDLR class A repeats-containing

A kinase (PRKA) anchor protein (gravin) 12 CDNA sequence BC003281 Ia-associated invariant chain Nuclear factor of ␬ light chain gene enhancer in B-cells inhibitor, ␣ Nuclear RNA export factor 1 homolog (S. cerevisiae) Ras-GTPase-activating protein SH3-domain binding protein Secretory carrier membrane protein 3 Splicing factor, arginine/serine-rich 1 (ASF/SF2) Transforming growth factor, ␤1 Transforming, acidic coiled-coil containing protein 3

(continues)



3671

TABLE 4 (continued). Androgen Control of Meibomian Gland Genes Associated with Lipid Metabolism and Transport, Sterol Biosynthesis, Protein Activity, and Cellular Components Upregulation

Downregulation

Intracellular protein transport (continued) Karyopherin (importin) ␤1 PDZ domain containing 11 Peroxisomal biogenesis factor 13 RAB1B, member RAS oncogene family RAB2, member RAS oncogene family Rab38, member of RAS oncogene family RAB4B, member RAS oncogene family RAB9, member RAS oncogene family RIKEN cDNA 1110034E15 gene RIKEN cDNA 5830417C01 gene RIKEN cDNA A430019L02 gene Sec61 ␤ subunit Signal recognition particle 54 Sortilin-related VPS10 domain containing receptor 2 Sorting nexin 2 Translocase of inner mitochondrial membrane 8 homolog b (yeast) Translocase of outer mitochondrial membrane 20 homolog (yeast) Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, ␤ pol Peroxisome (also microbody) 2-4-Dienoyl-coenzyme A reductase 2, peroxisomal Acyl-coenzyme A oxidase 3, pristanoyl ATP-binding cassette, sub-family D (ALD), member 3 Catalase Mpv17 transgene, kidney disease mutant Peroxisomal biogenesis factor 13 Peroxisomal membrane protein 3 Peroxisomal membrane protein 4 Peroxisomal membrane protein 4 Peroxisome biogenesis factor 19 Phytanoyl-CoA hydroxylase Polyamine oxidase Solute carrier family 25 Sterol carrier protein 2, liver Early endosome CD1d1 antigen RAB34, member of RAS oncogene family RAB5A, member RAS oncogene family Tumor protein D52-like 1 Vesicle-associated membrane protein 8 The selected genes, which are examples of each category, were significantly (P ⬍ 0.05) up- or downregulated by testosterone treatment.

ligand-activated transcription factors and appear to mediate the classic actions of androgens throughout the body.28,29 After androgen binds to the receptor, the monomeric, activated hormone–receptor complex invariably associates with an androgen response element in the regulatory region of specific target genes; typically dimerizes with another androgen-bound complex; and, in combination with appropriate coactivators and promoter elements, controls gene transcription.28,29 In support of this hypothesis, it has been shown that androgen receptors exist in sebaceous gland epithelial cells17–19 and androgen activity in these cells may be compromised by androgen receptor defects or antagonists.30 –32 Similarly, androgen receptors exist in meibomian gland epithelial cells,21,22 and androgen receptor disruption or the use of antiandrogen medications is associated with significant meibomian gland dysfunction and striking alterations in the neutral and polar lipid profiles of meibomian gland secretions.2,3,12–14 In addition, we have recently found that many androgen-regulated genes in the meibomian gland appear to depend on the presence of functional androgen receptors.33 It is important to note, though, that other processes may also be involved in, or mediate, androgen influence on meibomian gland gene expression. For example, the apparent andro-

gen control of transcriptional activity may actually reflect hormone-induced alterations in mRNA stability,34 a possibility that remains to be explored. Another possibility is that testosterone’s impact on the meibomian gland is not direct, but rather is mediated through estrogen activity. The meibomian gland contains the mRNA for aromatase cytochrome P-450 (Schirra F, Suzuki T, Dickinson DP, Townsend DJ, Gipson IK, Sullivan DA, manuscript submitted) an enzyme that transforms testosterone into 17␤-estradiol.35 Moreover, the meibomian gland harbors estrogen receptor mRNA and protein.21,36 However, an estrogen mediation of androgen effects in the meibomian gland is highly unlikely. Recent research has shown that 17␤-estradiol treatment of ovariectomized mice elicits a pattern of gene expression in meibomian tissue that is dissimilar from that induced by testosterone (Suzuki T, Schirra F, Jensen RV, Richards SM, Sullivan DA, manuscript submitted).37 Furthermore, unlike androgens, estrogens appear to decrease sebaceous gland function,32,38 and this effect has been proposed to be due to an antagonism of androgen action.39,40 Our finding that androgens modulate gene expression in the mouse meibomian gland is consistent with our earlier preliminary observations in rabbits.41 Thus, by using RNA arbitrarily primed polymerase chain reactions, sequencing gels,

3672

Schirra et al.


TABLE 5. High and Low Expression of Gene Ontologies in the Meibomian Glands of Placebo- or Testosterone-Treated Mice Ontology Biological process Lipid metabolism Fatty acid metabolism Lipid transport Morphogenesis Cell adhesion Protein modification mRNA metabolism Regulation of cell growth Cell growth Proteolysis and peptidolysis G-protein-coupled receptor signaling pathway Catabolism Molecular function Oxidoreductase activity Lyase activity Carboxylic ester hydrolase activity Binding Actin binding Protein binding S-adenosylmethionine-dependent methyltransferase activity RNA binding Endonuclease activity Rhodopsin-like receptor activity Transporter activity G-protein coupled receptor activity Cellular component Microbody Peroxisome Mitochondrion Extracellular matrix Nucleus Cytoskeleton Cytoskeleton Intracellular Nucleus Extracellular space Mitochondrion Integral to membrane

Gene List

T Genes 1

60 20 9 90 34 94

46 16 8 52 19 56

24 11 12 49 52 75

P Genes 1

Array Genes

T z-Score

P z-Score

14 4 1 38 15 38

265 77 33 652 293 728

3.56 2.87 2.51 ⴚ2.4 ⴚ2.4 ⴚ2.81

0.47 0.21 ⫺0.45 1.45 0.36 0.72

9 3 3 43 47 66

15 8 9 6 5 9

95 38 46 344 337 495

⫺0.4 ⫺0.57 ⫺0.93 1.09 1.96 1.95

5.16 4.79 4.79 ⴚ2.65 ⴚ2.86 ⴚ3.14

85 21 12 668 11 214

69 16 12 435 3 125

16 5 0 233 8 89

396 79 57 4340 118 1540

4.39 2.73 2.51 ⴚ2.57 ⴚ2.91 ⴚ3.8

⫺0.82 0.59 ⫺1.72 2.3 0.95 1.81

11 49 12 30 114 36

3 24 5 29 91 34

8 25 7 1 23 2

38 246 41 178 788 228

⫺0.57 ⫺0.52 0.29 2.4 0.74 2.05

4.62 3.89 3.62 ⴚ2.72 ⴚ2.73 ⴚ2.86

15 15 89 10 273 56

15 15 76 7 166 24

0 0 13 3 107 32

45 45 485 130 1751 340

4.82 4.82 3.44 ⴚ2.06 ⴚ2.31 ⴚ2.37

⫺1.5 ⫺1.5 ⫺2.22 ⫺1.32 3.12 4.15

56 618 273 250 89 322

24 409 166 185 76 240

32 209 107 65 13 82

340 3744 1751 1705 485 2108

⫺2.37 ⫺0.12 ⫺2.31 ⫺0.17 3.44 0.75

4.15 3.6 3.12 ⴚ2.1 ⴚ2.22 ⴚ2.23

Specific ontologies, with some of the highest and lowest z-scores, were selected after the analysis of log-transformed data. Criteria for inclusion in the table were an ontology containing ⱖ9 genes and having a z-score ⬎2.0 or ⬍ ⫺2.0. High and low values for the placebo (P) and testosterone (T) groups in designated ontologies are highlighted in bold print.

and autoradiography, we were able to identify 58 differentially expressed mRNAs in the meibomian glands of orchiectomized rabbits treated topically with testosterone- or vehicle. However, analysis of 22 of the corresponding cDNA bands demonstrated that the majority had no significant homology to sequences in the GenBank database (http://www.ncbi.nlm. nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD), presumably due to limited data for rabbit sequences. Consequently, to identify genes regulated by androgens in the meibomian gland, we selected mice as an experimental model because of the extensive genetic information available for this species. Considering that androgens modulate meibomian gland lipogenesis, the genes upregulated in this tissue by testosterone and the proteins they encode are particularly intriguing. Fatty acid synthase is a critical lipogenic enzyme that is known to be regulated by androgens in other tissues42,43 and is expressed in meibomian gland epithelial cells (Richards SM, et al. IOVS 2002;43:ARVO E-Abstract 3150). Fatty acid transport protein 4

facilitates the cellular uptake and metabolism of long- and very-long-chain fatty acids,44 whereas elongation of very-longchain fatty acids-like 1 and 3 promote the tissue-specific synthesis of very-long-chain fatty acids and sphingolipids.45,46 These proteins could be involved in the androgen-induced increase of long-chain fatty acids in the total lipid fraction of rabbit meibomian glands.1 Monoglyceride lipase hydrolyzes triand monoglycerides to fatty acids and glycerol.47 Abca1 and Abcd3, which are members of the adenosine triphosphate (ATP)-binding cassette family, transport various molecules across extra- and intracellular membranes. Abca1 functions as a cholesterol efflux pump in the lipid-removal pathway48 and thereby serves as a key regulator of cholesterol distribution.49,50 Abcd3 modulates the importation of fatty acids and/or fatty acyl-CoAs into peroxisomes.51 3-Hydroxy-3-methylglutaryl-coenzyme A reductase is the rate-limiting enzyme of sterol biosynthesis.46 Oxysterol binding protein-like 1A, sterol carrier protein 2, liver, lipocalin 3, and phosphatidylcholine transfer protein are involved in the binding and/or transfer of phospholipids.46 However, whether these proteins play a de-



3673

TABLE 6. GEM Chip Confirmation of Selected Bioarray Results Accession Number Testosterone ⬎ placebo NM_010476 NM_008288 NM_013754 NM_026058 AK009450 NM_010784 NM_010898 NM_020573 NM_026438 NM_021557 M62361 Placebo ⬎ testosterone NM_007606 K02782 NM_011469

Gene

Ontology

Hydroxysteroid (17␤) dehydrogenase 7 Hydroxysteroid 11␤ dehydrogenase 1 Insulin-like 6 Longevity assurance homolog 4 (S. cerevisiae) Membrane progestin receptor ␣ Midkine Neurofibromatosis 2 Oxysterol binding protein-like 1A Pyrophosphatase Retinol dehydrogenase 11 Sterol carrier protein 2, liver

Steroid metabolism Steroid metabolism Receptor binding Sphingoid biosynthesis Signal transducer activity Cell cycle Phosphate metabolism Lipid transport Hydrolysis of diphosphate bonds Oxidoreductase activity Carboxylic acid metabolism

Carbonic anhydrase 3 Complement component 3 Small proline-rich protein 2B

One-carbon compound metabolism Vesicle-mediated transport Structural molecule activity

Separate meibomian gland mRNA samples from placebo- or testosterone-treated mice were processed for GEM 1 and 2 gene chip evaluation. Differentially expressed genes were then compared to those identified by CodeLink bioarrays. This table lists known genes with known functions that showed greater than a 1.5-fold up- or downregulation in both CodeLink and GEM arrays.

finitive role in androgen-meibomian gland interactions has yet to be determined. Androgens also were shown to control a series of genes that may be very important in the endocrine regulation of the meibomian gland. Thus, testosterone increased the mRNA levels of 17␤-hydroxysteroid dehydrogenase 7, a member of the enzyme family that regulates the interconversion of 17-ketosteroids with their corresponding 17␤-hydroxysteroids.52 This enzymatic activity is essential for the metabolism of all active androgens and estrogens in peripheral sites52 and may mediate the local, intracrine synthesis of androgens from adrenal precursors in the meibomian gland. Testosterone also enhanced

the mRNA content of insulin-like growth factor 1, a pleiotropic protein that stimulates DNA synthesis and differentiation in sebaceous cells.53 Insulin-like growth factor 1 may also promote steroidogenesis54 and has been shown to be regulated by androgens in other tissues.55 Moreover, androgen treatment increased the expression of the gene encoding estrogen receptor 2 (␤). This receptor, which is upregulated by androgen in the prostate,56 may inhibit the activity of estrogen receptor 1 (␣).57 Testosterone also elevated the mRNA levels of 11␤hydroxysteroid dehydrogenase 1, an enzyme that catalyzes the conversion of cortisol to the inactive metabolite cortisone.46 Of interest, testosterone downregulated the gene expression of

TABLE 7. Verification of Selected Bioarray and Gene Chip Results Gene Testosterone ⬎ placebo 17␤-Hydroxysteroid dehydrogenase 7 ATP-binding cassette, sub-family A, member 1 ATP-binding cassette, sub-family D, member 3 Elongation of very long chain fatty acids-like 3 Fatty acid synthase Fatty acid transport protein 4 Glutathione peroxidase 3 Insulin-like growth factor 1 Monoglyceride lipase Neuromedin B Placebo ⬎ testosterone Cyclin D1 Odorant-binding protein Ia Resistin Small proline-rich protein 2A‡

CodeLink Ratio

GEM Ratio

qPCR Ratio

1.77 / 1.41 1.40 / 1.25 2.52 1.36 1.39 3.21

2.80 1.55 1.82 1.91 2.10 2.20 ⫺ 1.90 2.09 ⫺

2.21 2.17 2.19 1.65 2.08 1.57 2.09* 1.51† 2.07 2.10

⫺ ⫺ 2.42 3.96

2.49 29.41 ⫺ 3.41

1.57† 55.0 2.97* 4.30

The expression of selected genes, that were shown to be differentially upregulated in meibomian glands of placebo- or testosterone-treated mice by using CodeLink Bioarrays or GEM chips, were reevaluated with qPCR procedures. Unless otherwise noted (i.e., n ⫽ 2†), all qPCR ratios equal the average of 3 measurements. The mRNA levels were standardized to those of GAPDH or, where designated,* tubulin, ␦1. The “–” symbol indicates that the gene sequence was not present on either the CodeLink Bioarray or GEM chip, or that the normalized data were below the CodeLink sensitivity limit of 0.5 signal intensity units (i.e., cyclin D1). The “/” symbol indicates that the hormone effect did not reach significance on the CodeLink Bioarrays. All other CodeLink data were significantly (P ⬍ 0.05, two-tailed) increased or decreased relative to control, with the exception of fatty acid transport protein 4 (P ⬍ 0.05, one-tailed). Differences between CodeLink and GEM results may be due, at least in part, to variations (e.g., up to 30%) in signal intensities that may occur among corresponding elements on different microarrays.59 ‡ The UniGene Cluster identification code for small proline-rich protein 2A is now apparently the same as for 2B.

3674

Schirra et al.

aldehyde dehydrogenase family 1, subfamily A3 (also called retinaldehyde dehydrogenase 3), an enzyme that stimulates retinoic acid biosynthesis.46 In addition to these actions, androgens promoted the expression of genes involved in the sorting (e.g., adaptor protein complexes, RAB9), trafficking (e.g., ADP-ribosylation factor 5, sorting nexin 2), and hydrolysis (e.g., cathepsin B) of proteins in various cellular locations, including the endosome, Golgi apparatus, endoplasmic reticulum, lysosome, proteasome, nucleus, and mitochondrion.46 Androgens also increased the mRNA levels of epimorphin (an extracellular protein that directs epithelial cell morphogenesis), neuromedin B (a bombesin-like peptide that stimulates epithelial cell proliferation),58 and phospholipases C-␤3 and -␤4 (mediators of the production of the second-messenger molecules diacylglycerol and inositol 1,4,5-trisphosphate).46 Testosterone decreased the mRNA amounts of Ia-associated invariant chain, which plays an essential role in major histocompatibility (MHC) class II antigen processing.46 In summary, our results show that testosterone regulates the expression of a number of genes in the mouse meibomian gland and that many of these genes are involved in the production, metabolism, transport, and release of lipids, as well as in steroidogenic pathways. We are currently attempting to determine the meibomian gland distribution of these genes (e.g., by in situ hybridization), in order to identify the cellular targets for androgen action. This procedure will also verify mRNA location within the gland, compared with the conjunctiva, given that very small parts of this latter tissue adhered to the meibomian gland during isolation. In concert with these studies, we are endeavoring to determine whether a variety of these hormone-regulated genes are translated (e.g., by immunohistochemistry and Western blot analysis). This combined information may help to explain, at least in part, the mechanism by which topical androgens reportedly stimulate the synthesis and secretion of meibomian gland lipids, prolong the tear film breakup time, and alleviate dry eye.7,8

Acknowledgments The authors thank Christian B. Wade (Seattle, WA) for assistance with the GeneSifter software, and the Harvard Center for Genomic Research for help with processing the GEM 1 and 2 gene chip data.

References 1. Sullivan DA, Sullivan BD, Ullman MD, et al. Androgen influence on the meibomian gland. Invest Ophthalmol Vis Sci. 2000;41:3732– 3742. 2. Krenzer KL, Dana MR, Ullman MD, et al. Effect of androgen deficiency on the human meibomian gland and ocular surface. J Clin Endocrinol Metab. 2000;85:4874 – 4882. 3. Sullivan BD, Evans JE, Krenzer KL, Dana MR, Sullivan DA. Impact of antiandrogen treatment on the fatty acid profile of neutral lipids in human meibomian gland secretions. J Clin Endocrinol Metab. 2000;85:4866 – 4873. 4. Driver PJ, Lemp MA. Meibomian gland dysfunction. Surv Ophthalmol. 1996;40:343–367. 5. McCulley JP, Shine W. A compositional based model for the tear film lipid layer. Trans Am Ophthalmol Soc. 1997;95:79 – 88; discussion 88 –93. 6. Bron AJ, Tiffany JM, Gouveia SM, Yokoi N, Voon LW. Functional aspects of the tear film lipid layer. Exp Eye Res. 2004;78:347–360. 7. Zeligs M. Dehydroepiandrosterone therapy for the treatment of dry eye disorders. International patent application WO 94/04155, 1994. 8. Worda C, Nepp J, Huber JC, Sator MO. Treatment of keratoconjunctivitis sicca with topical androgen. Maturitas. 2001;37:209 – 212.

IOVS, October 2005, Vol. 46, No. 10 9. Labrie F, Belanger A, Cusan L, Gomez JL, Candas B. Marked decline in serum concentrations of adrenal C19 sex steroid precursors and conjugated androgen metabolites during aging. J Clin Endocrinol Metab. 1997;82:2396 –2402. 10. Brinkmann AO. Molecular basis of androgen insensitivity. Mol Cell Endocrinol. 2001;179:105–109. 11. Sullivan DA, Belanger A, Cermak JM, et al. Are women with Sjo ¨ gren’s syndrome androgen-deficient? J Rheumatol. 2003;30: 2413–2419. 12. Sullivan BD, Evans JE, Dana MR, Sullivan DA. Impact of androgen deficiency on the lipid profiles in human meibomian gland secretions. Adv Exp Med Biol. 2002;506:449 – 458. 13. Cermak JM, Krenzer KL, Sullivan RM, Dana MR, Sullivan DA. Is complete androgen insensitivity syndrome associated with alterations in the meibomian gland and ocular surface? Cornea. 2003; 22:516 –521. 14. Sullivan BD, Evans JE, Cermak JM, Krenzer KL, Dana MR, Sullivan DA. Complete androgen insensitivity syndrome: effect on human meibomian gland secretions. Arch Ophthalmol. 2002;120:1689 – 1699. 15. Shimazaki J, Sakata M, Tsubota K. Ocular surface changes and discomfort in patients with meibomian gland dysfunction. Arch Ophthalmol. 1995;113:1266 –1270. 16. Thody AJ, Shuster S. Control and function of sebaceous glands. Physiol Rev. 1989;69:383– 416. 17. Deplewski D, Rosenfield RL. Role of hormones in pilosebaceous unit development. Endocr Rev. 2000;21:363–392. 18. Miyake K, Ciletti N, Liao S, Rosenfield RL. Androgen receptor expression in the preputial gland and its sebocytes. J Invest Dermatol. 1994;103:721–725. 19. Luderschmidt C, Eiermann W, Jawny J. Steroid hormone receptors and their relevance for sebum production in the sebaceous gland ear model of the Syrian hamster. Arch Dermatol Res. 1983;275: 175–180. 20. Puy LA, Turgeon C, Gagne D, et al. Localization and regulation of expression of the FAR-17A gene in the hamster flank organs. J Invest Dermatol. 1996;107:44 –50. 21. Wickham LA, Gao J, Toda I, Rocha EM, Ono M, Sullivan DA. Identification of androgen, estrogen and progesterone receptor mRNAs in the eye. Acta Ophthalmol Scand. 2000;78:146 –153. 22. Rocha EM, Wickham LA, da Silveira LA, et al. Identification of androgen receptor protein and 5alpha-reductase mRNA in human ocular tissues. Br J Ophthalmol. 2000;84:76 – 84. 23. Treister NS, Richards SM, Lombardi MJ, Rowley P, Jensen RV, Sullivan DA. Sex-related differences in gene expression in salivary glands of BALB/c mice. J Dent Res. 2005;84:160 –165. 24. Ashburner M, Ball CA, Blake JA, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000;25:25–29. 25. Hughes TR, Marton MJ, Jones AR, et al. Functional discovery via a compendium of expression profiles. Cell. 2000;102:109 –126. 26. Roberts CJ, Nelson B, Marton MJ, et al. Signaling and circuitry of multiple MAPK pathways revealed by a matrix of global gene expression profiles. Science. 2000;287:873– 880. 27. User Bulletin #2: ABI Prism 7700 Sequence Detection System. Foster City, CA: Applied Biosystems, Inc.; updated version, October, 2001. 28. Clark JH, Schrader WT, O’Malley BW. Mechanisms of action of steroid hormones. In: Wilson JD, Foster DW, eds. Williams Textbook of Endocrinology. Philadelphia: WB Saunders; 1992:35–90. 29. McPhaul MJ, Young M. Complexities of androgen action. J Am Acad Dermatol. 2001;45:S87–S94. 30. Imperato-McGinley J, Gautier T, Cai LQ, Yee B, Epstein J, Pochi P. The androgen control of sebum production: studies of subjects with dihydrotestosterone deficiency and complete androgen insensitivity. J Clin Endocrinol Metab. 1993;76:524 –528. 31. Schroder HG, Ziegler M, Nickisch K, Kaufmann J, el Etreby MF. Effects of topically applied antiandrogenic compounds on sebaceous glands of hamster ears and flank organs. J Invest Dermatol. 1989;92:769 –773. 32. Wirth H, Gloor M, Kimmel W. Influence of cyproterone acetate and estradiol on cell kinetics in the sebaceous gland of the golden hamster ear. Arch Dermatol Res. 1980;268:277–281.

IOVS, October 2005, Vol. 46, No. 10 33. Yamagami H, Schirra F, Liu M, Richards SM, Sullivan BD, Sullivan DA. Androgen influence on gene expression in the meibomian gland. Adv Exp Med Biol. 2002;506:477– 481. 34. Yeap BB, Krueger RG, Leedman PJ. Differential posttranscriptional regulation of androgen receptor gene expression by androgen in prostate and breast cancer cells. Endocrinology. 1999;140:3282– 3291. 35. Bulun SE, Simpson ER. Regulation of aromatase expression in human tissues. Breast Cancer Res Treat. 1994;30:19 –29. 36. Esmaeli B, Harvey JT, Hewlett B. Immunohistochemical evidence for estrogen receptors in meibomian glands. Ophthalmology. 2000;107:180 –184. 37. Suzuki T, Schaumberg DA, Sullivan BD, et al. Do estrogen and progesterone play a role in the dry eye of Sjo ¨ gren’s syndrome? Ann NY Acad Sci. 2002;966:223–225. 38. Pochi PE, Strauss JS. Endocrinologic control of the development and activity of the human sebaceous gland. J Invest Dermatol. 1974;62:191–201. 39. Schafer G, Krause W. The effect of estradiol on the sebaceous gland of the hamster ear and its antagonism by tamoxifen. Arch Dermatol Res. 1985;277:230 –234. 40. Sansone-Bazzano G, Reisner RM, Bazzano G. A possible mechanism of action of estrogen at the cellular level in a model sebaceous gland. J Invest Dermatol. 1972;59:299 –304. 41. Steagall RJ, Yamagami H, Wickham LA, Sullivan DA. Androgen control of gene expression in the rabbit meibomian gland. Adv Exp Med Biol. 2002;506:465– 476. 42. Swinnen JV, Esquenet M, Goossens K, Heyns W, Verhoeven G. Androgens stimulate fatty acid synthase in the human prostate cancer cell line LNCaP. Cancer Res. 1997;57:1086 –1090. 43. Swinnen JV, Verhoeven G. Androgens and the control of lipid metabolism in human prostate cancer cells. J Steroid Biochem Mol Biol. 1998;65:191–198. 44. Herrmann T, Buchkremer F, Gosch I, Hall AM, Bernlohr DA, Stremmel W. Mouse fatty acid transport protein 4 (FATP4): characterization of the gene and functional assessment as a very long chain acyl-CoA synthetase. Gene. 2001;270:31– 40. 45. Tvrdik P, Westerberg R, Silve S, et al. Role of a new mammalian gene family in the biosynthesis of very long chain fatty acids and sphingolipids. J Cell Biol. 2000;149:707–718. 46. Universal Protein Resource Knowledgebase. http://www.expasy. uniprot.org/index.shtml.


3675

47. Karlsson M, Reue K, Xia YR, et al. Exon-intron organization and chromosomal localization of the mouse monoglyceride lipase gene. Gene. 2001;272:11–18. 48. Lawn RM, Wade DP, Garvin MR, et al. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest. 1999;104:R25–31. 49. Santamarina-Fojo S, Remaley AT, Neufeld EB, Brewer HB Jr. Regulation and intracellular trafficking of the ABCA1 transporter. J Lipid Res. 2001;42:1339 –1345. 50. Wang N, Silver DL, Thiele C, Tall AR. ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein. J Biol Chem. 2001;276:23742–23747. 51. Hettema EH, Tabak HF. Transport of fatty acids and metabolites across the peroxisomal membrane. Biochim Biophys Acta. 2000; 1486:18 –27. 52. Labrie F, Luu-The V, Lin SX, et al. Intracrinology: role of the family of 17 beta-hydroxysteroid dehydrogenases in human physiology and disease. J Mol Endocrinol. 2000;25:1–16. 53. Deplewski D, Rosenfield RL. Growth hormone and insulin-like growth factors have different effects on sebaceous cell growth and differentiation. Endocrinology. 1999;140:4089 – 4094. 54. Mesiano S, Katz SL, Lee JY, Jaffe RB. Insulin-like growth factors augment steroid production and expression of steroidogenic enzymes in human fetal adrenal cortical cells: implications for adrenal androgen regulation. J Clin Endocrinol Metab. 1997;82:1390 – 1396. 55. Gori F, Hofbauer LC, Conover CA, Khosla S. Effects of androgens on the insulin-like growth factor system in an androgen-responsive human osteoblastic cell line. Endocrinology. 1999;140:5579 – 5586. 56. Asano K, Maruyama S, Usui T, Fujimoto N. Regulation of estrogen receptor alpha and beta expression by testosterone in the rat prostate gland. Endocr J. 2003;50:281–287. 57. Hall JM, McDonnell DP. The estrogen receptor beta-isoform (ERbeta) of the human estrogen receptor modulates ERalpha transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology. 1999;140:5566 – 5578. 58. Matusiak D, Glover S, Nathaniel R, Matkowskyj K, Yang J, Benya RV. Neuromedin B and its receptor are mitogens in both normal and malignant epithelial cells lining the colon. Am J Physiol. 2005;288:G718 –G728. 59. Stears RL, Martinsky T, Schena M. Trends in microarray analysis. Nat Med. 2003;9:140 –145.