Antiandrogen Exposure in Utero Disrupts Expression of Desert ...

REPRODUCTION-DEVELOPMENT

Antiandrogen Exposure in Utero Disrupts Expression of Desert Hedgehog and Insulin-Like Factor 3 in the Developing Fetal Rat Testis Leon J. S. Brokken,* Annika Adamsson,* Jorma Paranko, and Jorma Toppari Departments of Physiology (L.J.S.B., A.A., J.T.), Anatomy (J.P.), and Paediatrics (J.T.) and Laboratory of Electron Microscopy (A.A.), University of Turku, 20520 Turku, Finland

Testicular development is an androgen-dependent process, and fetal exposure to antiandrogens disrupts male sexual differentiation. A variety of testicular disorders may result from impaired development of fetal Leydig and Sertoli cells. We hypothesized that antiandrogenic exposure during fetal development interferes with desert hedgehog (Dhh) signaling in the testis and results in impaired Leydig cell differentiation. Fetal rats were exposed in utero to the antiandrogen flutamide from 10.5 d post conception (dpc) until they were killed or delivery. Fetal testes were isolated at different time points during gestation and gene expression levels of Dhh, patched-1 (Ptc1), steroidogenic factor 1 (Sf1), cytochrome P450 side-chain cleavage (P450scc), 3␤-hydroxysteroid dehydrogenase type 1 (Hsd3b1), and insulin-like factor 3 (Insl3) were analyzed. To study direct effects of hedgehog signaling on testicular development, testes from 14.5 dpc fetuses were cultured for 3 d in the presence of cyclopamine, sonic hedgehog, or vehicle, and gene expression levels and testosterone secretion were analyzed. Organ cultures were also analyzed histologically, and cleaved-caspase 3 immunohistochemistry was performed to assess apoptosis. In utero exposure to flutamide decreased expression levels of Dhh, Ptc1, Sf1, P450scc, Hsd3b1, and Insl3, particularly from 17.5 dpc onward. Inhibition of hedgehog signaling in testis cultures resulted in similar effects on gene expression levels. Apoptosis in Wolffian ducts was increased by cyclopamine compared with sonic hedgehog- or vehicle-treated cultures. We conclude that exposure to the antiandrogen flutamide interferes with Dhh signaling resulting in an impaired differentiation of the fetal Leydig cells and subsequently leading to abnormal testicular development and sexual differentiation. (Endocrinology 150: 445– 451, 2009)

he last decades have revealed various adverse trends in reproductive health (1) such as increasing incidences of testicular cancer, decreased sperm quality, cryptorchidism, and hypospadias. These disorders might well be symptoms of one underlying mechanism, which has been introduced by Skakkebaek et al. (2) as the testicular dysgenesis syndrome. This hypothetical model postulates that the variety of testicular disorders that manifest themselves during postnatal life is the result of disruption of embryonic programming and fetal development of Leydig and Sertoli cells (3). Several key genes are involved in proper sexual differentiation of the testis. Desert hedgehog (Dhh) is produced and secreted by Sertoli cells (4) shortly after the onset of expression of the testis-

T

determining factor Sry in the fetal testis. Homozygous Dhh-null female mice are fertile, but the males have small embryonic testis by 18.5 d post conception (dpc) and are sterile into adulthood (5). Dhh is a ligand for the transmembrane patched-1 (Ptc1) receptor, which in the fetal testis is expressed by fetal Leydig cells and peritubular myoid cells (5, 6). Both fetal and adult Leydig cells produce high levels of insulin-like factor 3 (Insl3), a growth factor indispensable for proper testicular descent and inhibitor of germ cell apoptosis (7, 8). Leydig cells also express steroidogenic factor 1 (Sf1), which is the major transcriptional regulator of Insl3 and steroidogenic enzymes necessary for sufficient testosterone production.

ISSN Print 0013-7227 ISSN Online 1945-7170 Printed in U.S.A. Copyright © 2009 by The Endocrine Society doi: 10.1210/en.2008-0230 Received February 15, 2008. Accepted August 28, 2008. First Published Online September 4, 2008 * L.J.S.B. and A.A. contributed equally to the manuscript.

Abbreviations: AR, Androgen receptor; dpc, days post conception; Dhh, desert hedgehog; Hsd3b1, 3␤-hydroxysteroid dehydrogenase type 1; Insl3, insulin-like factor 3; NGS, normal goat serum; P450scc, P450 side-chain cleavage; Ptc1, patched-1; rmShh, recombinant mouse sonic hedgehog; Sf1, steroidogenic factor 1; StAR, steroidogenic acute regulatory protein; TBS/T, Tris-buffered saline containing 0.5% Triton X-100.

Endocrinology, January 2009, 150(1):445– 451

endo.endojournals.org

445

446

Brokken et al.

Flutamide Suppresses Dhh and Insl3

Male sexual differentiation and development are androgen dependent, and it is well established that exposure to antiandrogens during fetal development typically suppresses male sexual maturation and associates in male newborn rats with decreased anogenital distance, nipple retention, hypoplasia and malformation of the external genitalia, cryptorchidism, blind vaginal pouches, and hypospermatogenesis (9 –12). However, to date, the molecular mechanism underlying these observations have not been well characterized. Given the similar observations in the Dhh-null mice, we hypothesized that exposure to the androgen receptor (AR) antagonist flutamide during fetal development interferes with Dhh signaling and results in impaired Leydig cell differentiation, which could partly explain the observations in these animals after birth.


for 1 h at room temperature in the presence of a polyclonal rabbit antihuman steroidogenic acute regulatory protein (StAR) antibody (kindly donated by Dr. J. F. Strauss, III) (13) diluted 1:1000 in PBS with 1% BSA and 0.02% NaN3 or with a polyclonal rabbit antihuman AR antibody (N-20; Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:1000 (0.2 ␮g/ml). ␤-Actin was used as an internal loading control and was detected using a monoclonal mouse anti-␤-actin antibody (clone AC-15; SigmaAldrich, St. Louis, MO) diluted 1:20,000 (0.14 ␮g/ml). Antibody binding was detected using corresponding horseradish peroxidase-linked antirabbit and antimouse antibodies diluted 1:5000 (Amersham) for 1 h at room temperature and visualized by ECL chemiluminescence (Amersham) on FujiFilm Super RX films. Relative labeling intensity was quantified with Chemi Imager 4400 software (Chemi Imager, Alpha Innotech Corp., San Leandro, CA). StAR and AR labeling intensities were normalized to ␤-actin. At least five individual samples were run and analyzed in each experiment.

In vitro organ cultures

Materials and Methods Animals Timed pregnant Sprague Dawley rats (Harlan, Zeist, The Netherlands) were housed individually with a 12-h light, 12-h dark cycle at 21 C and 55% relative humidity and received pelleted low-soy-content rat chow 关RM1/RM3(E) SQC; Special Diet Service, Witham, UK兴 and water ad libitum. The animals were killed by CO2 asphyxiation and cervical dislocation. The uteri were removed and placed on ice. The number of fetuses, fetal weight, and gender were recorded. Neonates, at the age of 1 d, were killed by decapitation, and thereafter, testes were excised. The experimental protocols were approved by the Turku University Committee on Ethics of Animal Experiments.

Treatment Timed pregnant rats were randomly assigned to experimental or control groups (n ⫽ 3 in each). The day when sperm was found in the vagina was considered 0.5 dpc. Flutamide (Sigma Chemical Co., St. Louis, MO) was dissolved in dimethylsulfoxide and diluted in corn oil to 25 mg/ml. The animals were treated once daily by oral gavage with flutamide (25 mg/kg body weight) from 10.5 dpc until killing or delivery. Control rats received vehicle only.

Testes with adjacent mesonephroi were explanted from 14.5-dpc fetuses and grown for 3 d in 24-well culture plates on agarose blocks placed in DMEM containing 10% fetal calf serum and 50 ␮g/ml gentamicin and incubated at 37 C in a humidified atmosphere containing 95% air/5% CO2. The blocks were prepared by dissolving 2% agarose in DMEM by boiling in a microwave at the lowest intensity. Gentamicin (50 ␮g/ml) and 10% serum were then added after cooling the agarose until approximately 60 C. Testes were cultured in the presence of either 12 nM recombinant mouse sonic hedgehog (rmShh), 25 ␮M cyclopamine (steroidal alkaloid that inhibits hedgehog signaling; Biomol Research Labs, Plymouth Meeting, PA), or vehicle only. Medium for testosterone analysis was collected after 24, 48, and 72 h in culture. After 3 d in culture, five testes per treatment were fixed in 4% neutrally buffered paraformaldehyde and embedded in paraffin for hematoxylin-eosin staining and cleaved-caspase 3 immunohistochemistry, and six to eight testes were individually snap frozen for quantitative mRNA analysis.

Real-time quantitative PCR

For Western blot analysis and intratesticular steroid hormone measurements, 10 testes of 15.5-dpc fetuses, four testes of 17.5-dpc fetuses, three testes of 19.5-dpc fetuses, and two testes of neonates (1 d postnatal) were pooled accordingly and snap frozen in liquid nitrogen. Samples were stored at ⫺80 C until analysis. Hormone levels were determined in at least four pooled samples. For expression studies, fetal testes were excised at 14.5, 15.5, 17.5, and 19.5 dpc and from neonates. Of each pair, one testis was snap frozen for RNA analysis, whereas the contralateral testis was fixed in 4% buffered paraformaldehyde and embedded in paraffin for immunohistochemistry.

Expression levels of Dhh, Ptc1, Sf1, Insl3, StAR, cytochrome P450 side-chain cleavage (P450scc), and 3␤-hydroxysteroid dehydrogenase type 1 (Hsd3b1) were quantified using real-time PCR on the DNA Engine Opticon System (MJ Research, Inc., Waltham, MA). Oligonucleotide sequences of the primers used are described in Table 1. All primer pairs were intron spanning to exclude coamplification of genomic DNA. Total testicular RNA was isolated using RNeasy kit (QIAGEN, Germantown, MD) according to the manufacturer’s instructions. In short, each snapfrozen testis was homogenized using a plastic Eppendorf pestle, and the DNA was sheared using Qia-shredder columns (QIAGEN). Two micrograms total RNA were reverse transcribed using avian myeloblastosis virus reverse transcriptase (30 U), reverse transcriptase buffer (Promega Corp., Madison, WI), 1 ␮g oligo(dT)15 primer (Promega), and 40 U ribonuclease inhibitor (RNasin; Promega) in a final volume of 25 ␮l. The cDNA was diluted 1:5, and duplicates of 5 ␮l were used to quantify the expression of various genes in each cDNA sample using Quantitect SYBR Green PCR kit (QIAGEN). Expression levels of the respective genes were normalized to the level of the housekeeping gene ribosomal protein S26.

Western blot analysis

Immunohistochemistry

Pooled testicular samples were homogenized in 35 ␮l ice-cold lysis buffer (0.2% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride in PBS). Homogenates were then centrifuged for 15 min at 14,000 rpm at 4 C, and the supernatants were used for the assessment of protein concentration by the Bradford method (Bio-Rad Laboratories AB, Sundbyberg, Sweden). Equal amounts of protein (20 ␮g) were separated by 12.5% SDS-PAGE and transferred onto nitrocellulose membrane (Hybond-P; Amersham Biosciences, Buckinghamshire, UK). To block unspecific antibody binding, the membrane was incubated overnight at 4 C in PBS containing 3% nonfat milk powder and 0.3% Tween 20. Immunochemical detection of the proteins was performed by incubating the membrane

Cleaved-caspase 3 immunoreactivity was used as a marker for apoptosis. The monoclonal rabbit antibody (Asp175; Cell Signaling Technology, Beverly, MA) detects endogenous levels of the large fragment of activated caspase-3 resulting from cleavage adjacent to Asp175. The antibody does not recognize full-length caspase-3 or other cleaved caspases. Deparaffinized sections of the paraformaldehyde-fixed paraffin-embedded organ cultures were reacted to 3% hydrogen peroxide to inhibit endogenous peroxidase activity. The sections were washed in Tris-buffered saline containing 0.5% Triton X-100 (TBS/T, pH 7.4) (Sigma Chemicals) and unspecific antibody binding was blocked by preincubating the sections in TBS/T containing 1% BSA and 5% normal

Developmental analysis



447

TABLE 1. Oligonucleotide sequences used in the quantitative PCR measurements Oligonucleotide sequence Gene name

Product size (bp)

Sense (5ⴕ–3ⴕ)

Dhh Ptc1 Sf1 Insl3 StAR P450scc Hsd3b1 Rps26

281 324 230 313 330 510 427 300

AAGCAACTTGTGCCTCTGCT TACGTGGAGGTGGTTCATCA GTCTGTCTCAAGTTCCTCATCCTC ACGCAGCCTGTGGACACC AGGCAGGGGGATCTTTCTAA AGATCCCTTCCCCTGGTGACAATG ATGCCCAGTACCTGAGGAGA AAGGAGAAACAACGGTCGTG

goat serum (NGS) for 30 min. The sections were then incubated with cleaved-caspase 3 antibody diluted 1:50 in TBS/T containing 0.1% BSA and 0.5% NGS. After washing three times for 5 min each in TBS/T, the sections were reacted to a horseradish peroxidase-linked goat antirabbit secondary antibody (diluted 1:400 in TBS/T containing 0.1% BSA and 0.5% NGS). After three washes, antibody binding was visualized by reacting the sections to 3,3⬘-diaminobenzidine according to the manufacturer’s instructions (Zymed Laboratories, South San Francisco, CA). Control incubations were carried out by substituting the primary antibody with nonimmune rabbit serum.

Hormone levels Intratesticular testosterone and progesterone levels from diethyl ether extracts of testicular homogenates and testosterone from culture media were measured using a time-resolved fluoroimmunoassay (Delfia; PerkinElmer Life and Analytical Sciences, Wallac Oy, Turku, Finland). Testes were homogenized by Ultra-Turrax in 0.5 ml ice-cold PBS, and 0.1 ml of the homogenate was taken for ether extraction. Ether-extracted samples were reconstituted to 0.1 ml Dilution II buffer (PerkinElmer), and 25 ␮l was taken for analysis. The intra- and interassay variations were less than 6 and 12%, respectively. Plasma LH was measured by two-site time-resolved fluoroimmunoassay (Delfia; PerkinElmer) as described by Haavisto et al. (14). The sensitivity of the LH assay was 0.75 pg/tube, the intraassay coefficient of variation less than 5% at more than 1 ␮g/liter, and interassay coefficient of variation 7.8% at 0.78 ␮g/liter.

Statistical analysis Significant differences in fetal testosterone, progesterone, LH, StAR, and AR levels were analyzed by ANOVA with the post hoc Dunnett’s test. Testosterone secretion in the in vitro experiments was analyzed by ANOVA with repeated measurements followed by t tests with Bonferroni correction. Gene expression levels were also analyzed by ANOVA followed by t tests

Antisense (5ⴕ–3ⴕ) TCGTCCCAACCTTCAGTCAC AACACCAAGGGCAAGAAATG CTCGTTGCCCAAATGCTTAT CAATCCGGGGGTGTTTCATT TGCCTGACTAGGGTTTCGTT CCAGGCGCTCCCCAAATACAACA TTGAGGGCCGCAAGTATCA GCAGGTCTGAATCGTGGTG

GenBank accession no. XM343327 AY357891 NM053344 AF139918 NM031558 NM017286 M38178 BC061561

with Bonferroni correction. A P value of 0.05 was adopted as the level of significance.

Results Fetal development study Administration of flutamide from 10.5 dpc until delivery did not affect the body weights of either the dams or the fetuses when compared with vehicle-treated control animals (Fig. 1). During normal development, fetal intratesticular testosterone concentrations, but not progesterone, increased with age (Fig. 2A). At 15.5 dpc, testicular testosterone content was 62 ⫾ 12 pg/testis, and at 17.5 dpc, it was 222 ⫾ 40 pg/testis (P ⬍ 0.05). At 19.5 dpc, intratesticular testosterone significantly increased to 318 ⫾ 43 pg/testis (P ⬍ 0.01) and reached its maximal level. In neonates, the testicular testosterone content had decreased to 183 ⫾ 44 pg/testis. The fetal testicular progesterone content decreased slightly throughout development (Fig. 2A). At 15.5 dpc the progesterone content was 139 ⫾ 17 pg/testis, and at 17.5 dpc, progesterone content was 114 ⫾ 7 pg/ testis. At 19.5 dpc, the testicular progesterone content decreased to 110 ⫾ 6 pg/testis, and in neonates, it was only 91 ⫾ 6 pg/testis. Serum LH levels significantly increased (P ⬍ 0.01) from 8.6 ⫾ 3.7 pg/ml at 17.5 dpc to 20.0 ⫾ 4.5 pg/ml at 1 d in neonates. The expression of StAR and AR protein paralleled the testicular testosterone profile (Fig. 2, B and C). At 19.5 dpc, the expression level of StAR protein had elevated 1.7-fold (ratio 2.45 ⫾ 0.46) compared with the level at 15.5 dpc (ratio 1.45 ⫾

FIG. 1. Maternal (left) and fetal (right) body weights in rats exposed to either vehicle (control) or 25 mg/kg flutamide. Values are means ⫾ SD for three dams per group or means ⫾ SEM for three litters per group, respectively. There were no significant differences between the control groups and the flutamide-exposed groups. NB, Newborns.

448

Brokken et al.


FIG. 2. Fetal intratesticular testosterone (T), progesterone (P4) and plasma LH levels (A) and StAR and AR protein quantified by Western blot analysis (B) in fetal rats at 15.5, 17.5, and 19.5 dpc and in newborns (NB). Representative Western blots of SHAR and AR expression are shown in C. *, P ⬍ 0.05; **, P ⬍ 0.01. T and P4 are compared with levels at 15.5 dpc. LH is compared with the level at 17.5 dpc. Values are means ⫾ SD from three to nine pooled samples per group.


In vitro organ cultures To test whether impaired Dhh signaling could be responsible for the suppressed gene expression levels in the in vivo experiments, we used an in vitro testis organ culture where 14.5-dpc fetal testis were cultured for 3 d in the presence of vehicle, the hedgehog inhibitor cyclopamine (15, 16), or rmShh, a ligand for Ptc1. Indeed, when fetal testes were cultured in the presence of cyclopamine, they expressed significantly lower levels of not only Ptc1 but also of Insl3 and P450scc and Hsd3b1 (Fig. 4). On the other hand, when fetal testes were cultured in the presence of rmShh, the expression levels of Ptc1 and Insl3 but not P450scc or Hsd3b1 were significantly increased compared with testes cultured in the presence of vehicle only. Sf1 expression showed a similar trend, but this did not reach statistical significance. Testosterone secretion by testes cultured in the presence of cyclopamine was significantly lower between 24 – 48 and 48 –72 h compared with testes cultured in the presence of vehicle (Fig. 4). Histological and immunohistochemical analysis of the testismesonephros organ cultures showed that after 3 d in culture, the Wolffian duct was well developed in the vehicle and rmShhexposed samples, whereas in the cyclopamine-exposed cultures, it had remained closed (Fig. 5, A–C). In the latter, the efferent ducts appeared widened and the epithelium was flattened. Moreover, the cyclopamine-exposed testes partly maintained the Mu¨llerian duct, which had regressed in the vehicle and rmShh-exposed testes. Hsd3b1 immunohistochemistry suggested a reduced number of steroidogenic Leydig cells after cyclopamine treatment (data not shown). To determine whether this decrease was due to increased apoptosis, the cultures were subjected to cleaved-caspase 3 immunohistochemistry. Whereas no clear conclusion regarding number of apoptotic Leydig cells could be drawn, cleaved-caspase 3 immunostaining revealed extensive apoptosis in the Wolffian ducts when cultured in the presence of cyclopamine but not in the controls or rmShh-treated organ cultures. (Fig. 5, D–F). Interestingly, a similar expression pattern as observed in the cyclopamine-treated testes was observed in nontreated fetal ovary cultures (data not shown).

Discussion 0.42). The expression level of testicular AR followed a similar trend. AR levels increased 1.9-fold at 17.5 dpc, 3.1-fold at 19.5 dpc, and 2.2-fold in the newborns compared with the levels at 15.5 dpc. Gene expression levels In utero exposure to flutamide significantly decreased mRNA expression levels of Dhh in fetal testes on 17.5 dpc (Fig. 3). Ptc1 expression was significantly suppressed on 17.5 and 19.5 dpc and in neonates. Sf1 was also significantly suppressed at 17.5 dpc in the flutamide-exposed litters. At 14.5 and 15.5 dpc, Sf1 expression was significantly higher than control. We do not know what mechanism might underlie this change. Expression levels of the steroidogenic enzymes P450scc and Hsd3b1 and the growth factor Insl3 were significantly lower in the flutamide-exposed testes than in control at 17.5 dpc and 1 d after birth.

In this study, we have shown that the expression patterns of several genes that are critically involved in sexual differentiation of the testis are affected by antiandrogenic action in utero. Moreover, we have shown that this results in impaired differentiation of fetal Leydig cells, which is reflected by suppressed Insl3, P450scc, and Hsdb1 expression in vivo. These findings explain in part how antiandrogen exposure during fetal development suppresses sexual maturation in males. During normal fetal development, intratesticular testosterone levels increased steadily from 15.5 dpc onward with a peak at 19.5 dpc and a subsequent decline 1 d after birth. This was paralleled by increased AR and StAR expression. Using immunohistochemistry, we have observed weak AR immune reactivity in peritubular myoid cells and interstitial cells earliest at 15.5 dpc (data not shown). AR immune reactivity has been demonstrated in fetal rats as early as 14.5 dpc in interstitial cells and peritubular



449

FIG. 3. Gene expression levels of Dhh, Ptc1, Sf1, P450scc, Hsd3b1, and Insl3 analyzed by real-time quantitative PCR in testes from fetuses that have been exposed in utero to either vehicle (E) or flutamide (F) at different time points after conception and 1 d after birth (newborns, NB). Expression levels are normalized to the level of the gene encoding ribosomal protein S26. Horizontal lines indicate means of the groups. Significant differences between vehicle- and flutamide-exposed groups are indicated. *, P ⬍ 0.05; **, P ⬍ 0.01; ***, P ⬍ 0.001.

myoid cells, but it is absent from fetal Sertoli cells (17). Using double immunohistochemistry, Mylchreest et al. (18) have convincingly identified the presence of AR and Hsd3b1 double-positive Leydig cells in the fetal rat testis at 16 and 18 dpc. However, others did not observe this colocalization and argued that AR is not expressed in fetal Leydig cells but localizes to the interstitial cells surrounding the seminiferous cords from 17 dpc onward (19). Concomitantly, LH levels steadily increased from 17.5 dpc up to 1 d after birth, reflecting proliferation and functional differentiation of fetal-type Leydig cells that are responsible for the produc-

tion of androgens and consequent development of the male reproductive tract. The signaling pathways that induce differentiation of fetaltype Leydig cells are largely unknown, but studies in mice have provided evidence that Dhh/Ptc1 signaling triggers fetal Leydig cell differentiation through up-regulation of Sf1 and P450scc (20, 21). Dhh is expressed and secreted by the Sertoli cells (5) and binds to Ptc1 receptors that are expressed by peritubular myoid cells and possibly interstitial Leydig cells (6). Sf1 is a nuclear transcription factor that regulates the transcription of a wide

FIG. 4. Gene expression levels and testosterone secretion by fetal testes that were excised at 14.5 dpc and cultured for 3 d in the presence of vehicle (control), 25 ␮M cyclopamine, or 12 nM rmShh. Gene expression levels were analyzed in six to eight testes per treatment. Testosterone secretion was determined from five testes per treatment, and culture medium was collected after 24, 48, and 72 h. Values are means ⫾ SD. Significant differences compared with vehicle-exposed groups are indicated. *, P ⬍ 0.05; **, P ⬍ 0.01; ***, P ⬍ 0.001.

450

Brokken et al.



FIG. 5. Representative photomicrographs of paraformaldehyde-fixed paraffin-embedded fetal testes that were cultured for 3 d in the presence of vehicle (A and D), 25 ␮M cyclopamine (B and E), or 12 nM rmShh (C and F). Sections were either stained with hematoxylin-eosin (A–C) or processed for cleaved-caspase 3 immunocytochemistry (D–F). Arrows indicate localization of the Wolffian duct; arrowheads indicate a remnant of the Mu¨llerian duct; solid line delineates testicular tissue (T). Scale bar, 100 ␮m.

variety of genes that are involved in the development of steroidogenic tissues (22), including genes that encode StAR and the steroidogenic enzymes P450scc, Hsd3b1, and 17␣-hydroxylase (Cyp17) (23–25). Moreover, in a recent study, Park et al. (26) showed that Dhh-driven Leydig cell development in the mouse is directly dependent on Sf1. In the fetal mouse testis, Sf1 expression marks the proliferative phase of pre-Sertoli cells and fetal Leydig cells (27). It should be noted that so far, to our knowledge, data regarding the role and function of Dhh signaling in fetal rat testis development are lacking. In utero exposure to the antiandrogen flutamide decreased the expression of Dhh and Sf1 at 17.5 dpc. Immunohistochemical analysis of the expression of the Sertoli cell marker Sox9 in flutamide-exposed testes did not reveal a change in Sertoli cell numbers (data not shown). In the rat, Sf1 expression starts around 11.5 dpc in the adrenogenital primordia, and in male rats, the expression levels remain high during gestation and localizes to both Sertoli cells and Leydig cells around 15 dpc (28, 29). In the mouse, expression of Dhh begins at 11.5 dpc and continues afterward in the Sertoli cell lineage (5, 21). Dhh is a ligand for the Ptc1 receptor (30), whose expression in the mouse becomes evident at 12.5 dpc in interstitial Leydig cells (21). Several studies have indicated the importance of androgens on fetal Sertoli and Leydig cell function (3, 31, 32). For example, both the androgen-insensitive Tfm mouse, which carries an inactivating mutation in the AR, as well as the AR-knockout mouse (33, 34) exhibit decreased numbers of Sertoli cells just after birth. Thus, androgenic effects on fetal Leydig cells and fetal Sertoli cells are mediated either directly through AR-positive fetal Leydig cells or, alternatively, through the peritubular myoid cells that do express AR during fetal development. Differentiation of these peritubular myoid cells is induced by Sertoli cell-derived Dhh (21, 35). If the peritubular myoid cells are the primary targets of androgen action, then they must signal to the Sertoli cells in a paracrine manner where they regulate Dhh expression. In turn, Dhh secretion would induce differentiation of not only the peritubular myoid cells but also of the

fetal Leydig cells. In either case, flutamide exposure interferes with these signaling pathways, resulting in impaired fetal Leydig cell differentiation and suppressed levels of Insl3, P450scc, and Hsd3b1. Presumably, this leads to insufficient levels of testosterone and Insl3, which prevents full masculinization. Similar results were obtained by Borch et al. (36) who observed reduced mRNA expression levels of Sf1, Insl3, P450scc, and StAR in 21-dpc rat fetuses that had been exposed to the antiandrogen diethylhexyl phthalate. The flutamide dose used in our study was relatively low, and therefore it might not have caused a total block of AR, which might explain why we did not see more dramatic effects. Due to the complexity of the experimental setting, it was not feasible to include more doses. When Dhh signaling was inhibited in fetal testis-mesonephros organ cultures, it had the same effects on fetal Leydig cell maturation as exposure to flutamide. Cyclopamine-exposed organ cultures showed dramatically decreased levels not only of Ptc1 but also of the growth factor Insl3 and the steroidogenic enzymes P450scc and Hsd3b1. Conversely, when Dhh signaling was stimulated using rmShh, Insl3 expression was increased. Although no effect was seen on the mRNA expression of P450scc and Hsd3b1, testosterone secretion by the cyclopamine-exposed testis cultures was severely affected. Organ cultures that were exposed to vehicle typically showed a well-developed Wolffian duct. The cultures exposed to cyclopamine, on the other hand, were characterized by a closed duct that showed massive apoptosis as judged by the marker cleavedcaspase 3, reflecting that testosterone is necessary for the maintenance of the Wolffian duct. In a recent study, Welsh et al. (37) showed that Wolffian duct development is a biphasic process and that flutamide exposure in utero specifically during the early window from 15.5–17.5 dpc resulted in incomplete or absent Wolffian ducts in adult male rats. These findings fit well with our results obtained in the in vitro organ cultures where 14.5-dpc testes were cultured for 3 subsequent days. Moreover, in testis cultures that had been exposed to cyclopamine, remnants of the Mu¨llerian duct could still be discerned. In the vehicle- or rmShh-exposed testis, these remnants were absent, suggesting that inhibition of hedgehog signaling


additionally impairs the production of anti-Mu¨llerian hormone by the Sertoli cells. The mechanism underlying this effect is not known. Taken together, our results suggest that antiandrogenic exposure in utero interferes with Dhh expression by fetal Sertoli cells, possibly mediated through peritubular myoid cells. Diminished Dhh secretion, in addition to possible direct effects of flutamide, impairs proper fetal Leydig cell differentiation causing insufficient levels of testosterone and Insl3 to maintain proper masculinization of the male reproductive system.


14.

15. 16. 17.

18.

Acknowledgments

19.

Address all correspondence and requests for reprints to: Jorma Toppari, Department of Physiology, University of Turku, Kiinamyllynkatu 10, 20520 Turku, Finland. E-mail: [email protected]. This work was supported by The Academy of Finland, The Centre of Excellence, Sigrid Juse´lius Foundation, the European Commission under the framework of the “Quality of Life” program (Contract QLK4-CT2002-00603), and the Turku University Hospital. Disclosure Statement: L.J.S.B., A.A., and J.P. have nothing to declare. J.T. received lecture fees from Pfizer-Academy once.

22.

References

25.

1. Toppari J, Larsen JC, Christiansen P, Giwercman A, Grandjean P, Guillette Jr LJ, Jegou B, Jensen TK, Jouannet P, Keiding N, Leffers H, McLachlan JA, Meyer O, Muller J, Rajpert-De Meyts E, Scheike T, Sharpe R, Sumpter J, Skakkebaek NE 1996 Male reproductive health and environmental xenoestrogens. Environ Health Perspect 104(Suppl 4):741– 803 2. Skakkebaek NE, Rajpert-De Meyts E, Main KM 2001 Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects. Hum Reprod 16:972–978 3. Welsh M, Saunders PT, Fisken M, Scott HM, Hutchison GR, Smith LB, Sharpe RM 2008 Identification in rats of a programming window for reproductive tract masculinization, disruption of which leads to hypospadias and cryptorchidism. J Clin Invest 118:1479 –1490 4. Bitgood MJ, McMahon AP 1995 Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev Biol 172:126–138 5. Bitgood MJ, Shen LY, McMahon AP 1996 Sertoli cell signaling by Desert hedgehog regulates the male germline. Curr Biol 6:298 –304 6. Clark AM, Garland KK, Russell LD 2000 Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biol Reprod 63:1825–1838 7. Kawamura K, Kumagai J, Sudo S, Chun SY, Pisarska M, Morita H, Toppari J, Fu P, Wade JD, Bathgate RA, Hsueh AJ 2004 Paracrine regulation of mammalian oocyte maturation and male germ cell survival. Proc Natl Acad Sci USA 101: 7323–7328 8. Zimmermann S, Steding G, Emmen JMA, Brinkmann AO, Nayernia K, Holstein AF, Engel W, Adham IM 1999 Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol 13:681– 691 9. Gray Jr LE, Ostby JS, Kelce WR 1994 Developmental effects of an environmental antiandrogen: the fungicide vinclozolin alters sex differentiation of the male rat. Toxicol Appl Pharmacol 129:46 –52 10. Mylchreest E, Cattley RC, Foster PM 1998 Male reproductive tract malformations in rats following gestational and lactational exposure to di(n-butyl) phthalate: an antiandrogenic mechanism? Toxicol Sci 43:47– 60 11. Ostby J, Kelce WR, Lambright C, Wolf CJ, Mann P, Gray Jr LE 1999 The fungicide procymidone alters sexual differentiation in the male rat by acting as an androgen-receptor antagonist in vivo and in vitro. Toxicol Ind Health 15:80 –93 12. You L, Casanova M, Archibeque-Engle S, Sar M, Fan LQ, Heck HA 1998 Impaired male sexual development in perinatal Sprague Dawley and Long-Evans hooded rats exposed in utero and lactationally to p,p⬘-DDE. Toxicol Sci 45:162–173 13. Pollack SE, Furth EE, Kallen CB, Arakane F, Kiriakidou M, Kozarsky KF,

20. 21.

23.

24.

26.

27. 28.

29.

30. 31.

32.

33.

34.

35. 36.

37.

451

Strauss 3rd JF 1997 Localization of the steroidogenic acute regulatory protein in human tissues. J Clin Endocrinol Metab 82:4243– 4251 Haavisto AM, Pettersson K, Bergendahl M, Perheentupa A, Roser JF, Huhtaniemi I 1993 A supersensitive immunofluorometric assay for rat luteinizing hormone. Endocrinology 132:1687–1691 Chen JK, Taipale J, Cooper MK, Beachy PA 2002 Inhibition of Hedgehog signaling by direct binding of cyclopamine to Smoothened. Genes Dev 16:2743–2748 Cooper MK, Porter JA, Young KE, Beachy PA 1998 Teratogen-mediated inhibition of target tissue response to Shh signaling. Science 280:1603–1607 You L, Sar M 1998 Androgen receptor expression in the testes and epididymides of prenatal and postnatal Sprague Dawley rats. Endocrinology 9:253– 261 Mylchreest E, Sar M, Wallace DG, Foster PM 2002 Fetal testosterone insufficiency and abnormal proliferation of Leydig cells and gonocytes in rats exposed to di(n-butyl) phthalate. Reprod Toxicol 16:19 –28 Majdic G, Millar MR, Saunders PT 1995 Immunolocalisation of androgen receptor to interstitial cells in fetal rat testes and to mesenchymal and epithelial cells of associated ducts. J Endocrinol 147:285–293 Yao HH, Capel B 2002 Sertoli cell-derived desert hedgehog signaling specifies fetal Leydig cell fate in testis organogenesis. Biol Reprod 66:191–192 Yao HH, Whoriskey W, Capel B 2002 Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis. Genes Dev 16:1433–1440 Val P, Lefrancois-Martinez AM, Veyssiere G, Martinez A 2003 SF-1 a key player in the development and differentiation of steroidogenic tissues. Nucl Recept 1:8 Morohashi K, Honda S, Inomata Y, Handa H, Omura T 1992 A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s. J Biol Chem 267:17913–17919 Leers-Sucheta S, Morohashi K, Mason JI, Melner MH 1997 Synergistic activation of the human type II 3␤-hydroxysteroid dehydrogenase/⌬5-⌬4 isomerase promoter by the transcription factor steroidogenic factor-1/adrenal 4-binding protein and phorbol ester. J Biol Chem 272:7960 –7967 Reinhart AJ, Williams SC, Clark BJ, Stocco DM 1999 SF-1 (steroidogenic factor-1) and C/EBP␤ (CCAAT/enhancer binding protein-␤) cooperate to regulate the murine StAR (steroidogenic acute regulatory) promoter. Mol Endocrinol 13: 729 –741 Park SY, Tong M, Jameson JL 2007 Distinct roles for steroidogenic factor 1 and desert hedgehog pathways in fetal and adult Leydig cell development. Endocrinology 148:3704 –3710 Schmahl J, Eicher EM, Washburn LL, Capel B 2000 Sry induces cell proliferation in the mouse gonad. Development 127:65–73 Hatano O, Takayama K, Imai T, Waterman MR, Takakusu A, Omura T, Morohashi K 1994 Sex-dependent expression of a transcription factor, Ad4BP, regulating steroidogenic P-450 genes in the gonads during prenatal and postnatal rat development. Development 120:2787–2797 Ikeda Y, Shen WH, Ingraham HA, Parker KL 1994 Developmental expression of mouse steroidogenic factor-1, an essential regulator of the steroid hydroxylases. Mol Endocrinol 8:654 – 662 Hooper JE, Scott MP 1989 The Drosophila patched gene encodes a putative membrane protein required for segmental patterning. Cell 59:751–765 Abel MH, Baker PJ, Charlton HM, Monteiro A, Verhoeven G, De Gendt K, Guillou F, O’Shaughnessy PJ 2008 Spermatogenesis and Sertoli cell activity in mice lacking Sertoli cell receptors for follicle-stimulating hormone and androgen. Endocrinology 149:3279 –3285 Scott HM, Hutchison GR, Jobling MS, McKinnell C, Drake AJ, Sharpe RM 2008 Relationship between androgen action in the “male programming window,” fetal Sertoli cell number and adult testis size in the rat. Endocrinology 149:5280 –5287 Tan KA, De Gendt K, Atanassova N, Walker M, Sharpe RM, Saunders PT, Denolet E, Verhoeven G 2005 The role of androgens in Sertoli cell proliferation and functional maturation: studies in mice with total or Sertoli cell-selective ablation of the androgen receptor. Endocrinology 146:2674 –2683 Johnston H, Baker PJ, Abel M, Charlton HM, Jackson G, Fleming L, Kumar TR, O’Shaughnessy PJ 2004 Regulation of Sertoli cell number and activity by follicle-stimulating hormone and androgen during postnatal development in the mouse. Endocrinology 145:318 –329 Pierucci-Alves F, Clark AM, Russell LD 2001 A developmental study of the desert hedgehog-null mouse testis. Biol Reprod 65:1392–1402 Borch J, Metzdorff SB, Vinggaard AM, Brokken LJS, Dalgaard M 2006 Mechanisms underlying the anti-androgenic effects of diethylhexyl phthalate in fetal rat testis. Toxicol 223:144 –155 Welsh M, Saunders PT, Sharpe RM 2007 The critical time window for androgen-dependent development of the Wolffian duct in the rat. Endocrinology 148:3185–3195