The Journal of Immunology
Grafting of “Abbreviated” Complementarity-Determining Regions Containing Specificity-Determining Residues Essential for Ligand Contact to Engineer a Less Immunogenic Humanized Monoclonal Antibody Roberto De Pascalis,* Makoto Iwahashi,1* Midori Tamura,2* Eduardo A. Padlan,3† Noreen R. Gonzales,* Ameurfina D. Santos,4† Mariateresa Giuliano,5* Peter Schuck,‡ Jeffrey Schlom,6* and Syed V. S. Kashmiri* Murine mAb COL-1 reacts with carcinoembryonic Ag (CEA), expressed on a wide range of human carcinomas. In preclinical studies in animals and clinical trials in patients, murine COL-1 showed excellent tumor localization. To circumvent the problem of immunogenicity of the murine Ab in patients, a humanized COL-1 (HuCOL-1) was generated by grafting the complementaritydetermining regions (CDRs) of COL-1 onto the frameworks of the variable light and variable heavy regions of human mAbs. To minimize anti-V region responses, a variant of HuCOL-1 was generated by grafting onto the human frameworks only the “abbreviated” CDRs, the stretches of CDR residues that contain the specificity-determining residues that are essential for the surface complementarity of the Ab and its ligand. In competition RIAs, the recombinant variant completely inhibited the binding of radiolabeled murine and humanized COL-1 to CEA. The HuCOL-1 and its variant showed no difference in their binding ability to the CEA expressed on the surface of a CEA-transduced tumor cell line. Compared with HuCOL-1, the HuCOL-1 variant showed lower reactivity to patients’ sera carrying anti-V region Abs to COL-1. The final variant of the HuCOL-1, which retains its Ag-binding reactivity and shows significantly lower serum reactivity than that of the parental Ab, can serve as a prototype for the development of a potentially useful clinical reagent. The Journal of Immunology, 2002, 169: 3076 –3084.
T
he mAbs against tumor Ag hold promise for diagnosis and therapy of human cancers (reviewed in Refs. 1–3). A major impediment to the clinical use of murine mAbs is the human anti-murine Ab (HAMA)7 response these mAbs elicit in patients (4 –7). To obviate the potential HAMA response, humanized Abs have been developed by grafting the complementarity-
*Laboratory of Tumor Immunology and Biology, Center for Cancer Research, National Cancer Institute, †Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, and ‡Division of Bioengineering and Physical Sciences, Office of Research Services, Office of the Director, National Institutes of Health, Bethesda, MD 20892 Received for publication April 12, 2002. Accepted for publication July 3, 2002. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1
Current address: Wakayama Medical School, 27 Shichibancho, Wakayama 640, Japan.
2
Current address: Tohoku University School of Medicine, 1-1 Seiro-Machi, AobaKu, Sendai 980-77, Japan. 3 Current address: Marine Science Institute, College of Science, University of the Philippines, Diliman, Quezon City, Philippines. 4
Current address: Institute of Molecular Biology and Biotechnology, College of Science, University of the Philippines, Diliman, 1101 Quezon City, Philippines.
5 Current address: Dipartimento Medicina Sperimentale, Sezione di Biotecnologie e Biologia Molecolare, Facolta’ di Medicina e Chirurgia, Seconda Universita’ degli Studi di Napoli, Via Costantinopoli 16, 80128 Naples, Italy. 6 Address correspondence and reprint requests to Dr. Jeffrey Schlom, Laboratory of Tumor Immunology and Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892. E-mail address:
[email protected] 7 Abbreviations used in this paper: HAMA, human anti-murine Ab; CDR, complementarity-determining region; SDR, specificity-determining residue; CEA, carcinoembryonic Ag; NCA, nonspecific cross-reacting Ag; m, murine; c, chimeric; Hu, humanized; pBSc, pBluescript II S/K⫹; SPR, surface plasmon resonance.
Copyright © 2002 by The American Association of Immunologists, Inc.
determining regions (CDRs) of the murine Ab onto the frameworks of the variable light (VL) and variable heavy (VH) regions of human mAbs (reviewed in Ref. 8). Humanization of a xenogeneic Ab, however, does not necessarily eliminate the immunogenicity of the molecule, because the humanized molecule can evoke anti-V region response (7, 9 –13). It has been proposed that binding of an Ab to an Ag involves only a small number of residues within the CDRs. The latter residues have been designated as specificity-determining residues (SDRs) (14). In an attempt to circumvent anti-V region response in patients, a murine Ab has been humanized by grafting only its SDRs onto human frameworks (13). The carcinoembryonic Ag (CEA), a cell surface glycoprotein of 180-kDa molecular mass, is one of the most widely used human tumor markers. It is expressed at high levels in the embryonic and fetal digestive epithelial tissue and, to a lesser extent, in normal adult colon and stomach epithelium (15). CEA is overexpressed in ⬃95% of gastrointestinal and pancreatic cancers, as well as in most non-small-cell lung carcinomas. Also, it is expressed in breast carcinoma and squamous cell carcinoma of the head and neck (reviewed in Refs. 11 and 16). A number of murine anti-CEA mAbs have been generated (17) and used for measuring CEA levels in blood (18) and for immunohistopathology of tissues from cancer patients (11, 19). In addition, Abs directed to CEA were among the first to be used in clinical trials to successfully localize tumors (20 –23). Also, several clinical trials have been conducted to evaluate the anti-tumor activity of anti-CEA mAbs (24 –27). CEA has some degree of cross-reactivity with several proteins, including nonspecific cross-reacting Ag-1 (NCA-1), normal fecal Ag-1, and the NCA-related proteins present in human granulocytes (17). 0022-1767/02/$02.00
The Journal of Immunology The mAb COL-1, an IgG2a, has a high affinity for CEA and has no detectable reactivity to granulocytes or to the CEA-related Ags NCA-1 and normal fecal Ag-1 (28). Murine COL-1 (mCOL-1) reacts with biopsies of colon and gastric carcinomas (80 and 88%, respectively) and with biopsies of human mammary and nonsmall-cell lung carcinomas (17, 29). Except for some reactivity to skin and gastric and colon mucosa, mCOL-1 does not react with normal tissues (17). In preclinical studies, 125I-labeled mCOL-1 achieved good tumor radiolocalization using LS-174T colon carcinoma xenograft in athymic mice (30). In patients, 131I-labeled mCOL-1 showed good tumor targeting of human gastrointestinal carcinomas in a phase I clinical trial (24). Not unexpectedly, mCOL-1 was found to induce HAMA response in patients (24, 31). Yu et al. (24) reported that 61 and 83% of patients treated with the Ab developed elevated HAMA levels by days 20 and 40, respectively. It was observed by Meredith et al. (31) that 93% of the patients developed Ig response, with most patients developing HAMA by day 14 and some as early as days 7–11 after mCOL-1 administration. The peak of Ab response generally occurred at 4 – 6 wk after exposure. An attempt has now been undertaken to reduce the immunogenicity of the mCOL-1 mAb by progressively reducing its murine content by genetic manipulation. This report describes the development and characterization of a mouse-human chimeric COL-1 (cCOL-1) mAb, a humanized COL-1 (HuCOL-1) mAb, and variants of HuCOL-1. A final variant of HuCOL-1 was developed by a previously suggested humanization protocol (14) based on transplantation of “abbreviated” xenogeneic CDRs onto the human Ab frameworks. This variant, which retains significant Ag-binding reactivity, is minimally reactive to sera from patients who were earlier administered mCOL-1 during clinical trials.
Materials and Methods Synthetic oligonucleotides The long overlapping oligomers and oligonucleotide primers used for DNA amplifications were supplied by Lofstrand Labs (Gaithersburg, MD) and Midland Certified Reagent (Midland, TX). The sequences of the four primers that
3077 were used to generate DNA fragments encoding the VH and VL domains of the mCOL-1 mAb were as follows: 1) 5⬘ VH: 5⬘-AGTAAGCTTCCACCATG GAGTGGTCCTGGGTCTTCCTCTTCTTCCTGTCCGTGACTACTGGAG TGCACTCCGAGGTTCAGCTGCAGCA-3⬘; 2) 3⬘ VH: 5⬘-CGATGGGC CCGTAGTTTTGGCAGAGGAGACGGCGACCG-3⬘; 3) 5⬘ VL: 5⬘-TAGC AAGCTTCCACCATGGATAGCCAGGCCCAGGTGCTCATGCTCCTGCT GCTGTGGGTGAGCGGCACATGCGGCGACATTGTGCTGACACA-3⬘; 4) and 3⬘ VL: 5⬘-TGCAGCCGCGGCCCGTTTGATTTCCAGCTTGG-3⬘. Each of the 5⬘ primers carries a HindIII site followed by a sequence encoding a signal peptide. The 3⬘ VH primer carries an ApaI, whereas the 3⬘ VL primer has a SacII site. The four 119- to 133-bp-long oligonucleotides that were used to generate each of the VH and VL genes of HuCOL-1 are shown by long arrows in Fig. 1. The sequence of the 20- to 21-bp-long end primers used for DNA amplification were as follows: 5) 5⬘ VH: 5⬘CGTAAGCTTCCACCATGGAG-3⬘; 6) 3⬘ VH: 5⬘-TGGGCCCTTGGTG GAGGCTGA-3⬘; 7) 5⬘ VL: 5⬘-GCAAGCTTCCACCATGGATA-3⬘; and 8) 3⬘ VL: 5⬘-TGCAGCCGCGGTACGTTTGAT-3⬘. The 5⬘ primers (nos. 5 and 7) carry a HindIII site. Whereas a site for ApaI has been incorporated in the 3⬘ VH primer (no. 6), the sequence for the SacII site has been included in the 3⬘ VL primer (no. 8). The sequences of two additional mutagenic primers (supplied by Milligen/Bioresearch, Burlington, VT) that were used for the generation and amplification of the genes encoding the V domains of HuCOL-1 variants were as follows: 9) 3⬘ VH: 5⬘-TGCCCT GGAACTTCTGGGCATATTCAGTA-3⬘; and 10) 3⬘ VL: 5⬘-GCACTGA CACTTTGGCTGGACTTGCAGTTGATGGTGGCCCCTC-3⬘. The sequences recognized by the restriction endonucleases are in italics, and the mutagenic changes are underlined.
DNA amplification All PCRs were conducted in a final volume of 100 l of PCR buffer containing 200 M dNTPs, 3 U of Taq polymerase (Boehringer Mannheim, Indianapolis, IN), 0.2 M each of the end primers, and 100 ng of DNA template. Initial denaturation at 94°C for 2 min was followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min. It was followed by a final primer extension step at 72°C for 10 min. The VL and VH genes of the HuCOL-1 were synthesized by the overlap extension PCR that has previously been described (32). Primer-induced mutagenesis was conducted by a dual-step PCR as described by Landt et al. (33).
Expression vectors Two different baculovirus transfer vectors, pAcUW51 (BD PharMingen, San Diego, CA) and pBAC4x-1 (Novagen, Madison, WI), have been used
FIGURE 1. Nucleotide sequence of the genes encoding the V regions of HuCOL-1 and their leader peptides. Nucleotide sequences of the humanized VL (A) and VH (B) genes were generated and amplified by PCR amplification, using four overlapping synthetic oligonucleotides (indicated by arrows) that together encompass, on alternating strands, the entire sequence of each of the genes and its leader. Sequences on the flanks of the genes encoding the variable region domains and their leader peptides are shown by lower case letters. The VL region (A) is comprised of nucleotides from positions 73– 402, whereas the VH region starts from position 70 and ends at 441. The restriction enzyme sites incorporated in the oligomers to facilitate cloning are shown in italics.
3078
MINIMALLY IMMUNOGENIC Ab BY ABBREVIATED CDR GRAFTING
for generating the recombinant viruses and the subsequent coexpression of the Ig H and L chains. In pAcUW51 vector, one of the target genes can be cloned at the BamHI site located downstream of the polh promoter, whereas the other gene can be driven by the p10 promoter by inserting the gene at either the BglII or the EcoRI site located 3⬘ to the promoter. The pBAC4x-1 baculovirus transfer plasmid contains two of each of the polh and p10 promoters, with a unique cloning site placed downstream of each promoter.
and the linearized BaculoGold Baculovirus DNA (BD PharMingen). Transfectomas producing HuCOL-1 and its variants were generated by transfecting insect cells with one of the pBAC4x-1-derived expression constructs and the linearized BacVector2000 Baculovirus DNA (Novagen). A cationic liposome-mediated system (DOTAP; Boehringer Mannheim) was used for all transfections. Harvesting of the recombinant virus, screening for Ig expression, and Ag binding by ELISA have previously been described (13).
Assembly of the V and C region genes and generation of expression constructs
ELISA
To generate constructs encoding the chimeric H and L chains of mAb COL-1, the V region sequences of the H and L chain genes were PCR amplified using the phagemid constructs of the cDNAs encoding the Fd and the L chain of mCOL-1 as templates. Primers no. 3 and no. 4 were used as forward and reverse primers, respectively, to amplify a 420-bp sequence encoding the VL domain along with the signal peptide located upstream. The 3⬘ primer was designed to extend the 3⬘ end of the amplified sequence to a unique SacII site located 10 bp downstream from the start of the human C region. A DNA fragment encoding the human C region was excised from a pre-existing construct pLNCXHuCC49HuK (32) by SacII/ClaI treatment. The construct carried an EcoRI site immediately upstream of ClaI site. The V and the C regions of the L chain were joined to the HindIII/ClaI linearized pBluescript II S/K⫹ (pBSc) plasmid (Stratagene, La Jolla, CA) by three-way ligation. Taking advantage of an EcoRI site upstream of the HindIII site in pBSc, the entire L chain sequence was then released from the construct by EcoRI digestion and inserted into the baculovirus expression vector pAcUW51 at the EcoRI site located downstream from the p10 promoter. For the assembly of the chimeric H chain, a 460-bp sequence encoding the VH domain and its leader peptide was PCR amplified using primers nos. 1 and 2 as 5⬘ and 3⬘ primers, respectively. The design of the 3⬘ primer facilitated amplification of the VH sequence to extend to the ApaI site located 17 bp downstream from the start of the CH1 domain. To assemble the V and C regions, an ApaI/ClaI DNA fragment carrying the human ␥1 C region was excised from a pre-existing construct pLgpCXHuCC49HuG1 (32). The ApaI/ClaI fragment along with the 460-bp PCR product was inserted into the HindIII/ClaI linearized pBSc. The DNA encoding the entire H chain was released by HindIII/ClaI treatment of the pBSc construct. The termini of the target DNA were filled in using Klenow fragments of the DNA polymerase, and the DNA fragment was subcloned in the L chain construct of pAcUW51 at the blunt-ended BamHI site located downstream of the polh promoter. DNA manipulations similar to those described for cCOL-1 were conducted to assemble the humanized and the variant V regions and their respective C regions into pBSc for the subsequent subcloning in baculovirus expression vector pBAC4x-1. After joining the V regions of the H and L chains to their respective C regions in pBSc, the assembled L chain of the HuCOL-1 or its variant was released from the pBSc construct and cloned at the EcoRI site, downstream from the p10 promoter. The entire H chain of the HuCOL-1 or its variant was excised from its pBSc construct by HindIII/XhoI treatment, and it was cloned unidirectionally in the L chain construct of pBAC4x-1 at the HindIII/XhoI site, downstream of polh promoter. Three expression constructs were generated: one containing the variant L chain and the parental humanized H chain, the second containing the variant H chain and the parental humanized L chain, and the third carrying variants of both the L and H chains (Table I).
Insect cell culture and production of recombinant Abs Serum-free-adapted Sf9 insect cells (Life Technologies, Rockville, MD) were cultured at 27°C in Sf900-II medium (Life Technologies) with 50 g/ml gentamicin. To develop transfectomas secreting cCOL-1, insect cells were cotransfected with the pAcUW51-derived expression construct
ELISAs were conducted by coating 96-well polyvinyl microtiter plates with CEA (100 ng/well; Research Diagnostic, Flanders, NJ) or with Fc␥fragment-specific goat anti-human IgG (100 ng/well) (Jackson ImmunoResearch Laboratories, West Grove, PA). Anti-human IgG or the CEAcoated plates were used to test for the production of Ig by the insect cells or to assess its Ag reactivity, respectively. The details of the assay procedure have been reported earlier (34).
Purification of recombinant Abs Three days after infection, the supernatants were collected and made free of cellular debris and any contaminating proteins, before using protein G agarose column (Life Technologies) to purify the desired protein as described earlier (13). The protein was concentrated using Centricon 30 (Amicon, Beverly, MA) and dialyzed in PBS buffer using a Slide-A-Lyzer cassette (Pierce, Rockford, IL). The protein concentration was determined by the method of Lowry et al. (35), and the purity of the eluted proteins was evaluated by SDS-PAGE under reducing and nonreducing conditions, using precast 4 –20% Tris-glycine gel (Novex, San Diego, CA). The protein bands were visualized by Coomassie blue staining (Novex).
Competition RIA The relative Ag binding of the mCOL-1 and the recombinant Abs derived from it were determined using competition RIA. Twenty-five microliters of serial dilutions of the Abs to be tested as well as the mCOL-1, prepared in 1% BSA in PBS, were added to microtiter plates containing 200 ng of CEA saturated with 5% BSA in PBS. 125I-labeled mCOL-1 or 125I-labeled HuCOL-1 (100,000 cpm in 25 l) was then added to each well. After an overnight incubation at 4°C, the plates were washed and counted in a gamma-scintillation counter. The relative affinity constants were calculated by a modification of the Scatchard method (36).
Flow cytometric analysis A previously described method (37) has been used for FACS analysis. To evaluate the ability of HuCOL-1 and its variants to bind to cell-surface CEA, 1 ⫻ 106 retrovirally transduced MC38 cells expressing CEA (38) were resuspended in cold Ca2⫹- and Mg2⫹-free Dulbecco’s PBS and incubated with the mCOL-1-derived Abs for 30 min on ice. A human IgG was used as an isotype control. After one washing cycle, the cell suspension was stained with FITC-conjugated mouse anti-human Ab (BD PharMingen) for 30 min on ice. A second washing cycle was performed, and then the samples were analyzed with a FACScan (BD Biosciences, Mountain View, CA) using CellQuest for Macintosh. Data from analysis of 10,000 cells were obtained.
Immunoadsorption of patient serum and detection of anti-V region Abs Stored patients’ sera, from a phase I clinical trial (24) that involved the administration of 131I-labeled mCOL-1 to gastrointestinal carcinoma patients, were used to assess serum reactivity of the mCOL-1-derived Abs. Several sera were tested for the presence of anti-V region Abs to mAb COL-1. The sera, however, contain circulating Ag and anti-murine Fc Abs, which could interfere with the binding of mAb COL-1 and its derivative
Table I. Affinity constants of HuCOL-1 and its variants mAb Designation
HuCOL-1 24,25,27 L 61 H 24,25,27 61 L/ H a
L Chain Variable Domain
H Chain Variable Domain
Humanized Variant Humanized Variant
Humanized Humanized Variant Variant
Numbering convention of Kabat et al. (47).
Manipulated CDR
Positions Substituteda
– – LCDR1 24, 25, 27 HCDR2 61 LCDR1/HCDR2 24, 25, 27/61
Ka (⫻108 M⫺1)
2.82 1.20 2.64 1.03
The Journal of Immunology
3079
FIGURE 2. Humanization protocols for mAb COL-1. A, Amino acid sequences of the VL regions of mCOL-1, human Ab VJI’CL, HuCOL-1 derived from mCOL-1 and VJI’CL, and the HuCOL-1 variant 24,25,27L. B, Amino acid sequences of the VH regions of mCOL-1, human Ab MO30, HuCOL-1 derived from mCOL-1 and MO30, and the variant 61H. Dashes indicate residues that are identical in mCOL-1, MO30, HuCOL-1, and variant. Asterisks mark framework residues that are deemed essential for maintaining the combining site structure of mCOL-1. Murine framework residues retained in the HuCOL-1 are shown in bold.
Abs to the anti-V region Abs. To circumvent this problem, the circulating CEA and anti-murine Fc Abs were removed by sequential preadsorption of the sera with purified mCOL-6 and mCOL-4 mAbs, two Abs that react with epitopes of CEA different from the one recognized by mCOL-1 (28). The mAb mCOL-4 has the same isotype as that of mCOL-1. For preadsorption, serum samples were added to mCOL-6 coupled to Reacti-gel according to the method of Hearn et al. (39). The mixtures were incubated overnight at 4°C with end-to-end rotation and were centrifuged at 1000 ⫻ g for 5 min. Preadsorption was repeated until the supernatants displayed no detectable anti-murine Fc activity. The procedure was then repeated using mCOL-4 coupled to Reacti-gel. To detect anti-V region Abs by surface plasmon resonance (SPR), the preadsorbed serum was used as a mobile reactant. Proteins were immobilized on carboxymethylated dextran CM5 chips (BIAcore, Piscataway, NJ) by amine coupling using standard procedure (40, 41). HuCOL-1 was immobilized on the surface of flow cell 1, whereas the surface of flow cell 2 was coated with an unrelated protein, rabbit ␥ globulin (Bio-Rad, Hercules, CA).
Sera reactivity The reactivity of COL-1 variants to anti-V region Abs was determined using a recently developed SPR-based competition assay (58). Competition experiments were performed at 25°C using a CM5 sensor chip containing either mCOL-1 or HuCOL-1 in flow cell 1 and rabbit ␥ globulin (Bio-Rad), as a reference, in flow cell 2. Typically, mCOL-1, HuCOL-1, or its variants were used at different concentrations, to compete with the Ab immobilized on the sensor chip for binding to serum anti-V region Abs. Patient’s serum with or without the competitor (mCOL-1, HuCOL-1, or its variants) was applied across the sensor surface using a recently developed sample application technique (42) at the unidirectional flow of 1 l/min. After the binding was measured for 1000 s, the samples were washed from the surfaces with running buffer using a flow rate of 100 l/min, and the surfaces were regenerated with 10 mM glycine (pH 2.0) for the HuCOL-1 sensor chip or with HCl (pH 2.3) for the mCOL-1 sensor chip. The percent binding at each Ab concentration was calculated as follows: % binding ⫽ [slope of the signal obtained with competitor (serum ⫹ mCOL-1, HuCOL-1, or HuCOL-1 variants)/slope of the signal obtained without competitor (serum only)] ⫻ 100. IC50 for each Ab, the concentration required for 50% inhibition of the binding of the serum to either mCOL-1 or HuCOL-1, was calculated.
Results Isolation of COL-1 H and L chain genes The genes encoding the L chain and the Fd region of the H chain of mAb COL-1 were generated by repertoire cloning methodology (43), using synthetic oligonucleotides described in Materials and Methods. The PCR products of the appropriate size were cloned in
phage vector, and phagemids carrying the target genes were subsequently excised. The cloned genes were sequenced (data not shown) before the phagemids were used as templates for the subsequent PCR amplification. Generation of genes encoding humanized COL-1 VL and VH domains The mCOL-1 was humanized by grafting the CDRs of the L and H chains onto the VL and VH frameworks of the appropriate human Abs, but retaining those framework residues that were deemed essential for preserving the structural integrity of the combining site (44 – 46). The Ig CDRs have been defined as comprising residues 31–35b, 50 – 65, and 95–102 in the H chain and residues 24 –34, 50 –56, and 89 –97 in the L chain (47). The framework residues that were deemed critical were identified on the basis of the atomic coordinates of the Abs of known structures available in the database (for example, see Ref. 48). The human Ab sequences that are most similar to mCOL-1 are VJI⬘CL (49) (GenBank accession number Z00022) for VL and MO30 (50) (GenBank accession number A32483) for VH. The alignment of the VL sequences of mCOL-1 and VJI’CL, and the VH sequences of mCOL-1 and MO30 are shown in Fig. 2. Also indicated in Fig. 2 are the locations of the framework residues that are critical for Ag binding. The humanization protocols for the VL and VH genes, shown in Fig. 2, are based on putting the CDR sequences of mAb COL-1 together with the frameworks of the human VL and VH templates, while replacing some of the human framework residues with those murine framework residues that may be critical for Ag binding. A nucleotide sequence was then deduced from the amino acid sequence of each of the designed humanized VL and VH domains. The nucleotide sequences were refined to provide high frequency usage of codons and by eliminating, with the help of programs FOLD and MAPSORT (51), any self-annealing regions and any sites for restriction endonucleases that might complicate cloning of the designed genes in the desired vectors. Using the four overlapping oligonucleotides (shown by long arrows in Fig. 1) that encompassed, on alternating strands, the entire sequence of either the VL or VH region and its leader and the respective end primers
3080
MINIMALLY IMMUNOGENIC Ab BY ABBREVIATED CDR GRAFTING
described in Materials and Methods, DNA fragments encoding the humanized VL or VH regions were generated and amplified by overlap extension PCR technique (32). The humanized VL or VH regions thus generated were extended to the ApaI and SacII sites located 10 and 17 bp downstream from the 5⬘ end of the C regions of the H and L chains, respectively. The PCR products were cloned in pBSc to generate pBScHuCOL-1VL and pBScHuCOL-1VH constructs. The inserts were sequenced to check the fidelity of the PCR products. Generation of genes encoding variants of HuCOL-1 VL and VH domains Examination of the known structures of Ab-Ag complexes reveals that only one-third of the CDR residues are involved in the interaction with the Ag (48). This led to the proposal to redefine the boundaries of the CDRs to 31–35b, 50 –58, and 95–101 in the H chain and 27d–34, 50 –55, and 89 –96 in the L chain (14). Accordingly, we have developed variants of HuCOL-1 H and L chains in which these abbreviated CDRs have been grafted onto the VJI’CL and MO30 frameworks (Table I). Genes encoding the humanized VL and VH domains of the variants 24,25,27L and 61H were generated by primer-induced mutagenesis, using pBScHuCOL-1VL and pBScHuCOL-1VH constructs, respectively, as templates. Variant 61H was generated by replacing residue 61 of mCOL-1 H chain CDR2 (numbering convention of Kabat et al. (47)) with the corresponding residues of mAb MO30 H chain CDR2. For the generation of 24,25,27L variant, residues 24, 25, and 27 of mCOL-1 L chain CDR1 were replaced with the corresponding residues in L chain CDR1 of the human mAb VJI’CL (Table I). The V region sequences were synthesized by a dual-step PCR procedure according to Landt et al. (33). For each L and H chain V region, the mutagenic primer, containing the desired nucleotide changes in the targeted CDR, was used as a 3⬘ primer, whereas a 20-mer end primer served as a 5⬘ primer. The resulting PCR product was gel purified and used as a 5⬘ primer for the subsequent step of the PCR in which a 21-mer oligonucleotide was used as a 3⬘ primer. The PCR products were cloned in pBSC vector and sequenced. The amino acid sequences of the VL of the variant 24,25,27L and VH of the variant 61H are shown in Fig. 2, A and B, respectively.
SDS-PAGE of the secreted mAbs The apparently lower Ag-binding reactivities of the variant mAbs L and 24,25,27L/61H than those of cCOL-1, HuCOL-1, and the variant 61H could be attributed either to any possible detrimental effect of genetic manipulations of the combining site of the secreted Abs or to some structural abnormality of the expressed Ig molecules. The latter may be detected on SDS-PAGE by a change in size or mobility of the molecules. To this end, the purified Abs from the culture supernatants and the murine mAb COL-1 were analyzed by SDS-PAGE. The gel profile under nonreducing conditions (data not shown) showed that the mobility of all five recombinant Abs was identical with that of mCOL-1 mAb, which has a molecular mass of ⬃160 kDa. Under reducing conditions, all the recombinant COL-1 Abs, like that of mCOL-1, yielded two protein bands of ⬃25–28 and 50 –55 kDa (data not shown). These molecular masses are in conformity with those of the Ig L and H chains. The results of the SDS-PAGE analysis, together with the ELISA for CEA reactivity of the serially diluted Abs, suggest that the reduced Ag reactivity of the variants 24,25,27L and 24,25,27L/61H may be due to some detrimental effect of the amino acid substitutions in the combining site of HuCOL-1. 24,25,27
Relative CEA-binding affinities of mAbs derived from COL-1 A competition RIA was performed to determine the relative CEAbinding affinities of the COL-1-derived mAbs and the parental mCOL-1 mAb. Serial dilutions of unlabeled Abs (murine, chimeric, humanized COL-1 and its variants) were used to compete with the binding of 125I-labeled HuCOL-1 (Fig. 3) or 125I-labeled mCOL-1 (data not shown) to CEA. All of the COL-1-derived recombinant Abs, like the parental mCOL-1, were able to completely inhibit the binding of 125I-labeled mCOL-1 and 125I-labeled HuCOL-1 to CEA. The competition profiles of cCOL-1, HuCOL-1, and the variant 61H were comparable to that of the mCOL-1. In contrast, the competition profiles of mAbs 24,25,27L and 24,25,27L/61H, although of slopes similar to that of the parental mCOL-1 mAb, were shifted to the right. The values of the relative Ka of cCOL-1, HuCOL-1, and 61H mAbs, calculated from the linear parts of the competition curves in Fig. 3, were 3.45 ⫻ 108 M⫺1,
Immunoreactivity of the mAbs expressed in insect cells The genes encoding the VL and VH domains of mCOL-1, HuCOL-1, and the variants 61H and 24,25,27L were assembled with the respective human C region genes (␥1 for the H and for the L chain). The expression constructs were introduced into Sf9 insect cells, and the supernatants harvested from the transfectants were assayed for Ig production and Ag-binding reactivity by ELISA, as described in Materials and Methods. All the transfectants and the viral plaques, generated by infecting Sf9 cells with the infectious supernatants, were found to be positive for Ig production as assayed by ELISA. Results of an ELISA for Ag binding also showed that all culture supernatants and the viral plaques were reactive with CEA, albeit with varying degrees. To examine whether the different constructs were expressing comparable levels of Ig molecules, viral plaques were expanded and a large batch of Sf9 cells was freshly infected, at a multiplicity of infection of 5, with infectious supernatant derived from the highest producing clone of each construct, and the infected cells were cultured under identical conditions. The secreted Abs were purified from equal volumes of the culture supernatants. The concentration of the secreted Abs was comparable (2–3 g/ml) in culture supernatants of all five transfectants.
FIGURE 3. Competition RIA of mCOL-1-derived Abs. Increasing concentrations of mAbs mCOL-1 (⽧), cCOL-1 (■), HuCOL-1 (Œ), 24,25,27L (E), 61H (䡺), 24,25,27L/61H (●), and HuIgG (‚) were used to compete for the binding of 125I-labeled HuCOL-1 to 200 ng of CEA coated in each well. Dashed line indicates competitor HuCOL-1. The assay was done in triplicate and the error bars denote the SD from the mean value of the data in triplicate.
The Journal of Immunology 2.82 ⫻ 108 M⫺1, and 2.64 ⫻ 108 M⫺1, respectively. These relative affinities are ⬃1.5- to 2-fold less than that of mCOL-1 (Table I). The relative Ka values of 24,25,27L and 24,25,27L/61H were 1.2 ⫻ 108 M⫺1 and 1.03 ⫻ 108 M⫺1, respectively, ⬃4.3- to 5-fold lower than that of parental mCOL-1 (Table I). Flow cytometric analysis Flow cytometric analysis was used to measure the binding of HuCOL-1 and its variants (61H, 24, 25, 27L, and 24, 25, 27L/61H) to the CEA expressed on the cell surface of a tumor cell line, MC38, that was retrovirally transduced with CEA (38). No significant differences were found in the mean fluorescence intensity or in the percentage of cells that was reactive with HuCOL-1 and its variants (Fig. 4). The percentages of gated cells, calculated after exclusion of irrelevant binding, were indeed between 54 and 56, whereas the mean fluorescence intensities were between 15 and 16 when 1 g of each Ab was used. Reactivity of HuCOL-1 and HuCOL-1 variants to patients’ sera The immunogenicity of an Ab variant can be assessed only through its clinical trial. A reasonable measure of the potential immunogenicity of the variant Ab, however, is its in vitro reactivity to sera from patients who were administered the parental Ab in a clinical trial. To assess the potential immunogenicity of the mCOL-1, HuCOL-1, and its variants in patients, the Abs were characterized for their reactivity to sera from gastrointestinal carcinoma patients who were administered 131I-labeled mCOL-1 in a phase I clinical trial (24). As described in Materials and Methods, any circulating CEA and anti-murine Fc Abs were removed from the sera by immunoadsorption with mCOL-6 and mCOL-4, two murine anti-CEA Abs of IgG1 and IgG2a isotypes, respectively. It has been suggested on the basis of epitope mapping of CEA (28) that mCOL-4 and mCOL-6 may react with CEA epitopes that are different from each other and different from the one recognized by mAb COL-1. Preadsorbed sera were tested for the presence of anti-V region Abs to mAb COL-1. Specific binding profiles of HuCOL-1 to the sera from patients EM, JS, and MB (data not shown) show that all three sera have Abs against the variable re-
3081 gions of mCOL-1. Serum reactivity of HuCOL-1 and HuCOL-1 variants was determined by their ability to compete with mCOL-1 or HuCOL-1 immobilized on a sensor chip for binding to the antivariable region Abs to mCOL-1 present in the serum. IC50, the concentration of the competitor Ab required for 50% inhibition of the binding of mCOL-1 or HuCOL-1 to the patient’s serum, was calculated by plotting the percent inhibition as a function of competitor concentration. A higher IC50 value indicates a decreased reactivity to the serum, suggesting potentially reduced immunogenicity of the Abs in patients. Fig. 5 shows the competition profiles generated by HuCOL-1 and its variants when they were used to compete with the HuCOL-1 immobilized on the sensor chip for binding to the anti-V region Abs to COL-1 present in the sera of patients EM (A), JS (B), and MB (C). The competition profiles were used to calculate IC50 values that are presented in Table II. For serum MB, the IC50 values of all three variants are 2- to 3-fold higher than that of HuCOL-1. Studies with the serum from patient EM show that the variants 24,25,27L and 24,25,27L/61H have 50% higher IC50 values, whereas the variant 61H has a significantly lower IC50 value than that of HuCOL-1. For the serum from patient JS, the IC50 of the variant 24,25,27L/61H is twice as much as that of HuCOL-1, whereas the IC50 values of the variant 61H and 24,25,27 L are comparable to that of parental HuCOL-1. When mCOL-1 was immobilized on the sensor chip and mCOL-1, HuCOL-1, and the variant 24,25,27L/61H were used to compete with it for binding to the anti-V region Abs in the serum of patient MB, the competition profiles shown in Fig. 6 were generated. The data show that the concentration of HuCOL-1 required for 50% inhibition of the binding of the patient’s serum to mCOL-1 is ⬃3-fold higher than that of mCOL-1, whereas the concentration of the variant 24,25,27L/61H required to attain 50% inhibition of the binding of mCOL-1 to the patient’s serum is ⬃5.5- and 17-fold higher than those of HuCOL-1 and mCOL-1, respectively. Moreover, it should be pointed out that the slope of the competition profile of the variant 24,25,27L/61H is quite different from that of mCOL-1. Indeed, there was ⬎2 log differential in the concentrations of the 24,25,27 61 L/ H and mCOL-1 mAbs required for the 60% inhibition
FIGURE 4. Flow cytometric analysis of the binding of HuCOL-1 and its variants to cells expressing cell surface CEA. Binding profiles of 1 g of HuCOL-1 (A), 24,25,27L (B), 61H (C), and 24,25,27L/61H (D) mAbs, to MC38 cells engineered to express CEA on their cell surface. Binding of an irrelevant mAb, human IgG (dashed line), is shown in each panel and represents ⬍2% of the cell population.
3082
MINIMALLY IMMUNOGENIC Ab BY ABBREVIATED CDR GRAFTING Table II. Reactivity of the variant mAbs with patients’ seraa
Competitor Ab
EM (nM)
JS (nM)
MB (nM)
HuCOL-1 24,25,27 L 61 H 24,25,27 61 L/ H
6.6 10.7 4.9 9.1
2.0 2.5 2.8 4.1
5.5 15.2 10.5 14.4
a Competitor Ab concentrations required for IC50 of binding of serum from patients EM, JS, and MB to HuCOL-1 were calculated.
cols for therapeutic efficiency of the radiolabeled mCOL-1 has been demonstrated in an animal model (30). In addition to causing a possible allergic reaction, the HAMA response results in rapid clearance of the Ab from the circulation, preventing the Ab from reaching the targeted tumor sites. In a phase I clinical trial of 131 I-labeled mCOL-1, the onset of HAMA response prevented administration of a second dose of the radiolabeled Ab in two patients who were otherwise eligible for further treatment. HAMA response was also reported in a phase II clinical trial, when IFN was combined with 131I-labeled COL-1 and 131I-labeled CC49, a murine Ab against another pancarcinoma Ag, tumor-associated glycoprotein-72, to achieve more efficient targeting of human colorectal cancer (31). Development of a mouse-human chimeric mAb is an approach that has been widely used to minimize HAMA response (52). Accordingly, a cCOL-1 mAb was developed by replacing the C regions of the L and H chains of the mCOL-1 with the human and ␥1 constant regions. The Ag-binding affinity of the cCOL-1 (3.45 ⫻ 108 M⫺1) was found to be comparable to that of murine Ab (5.17 ⫻ 108 M⫺1). A chimeric Ab, though likely to be less immunogenic than the murine Ab, may evoke anti-V region response in patients, because the V region of a murine Ab is potentially immunogenic. Anti-V region responses have been reported after the administration of chimeric Abs in patients (53, 54; reviewed in Ref. 55). To attempt to reduce this problem, mAb COL-1 has been humanized following a procedure that involves grafting of the CDRs of a xenogeneic Ab onto the human Ig frameworks (reviewed in Ref. 8). The most important consideration in humanizing an Ab is the preservation of its Ag-binding property, which depends on the FIGURE 5. Serum reactivity, by SPR, of HuCOL-1 and its variants. Increasing concentrations of HuCOL-1 (Œ), 24,25,27L (E), 61H (䡺), and 24,25,27 61 L/ H (F) mAbs were used to compete with the anti-V region Abs to COL-1 present in sera from patients EM (A), JS (B), and MB (C) for binding to HuCOL-1 immobilized on a sensor chip. Percent binding of the sera to HuCOL-1 was calculated from the sensograms and plotted as a function of the concentration of the competitor.
of the binding of the sera anti-V region Abs to mCOL-1 immobilized on the sensor chip (Fig. 6). Sera from two other patients, JS and EM, were used to compare serum reactivity of mCOL-1 and HuCOL-1. Although the IC50 value of HuCOL-1 was ⬃6-fold higher than that of mCOL-1 for JS serum, it was not possible to evaluate the difference in the reactivity of the two Abs to EM serum; even 1000 nM HuCOL-1 was unable to attain 50% inhibition of the binding of the serum to mCOL-1 (data not shown).
Discussion The HAMA response is a major impediment to the clinical use of the murine mAbs, particularly for the dose fractionation clinical protocols that are likely to be used for greater therapeutic efficacy and reduced toxicity. The advantage of dose fractionation proto-
FIGURE 6. Serum reactivity, by SPR, of mCOL-1 and the engineered Abs derived from it. Increasing concentrations of mCOL-1 (f), HuCOL-1 (Œ), and 24,25,27L/61H (F) were used to compete with the anti-V region Abs to COL-1 present in serum from patient MB for binding to mCOL-1 immobilized on a sensor chip. Percent binding of the sera to mCOL-1 was calculated from the sensograms and plotted as a function of the concentration of the competitor.
The Journal of Immunology structural integrity of the combining site. This requires selecting the most appropriate human templates for humanization and grafting the CDRs of the target Ab onto the human scaffold, while retaining those murine framework residues that may be involved in ligand contact directly or through their interaction with the CDRs. In the absence of a three-dimensional structure of mCOL-1, the identification of the crucial frameworks residue was facilitated by a search of the database that yielded the V regions of two human Abs, VJI’CL and MO30, respectively, whose sequences were most similar to the mCOL-1 VL and VH sequences. There are 76 identities among the 112 overall residues of the VL of the VJI’CL and mCOL-1, and when comparing the 80 framework residues only, there are 65 identities. Among the 127 overall VH residues of the MO30 and COL-1 mAbs, there are 75 identities, while there are 57 identities in their 87 frameworks residues. Because the VL frameworks of VJI’CL and mCOL-1 are so extensively homologous, they differ only by five residues among those deemed crucial for Ag binding. The VH frameworks of COL-1, however, differ from MO30 at 17 positions that are most probably essential for the ligand binding. This approach of selecting the human frameworks to be used as templates had been successful for the humanization of several Abs, including mAb AUK12–2 (56), mAb 1B4 (57), and mAb CC49 (32). Based on these considerations, humanization of mCOL-1 was conducted using VJI’CL and MO30 as human templates, and the resulting HuCOL-1 showed only 2.5-fold lower affinity than that of the murine COL-1. Because the murine CDRs of a humanized Ab could still evoke an anti-V region response in patients, CDR grafting is not an ultimate solution of the potential immunogenicity of a xenogeneic Ab. Padlan et al. (14) suggested that not all of the CDR residues are involved in the ligand contact. Tamura et al. (13) humanized the anti-tumor-associated glycoprotein-72 mAb CC49 by grafting only its SDRs onto the human Ab frameworks. The HuCC49 variant, designated HuCC49V10, that was developed by this approach retained the Ag-binding properties of the parental mAb, while reacting with the patients’ sera only minimally. The immunogenicity of an Ab, therefore, could be reduced by transplanting only those parts of the CDRs that contain the SDRs. The “abbreviated” CDRs have been defined (14). Based on this rationale, a variant of each of the L and H chains of the HuCOL-1 was developed. In L chain variant, residues 24, 25, and 27 of the L chain CDR1 were replaced with the corresponding residues of the human Ab VJI’CL, whereas in H chain variant, residue 61 of the H-chain CDR2 was replaced with the residue of the human Ab MO30, located at the same position. The Ag-binding affinity of the H chain variant was comparable to that of the parental HuCOL-1, whereas that of the L chain variant was ⬃2.4-fold lower. The slight loss in the affinity of the L chain variant was reflected in the affinity of the HuCOL-1 variant (2.7-fold lower than that of the parental HuCOL-1) that was generated by combining the H and the L chain variants. Flow cytometric analysis of the CEA-transduced MC38 cells that were treated with the variant Abs, however, shows that the slight losses in the relative affinities of the variants had no effect on their binding ability to the CEA expressed on the cell surface. Humanization by transplanting the “abbreviated” CDRs was undertaken to eliminate any possible idiotopes, present in the CDRgrafted HuCOL-1, that could be the potential targets of patients’ immune response. However, it should be pointed out that engineering of this variant may have generated new idiotopes on the combining site of HuCOL-1 that may be targeted by the patient’s immune response. The immunogenicity of the COL-1-derived Abs can be evaluated only through their clinical trials in patients. Whether the HuCOL-1 variants, generated by grafting of the “abbreviated” CDRs, have reduced the potential to evoke anti-V
3083 region response in patients compared with the CDR-grafted HuCOL-1 was assessed by comparing their reactivity to sera from gastrointestinal cancer patients who were administered 131Ilabeled mCOL-1 in a phase I clinical trial (24). The sera were shown to carry anti-V region Abs to COL-1. In lieu of clinical trials, serum reactivity of the variant Ab is as good a measure of its potential immunogenicity as one can get, without administering the variant in a patient. The results confirm an earlier observation using another Ab (13), that the pattern of the anti-V region responses differs from patient to patient. Some patients may elicit more vigorous response to certain idiotopes than other patients; nevertheless, the variant 24,25,27L/61H, compared with HuCOL-1, shows 1.5-, 2-, and 3-fold lower reactivity to EM, JS, and MB sera, respectively. The reduction in serum reactivity of the variant is much more significant than these numbers suggest, because the reactivity of HuCOL-1 to serum MB is 3-fold lower than that of mCOL-1. The lower serum reactivity of the variant 24,25,27L/61H may be due to the elimination of the immunogenic idiotopes from the L chain variant 24,25,27L, which shows 2- to 3-fold lower reactivity to EM and MB sera than does HuCOL-1. These results suggest that the variant 24,25,27L/61H, compared with HuCOL-1, is significantly less reactive to sera from patients who were administered 131I-labeled mCOL-1 in a clinical trial and, hopefully, substantially less immunogenic in patients.
Acknowledgments We thank Debra Weingarten for her editorial assistance in the preparation of this manuscript.
References 1. Weiner, L. M. 1999. An overview of monoclonal antibody therapy of cancer. Semin. Oncol. 26:43. 2. Green, M. C., J. L. Murray, and G. N. Hortobagyi. 2000. Monoclonal antibody therapy for solid tumors. Cancer Treat. Rev. 26:269. 3. Carter, P. 2001. Improving the efficacy of antibody-based cancer therapies. Nature Rev. 1:118. 4. Seccamani, E., M. Tattanelli, M. Mariani, E. Spranzi, G. A. Scassellati, and A. G. Siccardi. 1989. A simple qualitative determination of human antibodies to murine immunoglobulins (HAMA) in serum samples. Int. J. Radiat. Appl. Instrum. B 16:167. 5. Reynolds, J. C., S. Del Vecchio, H. Sakahara, M. E. Lora, J. A. Carrasquillo, R. D. Neumann, and S. M. Larson. 1989. Anti-murine antibody response to mouse monoclonal antibodies: clinical findings and implications. Int. J. Radiat. Appl. Instrum. B 16:121. 6. Colcher, D., D. E. Milenic, P. Ferroni, J. A. Carrasquillo, J. C. Reynolds, M. Roselli, S. M. Larson, and J. Schlom. 1990. In vivo fate of monoclonal antibody B72.3 in patients with colorectal cancer. J. Nucl. Med. 31:1133. 7. Blanco, I., R. Kawatsu, K. Harrison, P. Leichner, S. Augustine, J. Baranowska-Kortylewicz, M. Tempero, and D. Colcher. 1997. Antiidiotypic response against murine monoclonal antibodies reactive with tumor-associated antigen TAG-72. J Clin. Immunol. 17:96. 8. Winter, G., and W. J. Harris. 1993. Humanized antibodies. Immunol. Today 14: 243. 9. Schneider, W. P., S. M. Glaser, J. A. Kondas, and J. Hakimi. 1993. The antiidiotypic response by cynomolgus monkeys to humanized anti-Tac is primarily directed to complementarity-determining regions H1, H2, and L3. J. Immunol. 150:3086. 10. Stephens, S., S. Emtage, O. Vetterlein, L. Chaplin, C. Bebbington, A. Nesbitt, M. Sopwith, D. Athwal, C. Novak, and M. Bodmer. 1995. Comprehensive pharmacokinetics of a humanized antibody and analysis of residual anti-idiotypic responses. Immunology 85:668. 11. Sharkey, R. M., M. Juweid, J. Shevitz, T. Behr, R. Dunn, L. C. Swayne, G. Y. Wong, R. D. Blumenthal, G. L. Griffiths, J. A. Siegel, et al. 1995. Evaluation of a complementarity-determining region-grafted (humanized) anticarcinoembryonic antigen monoclonal antibody in preclinical and clinical studies. Cancer Res. 55:5935s. 12. Iwahashi, M., D. E. Milenic, E. A. Padlan, R. Bei, J. Schlom, and S. V. S. Kashmiri. 1999. CDR substitutions of a humanized monoclonal antibody (CC49): contributions of individual CDRs to antigen binding and immunogenicity. Mol. Immunol. 36:1079. 13. Tamura, M., D. E. Milenic, M. Iwahashi, E. Padlan, J. Schlom, and S. V. S. Kashmiri. 2000. Structural correlates of an anticarcinoma antibody: identification of specificity-determining residues (SDRs) and development of a minimally immunogenic antibody variant by retention of SDRs only. J. Immunol. 164:1432. 14. Padlan, E. A., C. Abergel, and J. P. Tipper. 1995. Identification of specificitydetermining residues in antibodies. FASEB J. 9:133.
3084
MINIMALLY IMMUNOGENIC Ab BY ABBREVIATED CDR GRAFTING
15. Shively, J. E., and J. D. Beatty. 1985. CEA-related antigens: molecular biology and clinical significance. Crit. Rev. Oncol. Hematol. 2:355. 16. Primus, F. J., R. M. Sharkey, H. J. Hansen, and D. M. Goldenberg. 1978. Immunoperoxidase detection of carcinoembryonic antigen: an overview. Cancer 42:1540. 17. Muraro, R., D. Wunderlich, A. Thor, J. Lundy, P. Noguchi, R. Cunningham, and J. Schlom. 1985. Definition by monoclonal antibodies of a repertoire of epitopes on carcinoembryonic antigen differentially expressed in human colon carcinomas versus normal adult tissues. Cancer Res. 45:5769. 18. Wanebo, H. J., B. Rao, C. M. Pinsky, R. G. Hoffman, M. Stearns, M. K. Schwartz, and H. F. Oettgen. 1978. Preoperative carcinoembryonic antigen level as a prognostic indicator in colorectal cancer. N. Engl. J. Med. 299:448. 19. Goldenberg, D. M., R. M. Sharkey, and F. J. Primus. 1978. Immunocytochemical detection of carcinoembryonic antigen in conventional histopathology specimens. Cancer 42:1546. 20. Goldenberg, D. M., F. DeLand, E. Kim, S. Bennett, F. J. Primus, J. R. van Nagell, Jr., N. Estes, P. DeSimone, and P. Rayburn. 1978. Use of radiolabeled antibodies to carcinoembryonic antigen for the detection and localization of diverse cancers by external photoscanning. N. Engl. J. Med. 298:1384. 21. Di Carlo, V., P. De Nardi, M. Stella, P. Magnani, and F. Fazio. 1998. Preoperative and intraoperative radioimmunodetection of cancer pretargeted by biotinylated monoclonal antibodies. Semin. Surg. Oncol. 15:235. 22. Mayer, A., K. A. Chester, A. A. Flynn, and R. H. Begent. 1999. Taking engineered anti-CEA antibodies to the clinic. J. Immunol. Methods 231:261. 23. Chester, K. A., A. Mayer, J. Bhatia, L. Robson, D. I. Spencer, S. P. Cooke, A. A. Flynn, S. K. Sharma, G. Boxer, R. B. Pedley, and R. H. Begent. 2000. Recombinant anti-carcinoembryonic antigen antibodies for targeting cancer. Cancer Chemother. Pharmacol. 46:S8. 24. Yu, B., J. Carrasquillo, D. Milenic, Y. Chung, P. Perentesis, I. Feuerestein, D. Eggensperger, C. F. Qi, C. Paik, J. Reynolds, et al. 1996. Phase I trial of iodine 131-labeled COL-1 in patients with gastrointestinal malignancies: influence of serum carcinoembryonic antigen and tumor bulk on pharmacokinetics. J. Clin. Oncol. 14:1798. 25. Wong, J. Y. C., D. Z. Chu, D. M. Yamauchi, L. E. Williams, A. Liu, S. Wilczynski, A. M. Wu, J. E. Shively, J. H. Doroshow, and A. A. Raubitschek. 2000. A phase I radioimmunotherapy trial evaluating 90yttrium-labeled anticarcinoembryonic antigen (CEA) chimeric T84.66 in patients with metastatic CEA-producing malignancies. Clin. Cancer Res. 6:3855. 26. Juweid, M. E., G. Hajjar, L. C. Swayne, R. M. Sharkey, S. Suleiman, T. Herskovic, M. Pereira, A. D. Rubin, and D. M. Goldenberg. 1999. Phase I/II trial of 131I-MN-14F(ab⬘)2 anti-carcinoembryonic antigen monoclonal antibody in the treatment of patients with metastatic medullary thyroid carcinoma. Cancer 85:1828. 27. Buchegger, F., A. S. Allal, A. Roth, J. P. Papazyan, Y. Dupertuis, R. O. Mirimanoff, M. Gillet, A. Pelegrin, J. P. Mach, and D. O. Slosman. 2000. Combined radioimmunotherapy and radiotherapy of liver metastases from colorectal cancer: a feasibility study. Anticancer Res. 20:1889. 28. Kuroki, M., J. W. Greiner, J. F. Simpson, F. J. Primus, F. Guadagni, and J. Schlom. 1989. Serologic mapping and biochemical characterization of the carcinoembryonic antigen epitopes using fourteen distinct monoclonal antibodies. Int. J. Cancer 44:208. 29. Ohuchi, N., D. Wunderlich, J. Fujita, D. Colcher, R. Muraro, M. Nose, and J. Schlom. 1987. Differential expression of carcinoembryonic antigen in early gastric adenocarcinomas versus benign gastric lesions defined by monoclonal antibodies reactive with restricted antigen epitopes. Cancer Res. 47:3565. 30. Siler, K., D. Eggensperger, P. H. Hand, D. E. Milenic, L. S. Miller, D. P. Houchens, G. Hinkle, and J. Schlom. 1993. Therapeutic efficacy of a highaffinity anticarcinoembryonic antigen monoclonal antibody (COL-1). Biotechnol. Ther. 4:163. 31. Meredith, R. F., M. B. Khazaeli, W. E. Plott, W. E. Grizzle, T. Liu, J. Schlom, C. D. Russell, R. H. Wheeler, and A. F. LoBuglio. 1996. Phase II study of dual 131 I-labeled monoclonal antibody therapy with interferon in patients with metastatic colorectal cancer. Clin. Cancer Res. 2:1811. 32. Kashmiri, S. V. S., L. Shu, E. A. Padlan, D. E. Milenic, J. Schlom, and P. H. Hand. 1995. Generation, characterization, and in vivo studies of humanized anticarcinoma antibody CC49. Hybridoma 14:461. 33. Landt, O., H. P. Grunert, and U. Hahn. 1990. A general method for rapid sitedirected mutagenesis using the polymerase chain reaction. Gene 96:125. 34. Bei, R., J. Schlom, and S. V. S. Kashmiri. 1995. Baculovirus expression of a functional single-chain immunoglobulin and its IL-2 fusion protein. J. Immunol. Methods 186:245. 35. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein measurement with the folin phenol reagent. J. Biol. Chem. 193:265.
36. Frankel, M. E., and W. Gerhard. 1979. The rapid determination of binding constants for antiviral antibodies by a radioimmunoassay: an analysis of the interaction between hybridoma proteins and influenza virus. Mol. Immunol. 16:101. 37. Guadagni, F., P. L. Witt, P. F. Robbins, J. Schlom, and J. W. Greiner. 1990. Regulation of carcinoembryonic antigen expression in different human colorectal tumor cells by interferon-␥. Cancer Res. 50:6248. 38. Robbins, P. F., J. A. Kantor, M. Salgaller, P. H. Hand, P. D. Fernsten, and J. Schlom. 1991. Transduction and expression of the human carcinoembryonic antigen gene in a murine colon carcinoma cell line. Cancer Res. 51:3657. 39. Hearn, M. T., G. S. Bethell, J. S. Ayers, and W. S. Hancock. 1979. Application of 1,1⬘-carbonyldiimidazole-activated agarose for the purification of proteins. II. The use of an activated matrix devoid of additional charged groups for the purification of thyroid proteins. J. Chromatogr. 185:463. 40. Johnsson, B., S. Lofas, and G. Lindquist. 1991. Immobilization of proteins to a carboxymethyldextran-modified surface for biospecific interaction analysis in surface plasmon resonance sensors. Anal. Biochem. 198:268. 41. Schuck, P., L. F. Boyd, and P. S. Andersen. 1999. Measuring protein interactions by optical biosensors. In Current Protocols in Protein Science, Vol. 2. J. E. Coligan, B. M. Dunn, H. L. Ploegh, D. W. Speicher, and P. T. Wingfield, eds. John Wiley & Sons, New York, p. 20.2.1. 42. Abrantes, M., M. T. Magone, L. F. Boyd, and P. Schuck. 2001. Adaptation of a surface plasmon resonance biosensor with microfluidics for use with small sample volumes and long contact times. Anal. Chem. 73:2828. 43. Kang, A. S., D. R. Burton, and R. A. Lerner. 1991. Combinatorial immunoglobulin libraries in phage . Methods: A Companion to Methods in Enzymology 2:111. 44. Jones, P. T., P. H. Dear, J. Foote, M. S. Neuberger, and G. Winter. 1986. Replacing the complementarity-determining regions in a human antibody with those from a mouse. Nature 321:522. 45. Riechmann, L., M. Clark, H. Waldmann, and G. Winter. 1988. Reshaping human antibodies for therapy. Nature 332:323. 46. Verhoeyen, M., and L. Riechmann. Engineering of antibodies. 1988. Bioessays 8:74. 47. Kabat, E. A., T. Wu, H. M. Perry, K. S. Gottesman, and C. Foeller. 1991. Sequence of Proteins of Immunological Interests, 5th Ed. U.S. Department of Health and Human Services, National Institutes of Health, Bethesda, MD (NIH publication no. 91-3242). 48. Padlan, E. A. 1994. Anatomy of the antibody molecule. Mol. Immunol. 31:169. 49. Klobeck, H. G., G. W. Bornkamm, G. Combriato, R. Mocikat, H. D. Pohlenz, and H. G. Zachau. 1985. Subgroup IV of human immunoglobulin K light chains is encoded by a single germline gene. Nucleic Acids Res. 13:6515. 50. Larrick, J. W., L. Danielsson, C. A. Brenner, M. Abrahamson, K. E. Fry, and C. A. Borrebaeck. 1989. Rapid cloning of rearranged immunoglobulin genes from human hybridoma cells using mixed primers and the polymerase chain reaction. Biochem. Biophys. Res. Commun. 160:1250. 51. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387. 52. Morrison, S. L., and J. Schlom. 1990. Recombinant chimeric monoclonal antibodies. In Important Advances in Oncology. S. A. Rosenberg, ed. Lippincott, Philadelphia, p. 3. 53. Saleh, M. N., A. F. LoBuglio, R. H. Wheeler, K. J. Rogers, A. Haynes, J. Y. Lee, and M. B. Khazaeli. 1990. A phase II trial of murine monoclonal antibody 17-1A and interferon-␥: clinical and immunological data. Cancer Immunol. Immunother. 32:185. 54. Khazaeli, M. B., M. N. Saleh, T. P. Liu, R. F. Meredith, R. H. Wheeler, T. S. Baker, D. King, D. Secher, L. Allen, K. Rogers, et al. 1991. Pharmacokinetics and immune response of 131I-chimeric mouse/human B72.3 (human ␥4) monoclonal antibody in humans. Cancer Res. 51:5461. 55. Vaughan, T. J., J. K. Osbourn, and P. R. Tempest. 1998. Human antibodies by design. Nat. Biotechnol. 16:535. 56. Sato, K., M. Tsuchiya, J. Saldanha, Y. Koishihara, Y. Ohsugi, T. Kishimoto, and M. M. Bendig. 1994. Humanization of a mouse anti-human interleukin-6 receptor antibody comparing two methods for selecting human framework regions. Mol. Immunol. 31:371. 57. Singer, I. I., D. W. Kawka, J. A. DeMartino, B. L. Daugherty, K. O. Elliston, K. Alves, B. L. Bush, P. M. Cameron, G. C. Cuca, P. Davies, et al. 1993. Optimal humanization of 1B4, an anti-CD18 murine monoclonal antibody, is achieved by correct choice of human V-region framework sequences. J. Immunol. 150:2844. 58. Gonzales, N. R., P. Schuck, J. Schlom, and S. V. S. Kashmiri. Surface plasmon resonance-based competition assay to assess the sera reactivity of variants of humanized antibodies. J. Immunol. Methods. In press.
