Antisense RNA has been used extensively for the down-regulation of specific gene ...... Pantothenic acid. Sigma Aldrich. St Louis, MO, USA. Pfu Turbo. Stratagene ...... 570 bp HindIII/EcoRI ura4 3' fragment from pGT5 (Arndt et al., 2000). Ten to ...
ANTISENSE RNA-MEDIATED GENE SILENCING IN FISSION YEAST
Mitch Raponi
A thesis submitted for the degree of Doctor of Philosophy
School of Biochemistry and Molecular Genetics University of New South Wales 2000
Certificate of Originality
I hereby declare that this submission is my own work and to the best of my knowledge it contains no material published or written by another person, nor material which to a substantial extent has been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the text. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is fully acknowledged in the thesis.
I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that the assistance from others in the project’s design and conception or in style, presentation and linguistic expression is acknowledged.
Mical Raponi
Contents
Contents
CONTENTS ........................................................................................................................... I LIST OF FIGURES .............................................................................................................. VII LIST OF TABLES .................................................................................................................IX LIST OF ABBREVIATIONS ....................................................................................................X ABSTRACT .........................................................................................................................XI LIST OF PUBLICATIONS .................................................................................................... XII LIST OF ABSTRACTS ......................................................................................................... XII PATENT ............................................................................................................................ XII ACKNOWLEDGEMENTS ...................................................................................................XIII CHAPTER 1..........................................................................................................................1 INTRODUCTION ................................................................................................................1 1.1
ANTISENSE TECHNOLOGY - AN OVERVIEW ............................................................1
1.2
THE APPLICATION OF ANTISENSE RNA..................................................................4
1.2.1
Antisense RNA in gene therapy......................................................................4
1.2.2
Antisense RNA in agriculture ........................................................................6
1.2.3
Antisense RNA in floricultutre .......................................................................7
1.2.4
Antisense RNA in functional genomics ..........................................................8
1.3
ENDOGENOUS ANTISENSE RNA .............................................................................9
1.3.1
Endogenous antisense in prokaryotes and viruses ........................................9
1.3.2
Endogenous antisense in eukaryotes ...........................................................10
1.3.3
Endogenous double-stranded RNA..............................................................13
1.4
MECHANISMS OF ANTISENSE ACTION ...................................................................15
1.4.1
Interference with transcription ....................................................................16
1.4.2
Interference with pre-mRNA processing......................................................16
1.4.3
Interference with mRNA transport...............................................................16
1.4.4
Interference with translation .......................................................................17
I
Contents
1.4.5 1.5
Interference with multiple steps in gene expression ....................................18 POST-TRANSCRIPTIONAL GENE SILENCING ..........................................................19
1.5.1
dsRNA-mediated gene interference .............................................................19
1.5.2
Mechanisms of PTGS...................................................................................21
1.5.3
Interference with PTGS ...............................................................................26
1.6
FACTORS THAT AFFECT ANTISENSE RNA EFFICACY............................................27
1.6.1
Local accessibility........................................................................................27
1.6.2
RNA binding proteins...................................................................................29
1.6.3
Antisense RNA stability................................................................................31
1.6.4
Cellular metabolism.....................................................................................31
1.6.5
Antisense dose and position effects..............................................................32
1.6.6
Co-localisation of complementary RNAs.....................................................34
1.7
AIMS OF THIS WORK .............................................................................................39
CHAPTER 2........................................................................................................................41 MATERIALS AND METHODS .......................................................................................41 2.1
MATERIALS...........................................................................................................41
2.2
FISSION YEAST STRAINS AND CULTURE ...............................................................44
2.2.1
Fission Yeast Strains....................................................................................44
2.2.2
Media ...........................................................................................................44
2.2.3
Genetic crosses ............................................................................................46
2.2.4
Diploid construction ....................................................................................46
2.2.5
Fluorescent microscopy...............................................................................47
2.2.6
Yeast transformation....................................................................................48
2.2.7
Selection of stable integrants.......................................................................48
2.2.8
β-galactosidase assays.................................................................................49
2.3
BACTERIAL STRAINS AND CULTURE .....................................................................49
2.3.1
Bacterial strains...........................................................................................49
2.3.2
Bacterial and yeast plasmids .......................................................................50
2.3.3
Bacterial transformation..............................................................................52
2.4
YEAST NUCLEIC ACID ISOLATION ........................................................................52 II
Contents
2.4.1
Yeast total DNA large preparation..............................................................52
2.4.2
Yeast total DNA mini preparation ...............................................................53
2.4.3
Yeast total RNA preparation........................................................................54
2.5
BACTERIAL NUCLEIC ACID ISOLATION .................................................................54
2.5.1
Bacterial DNA large preparation ................................................................54
2.5.2
Bacterial DNA mini preparation .................................................................55
2.5.3
Bacterial DNA quick preparation................................................................55
2.6
RECOMBINANT DNA CONSTRUCTION ..................................................................56
2.6.1
Restriction enzyme digests ...........................................................................56
2.6.2
Agarose gel electrophoresis.........................................................................57
2.6.3
DNA recovery from agarose gels.................................................................58
2.6.4
DNA cloning ................................................................................................58
2.6.5
DNA sequencing ..........................................................................................59
2.7
POLYMERASE CHAIN REACTION (PCR) ................................................................60
2.7.1
Primers.........................................................................................................60
2.7.2
PCR cycling conditions................................................................................61
2.7.3
PCR product purification.............................................................................62
2.8
RADIOLABELLING DNA........................................................................................62
2.8.1
End-labelling ...............................................................................................62
2.8.2
Random-Primed labelling............................................................................63
2.9
DNA AND RNA ANALYSIS ..................................................................................64
2.9.1
DNA transfer to nylon membrane................................................................64
2.9.2
Hybridisation of radiolabelled probe ..........................................................64
2.9.3
Denaturing gel electrophoresis ...................................................................65
2.9.4
RNA transfer to nylon membrane ................................................................66
2.9.5
Phosphorimage analysis ..............................................................................66
CHAPTER 3........................................................................................................................67 THE INFLUENCE OF ANTISENSE GENE LOCATION ON TARGET GENE SUPPRESSION...................................................................................................................67 3.1
INTRODUCTION .....................................................................................................67 III
Contents
3.2
METHODS .............................................................................................................69
3.2.1
Construction of random integrants..............................................................69
3.2.2
Long inverse PCR (LI-PCR) ........................................................................73
3.3
RESULTS ...............................................................................................................75
3.3.1
Construction of random integrants – strategy I...........................................75
3.3.2
Genetic crossing does not affect β-galactosidase activity...........................77
3.3.3
Construction of random integrants – strategy II .........................................78
3.3.4
Characterisation of flanking sequences using LI-PCR................................79
3.3.5
Co-localisation of the target and antisense lacZ genes does not affect lacZ
suppression ...................................................................................................................81 3.3.6 3.4
lacZ suppression correlates with antisense dose........................................83 DISCUSSION ..........................................................................................................86
3.4.1
Summary ......................................................................................................86
3.4.2
Generation of random integrants ................................................................86
3.4.3
LI-PCR and characterisation of transgene location....................................87
3.4.4
Position effect and antisense RNA dose.......................................................88
3.4.5
Location effect and co-localisation of complementary genes......................89
CHAPTER 4........................................................................................................................91 THE EFFECT OF ANTISENSE AND TARGET GENE CO-LOCALISATION........91 4.1
INTRODUCTION .....................................................................................................91
4.2
METHODS .............................................................................................................95
4.2.1
Construction of diploid strains ....................................................................95
4.2.2
Construction of the close proximity strain...................................................97
4.3
RESULTS .............................................................................................................101
4.3.1
Expression of complementary genes from opposite alleles .......................101
4.3.2
Expression of complementary genes from the same locus.........................103
4.3.3
Convergent transcription at the target gene locus ....................................104
4.4
DISCUSSION ........................................................................................................109
4.4.1
Summary ....................................................................................................109
4.4.2
Expression of complementary genes at opposite alleles............................109 IV
Contents
4.4.3
Expression of complementary genes at the same locus .............................111
4.4.4
Convergent transcription of complementary genes ...................................112
CHAPTER 5......................................................................................................................114 THE EFFECT OF DOUBLE-STRANDED RNA IN FISSION YEAST .....................114 5.1
INTRODUCTION ...................................................................................................114
5.2
METHODS ...........................................................................................................117
5.2.1
Construction of sense lacZ-expressing strains ..........................................117
5.2.2
Construction of lacZ panhandle-expressing strains ..................................117
5.2.3
Construction of c-myc-expressing strains..................................................118
5.2.4
Construction of the ded1 plasmid ..............................................................118
5.3
RESULTS .............................................................................................................119
5.3.1
Expression of additional sense RNA enhances antisense RNA-mediated
target gene suppression ..............................................................................................119 5.3.2
A lacZ panhandle RNA inhibits lacZ gene expression...............................122
5.3.3
In vivo analysis of dsRNA formation.........................................................124
5.3.4
Co-expression of antisense and sense RNA enhances inhibition of a c-myc
target
....................................................................................................................126
5.3.5
Co-expression of the ded1 helicase with antisense genes..........................128
5.4
DISCUSSION ........................................................................................................131
5.4.1
Summary ....................................................................................................131
5.4.2
Co-expression of antisense and sense RNA ...............................................132
5.4.3
Expression of panhandle lacZ RNA ...........................................................134
5.4.4
Expression of an ATP-dependent RNA helicase ........................................135
5.4.5
PTGS in fission yeast .................................................................................137
CHAPTER 6......................................................................................................................139 IDENTIFICATION OF HOST CELL FACTORS THAT ENHANCE ANTISENSE RNA EFFICACY ..............................................................................................................139 6.1
INTRODUCTION ...................................................................................................139
6.2
METHODS ...........................................................................................................141 V
Contents
6.2.1
Construction of thi1 plasmid......................................................................141
6.2.2
Screening strategy for novel antisense enhancing sequences ...................141
6.3
RESULTS .............................................................................................................144
6.3.1
Over-expression of a transcriptional activator enhances antisense RNA
efficacy
....................................................................................................................144
6.3.2
Library screen for antisense enhancing plasmids .....................................146
6.3.3
Characterisation of antisense enhancing sequences .................................148
6.3.4
Aes2 factor enhances dsRNA-mediated gene silencing .............................152
6.4
DISCUSSION ........................................................................................................153
6.4.1
Summary ....................................................................................................153
6.4.2
The over-expression strategy .....................................................................154
6.4.3
aes homologies and possible roles in PTGS..............................................155
CHAPTER 7......................................................................................................................160 CONCLUSIONS ...............................................................................................................160 7.1
SYNTHESIS ..........................................................................................................160
7.2
A WORKING MODEL FOR PTGS IN FISSION YEAST...............................................162
7.3
FUTURE PROSPECTS ............................................................................................165
7.3.1
Position effect and transgene dose – an application .................................165
7.3.2
Convergent transcription as a form of gene regulation ............................166
7.3.3
PTGS and antisense enhancing sequences ................................................167
CHAPTER 8......................................................................................................................169 REFERENCES..................................................................................................................169
VI
Figures
List of Figures
Figure
Title
Page
1.1
The central dogma of biology.
1
1.2
Possible causes of dsRNA production.
22
1.3
Models for post-transcriptional gene silencing.
24
1.4
Organisation of the eukaryotic nucleus during interphase.
35
2.1
The fission yeast life cycle.
47
3.1
Strategy for constructing antisense lacZ random integrant strains.
70
3.2
The target lacZ gene and antisense lacZ integrating vector.
71
3.3
Insert analysis of pH94 library.
72
3.4
The LI-PCR strategy.
74
3.5
Integration and expression analysis of the antisense lacZ gene.
76
3.6
Analysis of β−galactosidase activity in mated strains.
77
3.7
PCR analysis of lacZ recombination in G17-16 transformants.
78
3.8
LI-PCR of random integrants.
80
3.9
Distribution of antisense integration sites in fission yeast strains.
81
3.10
Analysis of β−galactosidase activity in random integrant strains.
82
3.11
Antisense RNA-mediated gene silencing is dose-dependent.
84
3.12
Dose effect of antisense lacZ RNA.
85
4.1
Design of diploid strains used in this study.
95
4.2
Generation of the ura4 integration vector pL82-9.
98
4.3
Construction of the close proximity strain, L97-1.
100
4.4
Expression of complementary RNAs at opposite alleles.
102
4.5
Analysis of lacZ expression in L97-1.
104
4.6
Southern analysis of convergent cassette.
105
4.7
Analysis of the convergent transcription strain G34-10.
107
5.1
Effect of increasing target RNA in antisense-expressing strains.
121
5.2
lacZ panhandle-mediated gene silencing.
123
5.3
In vivo dsRNA assay.
125
5.4
dsRNA-mediated suppression of a c-m yc target.
127
5.5
Co-expression of antisense lacZ genes and ded1.
129
6.1
Over-expression screening strategy for PTGS modulating factors.
142
VII
Figures
6.2
Over-expression of the transcriptional activator thi1.
145
6.3
Over-expression screen of a S.pom be cDNA library.
147
6.4
Schematic alignment of aes factors with known nucleotide and protein sequences.
149
6.5
Sequence alignment of the aes1 protein with related proteins.
150
6.6
Expression of aes factors.
151
6.7
Co-expression of lacZ panhandle construct and aes2 factor.
152
7.1
A working model for PTGS in fission yeast.
164
VIII
Tables
List of Tables
Table
Title
Page
1.1
Antisense RNA-based gene therapy clinical trials.
5
1.2
Examples of pre-clinical antisense RNA-based therapeutic strategies.
6
1.3
Examples of eukaryotic genes with endogenous antisense RNAs.
11
1.4
Organisms exhibiting dsRNA-mediated gene silencing.
20
1.5
Examples of antisense experiments where there is no correlation between
37
antisense dose and target gene suppression. 1.6
Systems where complementary genes were spatially coupled.
38
2.1
Source of Materials.
41
2.2
Fission yeast strains used for this study.
44
2.3
EMM.
45
2.4
50X Salts.
45
2.5
1000X Vitamins.
45
2.6
10,000X Minerals.
46
2.7
Bacterial strains used in this study.
50
2.8
Bacterial and yeast plasmids used in this study.
50
2.9
Restriction enzymes used in this study.
56
2.10
Linkers used in this study.
59
2.11
Sequencing primers used in this study.
60
2.10
PCR primers used in this study.
60
2.11
PCR cycling parameters used in this study.
62
3.1
Mapping of integrated antisense lacZ plasmids in S.pom be.
80
4.1
Dipolid strains constructed for this study.
97
IX
Abbreviations
List of Abbreviations
This is a list of abbreviations which are commonly used in this thesis.
ADAR
adenosine deaminases that act on RNA
aa
amino acids
bp
base pairs
cDNA
complementary deoxyribose nucleic acid
cRNA
complementary ribose nucleic acid
dsRNA
double-stranded ribose nucleic acid
FOA
5-fluoro-orotic acid
LI-PCR
long-inverse polymerase chain reaction
MOPS
3-(N-morpholino)-propanesulphonic acid
mRNA
messenger RNA
nt
nucleotides
ONPG
O -nitrophenyl-β-D-galactopyranoside
ORF
open reading frame
PE
position effect
PEV
position effect variegation
PTGS
post-transcriptional gene silencing
X-gal
5-bromo-4-chloro-3-indoyl-β-D-galactoside
X
Abstract
Abstract The major aims of this thesis were to investigate the influence of i) antisense gene location relative to the target gene locus (“location effect”), ii) double-stranded RNA (dsRNA) formation, and iii) over-expression of host-encoded proteins on antisense RNA-mediated gene regulation. To test the location effect hypothesis, strains were generated which contained the target lacZ gene at a fixed location and the antisense lacZ gene at various genomic locations including all arms of the three fission yeast chomosomes and in close proximity to the target gene locus. A long inverse-PCR protocol was developed to rapidly identify the precise site of antisense gene integration in the fission yeast transformants. No significant difference in lacZ suppression was observed when the antisense gene was integrated in close proximity to the target gene locus, compared with other genomic locations, indicating that target and antisense gene co-localisation is not a critical factor for efficient antisense RNA-mediated gene suppression in vivo. Instead, increased lacZ down-regulation correlated with an increase in the steady-state level of antisense RNA, which was dependent on genomic position effects and transgene copy number. In contrast, convergent transcription of an overlapping antisense lacZ gene was found to be very effective at inhibiting lacZ gene expression. DsRNA was also found to be a central component of antisense RNA-mediated gene silencing in fission yeast. It was shown that gene suppression could be enhanced by increasing the intracellular concentration of non-coding lacZ RNA, while expression of a lacZ panhandle RNA also inhibited β-galactosidase activity. In addition, over-expression of the ATP-dependent RNA-helicase, ded1, was found to specifically enhance antisense RNA-mediated gene silencing. Through a unique overexpression screen, four novel factors were identified which specifically enhanced antisense RNA-mediated gene silencing by up to an additional 50%. The products of these antisense enhancing sequences (aes factors), all have natural associations with nucleic acids which is consistent with other proteins which have previously been identified to be involved in posttranscriptional gene silencing.
XI
Publications
List of Publications Raponi, M., Dawes, I.W. & Arndt, G.M. (2000) Characterization of flanking DNA using long inverse PCR. BioTechniques. 28:838-844. Raponi, M., Atkins, D., Dawes, I.W. & Arndt, G.M. (2000) The influence of antisense gene location on target gene suppression in the fission yeast Schizosaccharomyces pombe. Antisense Nucleic Acid Drug Devel. 10:29-34. Raponi, M. & Arndt, G.M. Identification of factors affecting post-transcriptional gene silencing in fission yeast. In preparation.
Raponi, M. & Arndt, G.M. Over-expression of an ATP-dependent RNA helicase enhances post-transcriptional gene silencing in fission yeast. In preparation.
List of Abstracts Raponi, M. & Arndt, G.M. (June, 2000) dsRNA-mediated gene interference in fission yeast. RNA Meeting. Madison, Wisconsin, USA. Oral presentation. Raponi, M., Atkins, D., Dawes, I.W. & Arndt, G.M. (March, 1999) A genetic based approach for identifying factors affecting antisense efficacy. Human Genome Meeting. Brisbane, Australia. Poster presentation. Raponi, M., Atkins, D., Dawes, I.W. & Arndt, G.M. (November, 1999) Co-localization of antisense and target genes does not enhance antisense efficacy. Australian Society of Medical Research Conference. Leura, Australia. Poster presentation.
Patent Methods for mediating gene suppression. Australian Patent Application No. PQ7830 XII
Acknowledgements
Acknowledgements
First and foremost I thank Greg Arndt for his supervision and friendship.
I thank my co-supervisors David Atkins, who encouraged me to pursue this work, and Ian Dawes for his timely advice and guidance.
I am indebted to past and present staff members of Johnson and Johnson Research with whom I have interacted with including members of the High Thoughput Genetics group (pictured), and especially Margaret Patrikakis.
I also thank JJR for funding my work and Wayne Gerlach and Denis Wade for their confidence in me.
Finally, I thank my family and friends for their support throughout the course of my postgraduate degree.
Back Row: G. Arndt, N. Tran, R. Pack Front Row: G. Odero, M. Raponi, C. Scott, H.P. Zhang, A. Arndt, M. Patrikakis
XIII
This w ork is dedicated to m y fam ily
XIV
Chapter 1
Introduction
CHAPTER 1 INTRODUCTION
1.1
Antisense Technology - An Overview
Antisense RNA has been used extensively for the down-regulation of specific gene expression in a variety of organisms (Murray and Crockett, 1992). This technique involves the expression of complementary RNA sequences which are intended to hybridise with a specific target mRNA and interfere with one or more steps of the gene expression pathway (Fig. 1.1) (Van der Krol et al., 1988). Although results obtained with this technology have been variable and our understanding of the mechanisms of this form of gene-silencing is not yet complete, its value has been demonstrated in a number of areas including agriculture, medicine, and genomics. Its discovery in a variety of organisms has also suggested it has a natural role in gene regulation.
Fig. 1.1 The central dogma of biology. Messenger RNA (mRNA) is transcribed from DNA, is processed in the nucleus, and transported to the cytoplasm where it is translated into protein. Antisense RNA may inhibit protein synthesis by acting at any step of this gene expression pathway. 1
Chapter 1
Introduction
The concept that an antisense nucleic acid sequence could be used to inhibit translation of a messenger RNA (mRNA) was hinted at in the early 1960s when it was shown that mRNA transcripts need to be single stranded for protein synthesis to occur (Singer et al., 1963). Specifically, polyphenylalanine synthesis was blocked when polyadenylic acid was added to a polyuridylic acid template. A few years later naturally-occurring antisense RNA was shown to exist in a biological organism (Bovre and Szybalski, 1969) but its significance as a regulatory element was not realised until complementary DNA sequences were used to inhibit protein synthesis in a cell-free assay (Paterson et al., 1977; Hastie and Held, 1978). Work by Zamecnik and Stephenson in the late 1970s took these observations one step further by showing that synthetic antisense oligonucleotides could specifically inhibit viral replication in cell culture (Zamecnik and Stephenson, 1978). The design and use of antisense oligodeoxyribonucleotides (ODNs) has evolved over the past twenty years with many problems such as delivery, dosage and non-specific effects being addressed. Despite these complex issues, the first antisense ODN was recently approved by the Food and Drug Administration (FDA) for use against retinitis in AIDS patients (Fomivirisen: ISIS, Carlsbad, CA). The recent development of antisense ODNs that contain a catalytic core (DNA enzymes or DNAzymes) has enabled these molecules to down-regulate specific genes at a much lower dosage due to their catalytic ability (Sun et al., 1999). These gene inactivation techniques have great potential, however, they are mechanistically different to antisense RNAs and as such will not be elaborated upon in this review. For comprehensive discussions on antisense ODNs and DNAzymes the reader is directed to other detailed critiques (Stull and Szoka, 1995; Agrawal, 1996; Breaker, 1997; Bennett, 1998). Antisense RNA was originally found to occur naturally in prokaryotic organisms (Itoh and Tomizawa, 1980; Tomizawa et al., 1981), where it has been shown to be involved in a number of biological processes (Wagner and Simons, 1994). Since antisense ODNs had already been shown to effectively inhibit target genes it was reasoned that artificial antisense genes could also inhibit gene expression if introduced into a target cell (Pestka et al., 1984). This hypothesis proved to be successful and was immediately extended to eukaryotic models where the utility of antisense genes was demonstrated in mammalian cells (Izant and Weintraub, 1984). Indeed, it is now clear that eukaryotic organisms also 2
Chapter 1
Introduction
contain endogenous antisense encoding sequences which, in some cases, have been suggested to have a role in specific gene regulation (Lipman, 1997; Knee and Murphy, 1997). Additionally, the presence of molecules and mechanisms which specifically respond to dsRNA in eukaryotes further indicates a natural role for antisense RNA-mediated gene regulation (Knee and Murphy, 1997; Bosher and LaBouesse, 2000). Like antisense DNA, the efficacy of antisense RNA has been enhanced by the addition of a catalytic core. However, unlike DNAzymes which were synthetically evolved in vitro (Santoro and Joyce, 1997), catalytic RNAs (or ribozymes) were originally discovered as naturally-occuring, self-cleaving RNAs in vivo (Cech, 1987). Four RNA catalytic motifs now exist in total (Rossi, 1992). The first is the Tetrahymena thermophila self-splicing sequence characterised by Cech and co-workers (Cech, 1987). The RNAse P ribozyme was determined to be the catalytic part of an enzyme which is involved in maturation of the 5’ end of tRNA in bacteria (Guerrier-Takada et al., 1983) while the “hairpin” (Hampel and Tritz, 1989) and “hammerhead” (Forster and Symons, 1987) ribozyme motifs were isolated from plant viroids. Haselhoff and Gerlach (1988) generated a set of design rules for a universal ribozyme which could specifically cleave any target sequence in trans. Since then ribozymes have been employed for a variety of applications in mammalian cells (Bramlage et al., 1998). Because of their cleaving properties and enzymatic requirements ribozymes have additional factors which affect their in vivo efficacy compared with antisense RNAs alone. However, due to the nature of this thesis they will be discussed in the context of an antisense RNA-based technology. For detailed commentaries on ribozymes the reader is referred to more in depth reviews (Rossi, 1992; Symons, 1994; James and Al-Shamkhani, 1995; Stull and Szoka, 1995).
3
Chapter 1
1.2
Introduction
The Application of Antisense RNA
While the utility of antisense RNA technology was demonstrated almost twenty years ago its commercial application is only now being realised. Its ability to inhibit the production of specific proteins has allowed for the potential of an unprecedented delivery of previously unobtainable goals in the areas of gene therapy, agriculture, functional genomics, and drug target validation.
1.2.1
A ntisense R N A in gene therapy
As of the end of April 2000 the Recombinant Advisory Committee had approved 19 antisense gene-based clinical trials for the treatment of HIV-1 and a variety of cancers, while another three are currently under review (Table 1.1). These strategies involve either delivery of the therapeutic construct to the target cells ex vivo by a viral or non-viral method, and then introduction of the modified cells into the patient; or non-viral-mediated in vivo delivery of the therapeutic (Raponi and Symonds, 1999). Although much research has been invested into the development of genetic-based therapeutics, few clinical successes have yet been realised (Cavazzana-Calvo et al., 2000). This is primarily due to the aim of demonstrating safety rather than efficacy in these early phase-I trials. Importantly, technical limitations such as inefficient cell transduction and immune responses to foreign DNA and viral vectors (Lehman, 1999) are being overcome with the development of more effective second generation vectors (Crystal, 1995; Romano et al., 2000). In addition to the antisense RNA-based therapies being tested in the clinic, many more strategies targeting a variety of diseases are also in pre-clinical phase (Mercols and Cohen, 1995; Weiss et al., 1999). A selection of these are shown in Table 1.2.
4
Chapter 1
Introduction
Table 1.1 Antisense RNA-based gene therapy clinical trials. Protocol a
Investigators
Therapeutic
Center/Sponsor
9604-153
Kohn
Anti-HIV ribozyme
Childrens Hospital LA
9710-218
Krishnan & Zaia
Anti-HIV ribozyme
RPI
9309-57
Wong-Staal
Anti-HIV ribozyme
Immusol
9508-117
Rosenblatt
Anti-HIV ribozyme
Johnson & Johnson
Symonds
Anti-HIV ribozyme
Johnson & Johnson
9705-188
Verfaillia
Antisense bcr/abl
University of Minnesota
9409-84
Holt
Antisense c-fos, c-myc
Vanderbilt University
9509-123
Steiner & Holt
Antisense c-myc
University of Tennessee
9902-285
Grandis
Antisense EGFR
University of Pittsburgh
9306-52
Ilan
Antisense IGF1
Case Western Reserve
9812-277
Amado
Antisense Pol1
Systemix
9806-261
Amado
Antisense Pol1
Systemix
9908-333
Swindells etal.
Antisense Pol1
Systemix
9909-340
Carabasi
Antisense Pol1
University of Alabama
9602-147
Kohn
Antisense RRE
UCLA
9503-103
Morgan
Antisense TAR
NIH
9306-49
Nabel
Antisense TAR
University of Michigan
9712-225
Isola
Antisense TAR
Mount Sinai Medical
Cowan & Conant
Antisense TAR
Enzo
Tisdale
Antisense Tat
NIH
9907-331 c
Gutheil & Fakhai
Antisense TGF-β
NovaRx
9512-138
Black & Fakhai
Antisense TGF-β2
UCLA
0004-393 c
Sobol & Bodkin
Antisense TGF-β2
NovaRx
b
9801-230 9909-341
a b
c
Protocols from www.nih.gov/od/oba c Protocols under review. Australian-based trial approved by Therapeutics Goods Administration.
5
Chapter 1
Introduction
Table 1.2 Examples of pre-clinical antisense RNA-based therapeutic strategies. Target
Disease
References
BCR-ABL
Cancer
(Martiat et al., 1993)
Calmodulin
Cancer
(Davidkova et al., 1996)
Cyclin G1 (CYCG1)
Cancer
(Skotzko et al., 1995)
E1AF
Cancer
(Hida et al., 1998)
Gastrin
Cancer
(Singh et al., 1998) (Li and Wang, 1997)
HPV16
Cancer
(Hamada et al., 1996)
IGF-IR
Cancer
(Trojan et al., 1993; Long et al., 1998)
MDR1
Cancer
(Li and Wang, 1997)
Methyltransferase
Cancer
(Nagane et al., 1997)
Phosphoprotein p18
Cancer
(Jeha et al., 1998)
Protein kinase Cα
Cancer
(Ahmad et al., 1994)
SPARC
Cancer
(Ledda et al., 1997)
uPAR
Cancer
(Yu et al., 1997)
VEGF
Cancer
(Saleh et al., 1996)
GABA
Epilepsy
(Xiao et al., 1997)
Hepatitis B virus
Infectious disease
(Wands et al., 1997)
D2 dopamine
CNS
(Weiss et al., 1997)
Angiotensinogen
Cardiovascular
(Schinke et al., 1996)
1.2.2
A ntisense R N A in agriculture
The biotechnology industry has utilised antisense RNA technology for enhancing agricultural practices. This is most clearly demonstrated by the approval of the first genetically modified food by the FDA in 1994. This was the FLAVR SAVR tomato developed by Calgene Inc. (Davis, CA) in which an antisense polygalacturonase gene was introduced to suppress the breakdown of pectin (Sheehy et al., 1988; Smith et al., 1988). This modification slows down the ripening process of the fruit and therefore increases its shelf-life. A similar strategy has been used to improve the quality and shelf-life of cantaloupe. In this case, an antisense ACC oxidase gene was introduced into the melon to reduce the production of the plant hormone ethylene (Ayub et al., 1996). Additionally, starch branching enzymes have been inhibited successfully by antisense RNA in potatoes to 6
Chapter 1
Introduction
generate high-amylose starch for commercial use (Schwall et al., 2000), while low-amylose starch-containing crops have also been produced for industrial applications (Heyer et al., 1999). The use of antisense RNA has been investigated for the generation of virus-resistant crops (Bird and Ray, 1991). The importance of this type of strategy has been recognised because standard agrochemicals are not often specifically effective against viruses. Interestingly, it was recently shown that the concomitant expression of antisense and sense RNAs can be a potent anti-viral strategy when compared to expressing antisense or sense RNAs alone (Waterhouse et al., 1998). Not only has this observation suggested more effective ways of protecting crops from virus-mediated devastation but it has also shed light on the possible mechanism(s) of antisense RNA-mediated gene silencing (Section 1.5).
1.2.3
A ntisense R N A in floricultutre
Another area where antisense RNA is being exploited is floriculture (Mol et al., 1995). There is a huge market for the development of flowers which have novel ornamental traits and increased vase-life. Like the genetically altered fruit described above, the biosynthesis of ethylene has been inhibited in flowers by antisense ACC oxidase RNA which has subsequently enhanced their shelf-life (Mol et al., 1995). Antisense RNA has also been used for the generation of flower colours not obtainable through conventional breeding techniques. For example, the introduction of antisense chalcone synthase transgenes into petunias, chrysanthemums, gerberas, and roses has resulted in the generation of pure white and pure pink flowers (Elomaa and Holton, 1994). However, the commercial availability of these plants is limited since regulatory bodies are concerned with the possibility that such transgenic plants may become weeds or transfer herbicide resistance to related wild-type weeds. Currently only one transgenic flower crop has been given approval for commercial release. This is long-life carnation produced by Florigene (Australia) which contains an antisense gene directed against an ethylene biosynthesis gene (aco) (Mol et al., 1999).
7
Chapter 1
1.2.4
Introduction
A ntisense R N A in functionalgenom ics
With the sequencing of 34 key genomes now complete including the first working draft of the human genome (Genomes online database; http: // wit. integratedgenomics. com / GOLD / ), genome research is rapidly shifting from the focus of gene discovery to that of gene function (Collins et al., 1998). To understand the biological purpose of the vast number of identified genes it is necessary to disrupt their gene expression and analyse the resulting cellular phenotype. This process is known as reverse genetics. However, in many cases gene knockouts are lethal to a cell if the targeted gene is essential for cell viability. Partial gene suppression is therefore more appropriate to avoid cell death and maintain a change in phenotype. Furthermore, antisense strategies can generate null phenotypes much quicker than traditional targeted gene knockouts (Yanez and Porter, 1998). To this end, antisense RNA-based technology is acquiring a role in the functional genomics arena (Kuspa et al., 1995; Spann et al., 1996; Gibbs et al., 1998; Welch et al., 1998). In addition, antisense RNA-based technology is being employed in the process of validating diseaserelated genes for therapeutic targeting (Welch et al., 1998; Dvorin, 1999). Rational design of antisense RNAs often yields few antisense sequences that can actually inhibit gene expression effectively (Section 1.6). An approach to overcome this limitation is the screening of large libraries of target gene fragments in cellular models for the natural selection of the most potent gene suppressor (Arndt et al., 2000). It was originally hypothesised by Sanford and Johnston (1985) that resistance to a particular pathogen could be derived by expressing portions of its genome in the host tissue. This was later realised by Holzmayer and Roninson who first introduced random fragmented bacteriophage lambda DNA into E. coli cells and identified both sense RNAs (encoding mutant proteins) and antisense RNAs which protected the cells from lambda-induced lysis (Holzmayer et al., 1992). These molecules acted by inhibiting the synthesis of the protein product or by interfering with the activity of the protein, respectively. The sequences generated from such libraries have been coined genetic suppressor elements (GSEs) and the technology is now being employed by companies such as PPD Discovery and Rigel to identify and validate gene targets in oncology (Roninson et al., 1995), inflammation, cardiovascular disease, CNS disorders, and infectious disease (Dunn et al., 1999; Dvorin, 1999). Small molecule drugs can then be designed against the candidate genes for clinical 8
Chapter 1
Introduction
treatment of the associated disease or the identified GSE could be used in a genetic-based therapy. Similarly, ribozyme-based libraries are being generated for the identification of gene targets involved in certain diseases (Pierce and Ruffner, 1998; Welch et al., 1998). However, as opposed to GSE technology, these libraries are limited to primarily identifying antisense-based molecules which cleave at specific sites in the target RNA.
1.3
Endogenous Antisense RNA
Endogenous antisense RNAs are naturally-occurring transcripts that are generated from the opposite strand of sense DNA which encodes a protein. These antisense transcripts may encode their own proteins or regulate their sense counterpart via an antisense RNA-based mechanism. Alternatively, antisense RNA may be generated from sequences that have been rearranged in the genome. The following sections describe examples of both endogenous antisense RNA and dsRNA. The presence of host proteins that bind to long dsRNAs further indicates a natural role for antisense RNA.
1.3.1
Endogenous antisense in prokaryotes and viruses
In prokaryotes endogenously expressed antisense RNAs have been found to be involved in several biological processes (Simons and Kleckner, 1988; Takayama and Inouye, 1990; Wagner and Simons, 1994). These include plasmid replication (Itoh and Tomizawa, 1980), cell division (Bouche and Bouche, 1989), transposon control (Simons and Kleckner, 1983), plasmid conjugation (Lee et al., 1992), and bacteriophage development (Krinke and Wulff, 1987). In all cases antisense RNAs down-regulate the expression of sense transcripts at the post-transcriptional level (Wagner and Simons, 1994). Although there are exceptions, most prokaryotic endogenous antisense genes share common features. For example, prokaryotic antisense RNAs are untranslatable and small, ranging from approximately 68 to 220 nt. These antisense RNAs either act in cis or trans. Cis-acting antisense genes are transcribed from the same loci as their target gene and are completely complementary to the target mRNA. Trans-acting antisense genes are encoded at different loci and usually have only partial homology with their target mRNA. It has also been shown that antisense RNAs have 9
Chapter 1
Introduction
a high degree of secondary structure which is important in the kinetics of RNA:RNA duplex formation (Simons, 1988; Wagner and Simons, 1994). It has recently been suggested that antisense RNA can regulate HIV-1 gene expression (Vanhee-Brossollet et al., 1995). An RNA transcript complementary to the env gene was identified by reverse trancriptase-PCR (RT-PCR) and shown to alter the regulatory patterns of the rev response element (RRE). Furthermore this antisense transcript could be translated in vitro. The resulting protein had properties which implicated its involvement in viral structure (Vanhee-Brossollet et al., 1995). Together these findings indicate that the RNA transcript may have dual roles in HIV-1 biology. Additionally, antisense RNA has been identified in Epstein Barr Virus (EBV) where it was shown to post-transcriptionally regulate the bzlf1 gene (Prang et al., 1995), while evidence also exists for endogenous antisense RNA-mediated gene regulation in herpes virus (Prang et al., 1995), human papillomavirus (HPV) (Higgins et al., 1991), and retrotransposons (Day and Rochaix, 1991).
1.3.2
Endogenous antisense in eukaryotes
In contrast to prokaryotic endogenous antisense sequences, naturally-occurring antisense genes which have been identified in eukaryotes are generally much larger and often encode proteins (Delihas, 1995; Dolnick, 1997; Knee and Murphy, 1997; Vanhee-Brossollet and Vaquero, 1998). This could be due to the complex nature of these genomes and the consequent need for highly specific genetic regulation. Bioinformatic analysis has shown that long, in-frame, open reading frames (ORFs) encoded in the antisense DNA strand occur frequently in eukaryotic organisms (Merino et al., 1994). Naturally, these sequences may not have a role in sense RNA regulation and may only be involved in protein synthesis. However, endogenous antisense RNAs have been implicated in mRNA editing (Seeburg, 1996), post-transcriptional gene regulation, X-chomosome inactivation (Heard et al., 1999), genomic imprinting (Reik and Constancia, 1997; Rougelle et al., 1998), and a variety of pathologies including cancer (Khochbin and Lawrence, 1989; Eccles et al., 1994) and CNS disorders (Tosic et al., 1990). Examples of eukaryotic genes for which antisense transcripts have been reported are shown in Table 1.3. In most cases these are the result of 10
Chapter 1
Introduction
convergent transcription, whereby promoters in the opposite strand overlap transcription of the 3' end of the sense RNA. Alternatively they result from divergent transcription, where the transcripts overlap at the 5' end. Additionally, Lipman has recently proposed that the long stretches of conserved sequence found in the 3’ untranslated region (3’ UTR) of many vertebrate genes may be involved in gene regulation via the formation of long RNA:RNA duplexes (Lipman, 1997). It was also recently shown that a large number of eukaryotic mRNAs are complementary to ribosomal RNA (rRNA) sequences (Mauro and Edelman, 1997). It was consequently found that these sequences could hybridise to rRNA and affect translational efficiency (Tranque et al., 1998).
Table 1.3 Examples of eukaryotic genes with endogenous antisense RNAs. Organism
Gene
Gene Function
References
D ictyostelium
PSV-A
Structure
(Hildebrandt and Nellen, 1992)
D rosophila
D dc
Hormonal
(Spencer et al., 1986)
D rosophila
G art
D rosophila
4f-rnp
D rosophila
D lx-1,D lx-2
D rosophila
N otch
pigmentation
(Kidd and Young, 1986)
D rosophila
m icropia
Retrotransposition
(Lankenau et al., 1994)
Xenopus
bFG F
Growth
(Volk et al., 1989)
S.cerevisiae
R AD 10
DNA repair
(Van Duin et al., 1989)
S.cerevisiae
RHO 1
(Peterson and Myers, 1993)
S.cerevisiae
C YC 1
(Zaret and Sherman, 1982)
A.m ajus
niv-525
pigmentation
(Coen and Carpenter, 1988)
Silkmoth
H cB.12
Choriogenesis
(Skeiky and Iatrou, 1990)
C .elegans
lin-14
Heterochonicity
(Lee et al., 1993)
Chicken
αIcollagen
Structure
(Farrell and Lukens, 1995)
Rat
bFG F
Growth
(Murphy and Knee, 1994)
Rat
c-erbA α
Hormonal
(Munroe and Lazar, 1991)
Mouse
m bp
Myelination
(Tosic et al., 1990)
Mouse
p53
Transcription
(Khochbin and Lawrence, 1989)
Mouse
H oxd-3
Development
(Bedford et al., 1995)
Mouse
c-m yc
Proliferation
(Nepveu and Marcu, 1986)
Mouse
L27
Ribosomal
(Belhumeur et al., 1988)
(Henikoff et al., 1986) (Petschek et al., 1996)
Editing
(McGuinness et al., 1996)
11
Chapter 1
Introduction
Mouse
c-m yb
Proliferation
(Bender and Thompson, 1987)
Mouse
surf-2/surf-4
Ribosomal
(Williams and Fried, 1986; Williams et al., 1988)
Mouse
Igf2r
Growth
(Wutz et al., 1997)
Mouse
H sp 70.2
Development
(Murashov and Wolgemuth, 1996)
Human
c-m yc
Proliferation
(Celano et al., 1992)
Human
N -m yc
Proliferation
(Krystal et al., 1990)
Human
ear-7
Hormonal
(Miyajima et al., 1989)
Human
bFG F
Development
(Murphy and Knee, 1994)
Human
EIF2α
Translation
(Silverman et al., 1992)
Human
SC 35
Splicing
(Fu and Maniatis, 1992)
Human
TS
Proliferation
(Dolnick, 1993)
Human
G nR H
Hormonal
(Adelman et al., 1987)
Human
M CH
Neurotransmission
(Hervieu and Nahon, 1995)
Human
W T1
Proliferation
(Eccles et al., 1994; Malik et al., 1995)
Human
bcm a
Immunity
(Laabi et al., 1994)
Human
CD 3ε/η/θ
Immunity
(Lerner et al., 1993)
Human
bcl-2
Apoptosis
(Capaccioli et al., 1996)
Many more examples of overlapping transcripts exist in yeast. The relatively high number of these is probably due to the compact nature of the yeast genome and the consequent proximity of yeast ORFs. This requires efficient mRNA 3’ end formation to inhibit transcription through neighbouring genes and possible inhibition of gene expression via promoter occlusion (prevention of transcription initiation due to active transcription of an overlapping gene), or generation of long regions of antisense RNA (Peterson and Myers, 1993). In fission yeast transcriptional pausing elements have been characterised which ensure appropriate termination of gene transcription (Birse et al., 1997). Although overlapping transcripts are present in budding yeast, there have been no reports of antisense RNA-mediated gene silencing in S. cerevisiae suggesting that, cellular elements exist which abrogate this form of gene regulation in this organism (Atkins et al., 1994). One example of a naturally-occurring antisense RNA has been reported in the eukaryotic amoeba Dictyostellium discoideum (Hildebrandt and Nellen, 1992). In this case a 1.8 kb antisense RNA was found to conditionally regulate the PSV-A gene during development (Hildebrandt and Nellen, 1992; Sadiq et al., 1994). Furthermore, an ORF was not found in 12
Chapter 1
Introduction
this antisense transcript indicating that its cellular mechanism may be confined to antisense RNA-mediated gene regulation.
1.3.3
Endogenous double-stranded R N A
The presence of dsRNA in eukaryotic cells and the identification of factors which employ dsRNA as a substrate further support a role for antisense RNA in the natural regulation of gene expression (Kumar and Carmichael, 1998). DsRNA-dependent adenosine deaminase [ADAR; (Bass et al., 1997)] has been shown to act on duplexes by modifying adenosines to inosines (Wagner et al., 1989; Polson and Bass, 1994). This activity results in partial unwinding of the RNA duplex due to unstable adenosine:uracil base pairs and is why the enzyme was originally termed "unwindase" (Bass and Weintraub, 1988; Rebagliati and Melton, 1987). ADAR is sensitive to the length of the RNA duplex and does not modify dsRNAs smaller than 15 bp, while the optimal activity is seen with 100 bp or longer RNA duplexes (Nishikura et al., 1991). This may be important since short RNA duplexes are abundant in the nucleus due to the highly complex secondary structures of many different RNAs. Additionally, this discrimination could be important for recognising viral dsRNAs or endogenous antisense-targeted transcripts (Kumar and Carmichael, 1997). It has been demonstrated that antisense:sense RNA interaction is a mechanism sometimes employed to edit mRNAs (Dolnick, 1997). The best characterised ADARs have been distinguished by their differing specificities to endogenous substrates (Bass et al., 1997). For example, ADAR1 tends to deaminate multiple adenosines within duplexed RNA (Bass and Weintraub, 1988; Wagner et al., 1989). In contrast, ADAR2 has been implicated in the specific modification of several receptors (Seeburg, 1996). For instance, posttranscriptional A to I editing of the glutamate subunit Glut-B pre-mRNA results in the conversion of a glutamate (CAG) to an argine (CGG) codon (Sommer et al., 1991). This modification alters the calcium permeability of the ion channel. A similar modification has also been demonstrated in the serotonin receptor which results in a reduced interaction between the receptor and G-proteins (Burns et al., 1997). While short RNA duplexes undergo limited modification and can complete cytoplasmic transportation, ADAR-mediated modification of long dsRNAs has been shown 13
Chapter 1
Introduction
to result in nuclear retention of the RNA duplex and consequent translational inhibition (Kumar and Carmichael, 1997). These authors used a polyomavirus model system to investigate the function of long antisense RNAs in mammalian cells. Modified transcripts had approximately half of their adenosines changed to inosines and were relatively stable within the nucleus. The level of inosines also correlates with the level of ADAR expression (Paul and Bass, 1998). Interestingly, the work by Kumar and Carmichael (1997) also demonstrated that the observed antisense-mediated inhibition of sense RNA is in fact due to the lack of probe complementarity with the modified RNA. In other words, the RNA is present but "invisible" to the probes being used and would thus explain the common hypothesis of antisense-induced degradation of target mRNA. In contrast, duplex RNA in the cytoplasm can trigger a potent immunological response (Kalvakolanu and Borden, 1996). Furthermore, it has been shown that only a single molecule of dsRNA is required to initiate this mechanism (Marcus, 1981). DsRNA formation usually occurs at some stage of viral life cycles which can lead to the induction of the interferon (IFN) pathway. This is often the result of dsRNA-activated protein kinase (PKR) autophosphorylation, which in turn phosphorylates the eukaryotic initiation factor eIF2α which leads to translational arrest. Alternatively, dsRNA can activate 2',5'-OligoA synthetase which then activates RNase L. RNase L can specifically degrade both viral and cellular RNAs (Kumar and Carmichael, 1998). Most naturally-occurring antisense RNAs likely act in the nucleus and as such would avoid these physiological effects resulting from the presence of cytoplasmic dsRNA. Curiously, antisense RNA has often been introduced into the cytoplasm of mammalian cells for the specifc down-regulation of target mRNA, but there has been a lack of reports demonstrating the non-specific immune response which would be expected if dsRNA was being formed. This could be explained if dsRNA was not being formed in the first place or if it is being rapidly degraded by ribonucleases before it can interact with PKR or other immunological factors. Moreover, only a few reports have actually demonstrated the binding of antisense RNA with its complementary target (Kim and Wold, 1985; Knect and Loomis, 1987; Yokoyama and Imamoto, 1987; Krystal et al., 1990; Kumar and Carmichael, 1997), while those dsRNAs that were detected were found to be localised in the nucleus. 14
Chapter 1
Introduction
Not surprisingly, many viruses have evolved strategies to counteract this hostdefense mechanism. In most cases these viruses generate proteins that deactivate PKR either by degrading it or inhibiting its activity. This has been demonstrated in adenovirus (Green and Mathews, 1992), EBV (Elia et al., 1996), vaccinia virus (Chang et al., 1992), poliovirus (Black et al., 1989), reovirus (Imani and Jacobs, 1988), influenza virus (Katze et al., 1988), and HIV-1 (Gunnery et al., 1990). In comparison, the polyomavirus has an alternative strategy whereby it interferes with IFN-inducible gene expression (Kumar and Carmichael, 1998). Like their mammalian counterparts, plant viruses have also evolved mechanisms for evading host defense mechanisms. However, unlike mammalian organisms, plants lack an immune system and have evolved an alternative strategy to protect themselves against viral attack (Baulcombe, 1996; Kooter et al., 1999; Ding, 2000). Section 1.5.3 discusses these mechanisms and the ways in which plant viruses avoid them.
1.4
Mechanisms of Antisense Action
Evidence exists for antisense RNA acting in either the nucleus or the cytoplasm (Fig. 1.1). It is also clear that the mode of action can vary between different organisms and different target genes. The use of non-polyadenylated antisense transcripts, which are retained in the nucleus, have suggested that the site of regulation of sense RNA expression could be at the level of transcription, pre-mRNA processing, or mRNA transport. In these cases there is a reduction in the steady-state level of the target mRNA. In addition, it has been shown that antisense RNA can directly inhibit the translation of the RNA message which occurs in the cytoplasm. Here, the steady-state level of mRNA remains the same while protein levels are reduced. Additionally, recent observations on the use of dsRNA-mediated gene silencing has suggested an alternative mechanism for the action of antisense RNA. The two primary hypotheses that may explain the consequence of RNA duplex formation are i) steric hindrance of mRNA expression, and/or ii) action of host-encoded factors on the dsRNA (Murray and Crockett, 1992).
15
Chapter 1
1.4.1
Introduction
Interference w ith transcription
Generally, a direct effect on RNA transcription is not seen in antisense RNA experiments (Murray and Crockett, 1992). Although it is cited to be one site of antisense RNA action (Mol et al., 1990), only two reports have suggested antisense RNA can act at the level of transcription (Yokoyama and Imamoto, 1987; Farrell and Lukens, 1995). In vitro run-on experiments conducted in a human promyelotic leukemic cell line have demonstrated a specific correlation between antisense c-myc RNA production and inhibition of sense c-myc RNA transcription (Yokoyama and Imamoto, 1987), while Northern analysis localised the majority of antisense RNA to the nucleus. This report, however, is complicated by the fact that monocyte differentiation is also associated with c-myc down-regulation. Farrell and Lukens (1995) demonstrated transcriptional regulation of α1 (I) collagen mRNA in chick embryo chondrocytes. As the antisense sequence was found within the sense locus, singlestranded DNA probes were used in nuclear run-on experiments to differentiate between sense and antisense RNA transcription. It is suggested that premature termination of sense RNA is probably due to polymerase collision of the antisense RNA transcriptional unit in this case (Vanhee-Brossollet and Vaquero, 1998).
1.4.2
Interference w ith pre-m R N A processing
There is limited evidence for antisense RNA-mediated interference at the level of RNA splicing. One report described inhibition of splicing by antisense RNA in vitro by targeting either splice sites or sequences down-stream of splice sites in HeLa cell extracts (Munroe, 1988).
Others
have
demonstrated
the
inhibition
of
hypoxanthine
guanine
phosphoribosyltransferase (HPRT) in vivo with antisense RNA specific to the first intron of HPRT (Stout and Caskey, 1990). However, in the latter example the effect could be at the level of transcription, pre-mRNA processing, or splicing.
1.4.3
Interference w ith m R N A transport
As discussed in Section 1.3.3, formation of dsRNA in the nucleus results in inhibition of nucleocytoplasmic mRNA transport (Kumar and Carmichael, 1997; Kumar and 16
Chapter 1
Introduction
Carmichael, 1998). However, ADAR-mediated modification of dsRNAs has probably resulted in the lack of reports demonstrating antisense-mediated interference at this level of gene expression because of reduced probe complementarity. For this reason only a few examples of nuclear retention have been reported (Kim and Wold, 1985; Prochownik et al., 1988; Tosic et al., 1990). Kim and Wold (1985) expressed antisense thymidine kinase (TK) RNA in a mouse cell line and showed that 95% of TK dsRNA was located in the nucleus while there was a concomitant 90% reduction in TK enzyme levels. As these cells contained a similar level of total TK RNA compared to control cells, it was concluded that target mRNA was not being degraded but rather its transport to the cytoplasm was being inhibited. Similarly, it was shown in a mouse cell line that expression of antisense c-myc RNA resulted in a re-adjustment of c-myc mRNA localisation favouring the nuclear compartment (Prochownik et al., 1988). Another study in a mutant mouse line harbouring an endogenous antisense gene also demonstrated interference with mRNA transport. In myelin-deficient (mld) mice there is an abnormal tandem duplication of the gene encoding myelin basic protein (MBP) which generates an antisense transcript (Tosic et al., 1990). This mutant showed a large decrease in MBP, a marked decrease in mbp mRNA in the cytoplasm, and an accompanying increase in the abundance of nuclear dsRNA (Tosic et al., 1990; Okano et al., 1991). Again, nuclear retention of mRNA indicates antisense RNAmediated inhibition of cytoplasmic transport or mRNA processing.
1.4.4
Interference w ith translation
Inhibition of protein synthesis when antisense RNA and target mRNA are co-localised in the cytoplasm suggests interference with mRNA translation. For example, microinjection of antisense RNA into the cytoplasm of Xenopus was one of the first models used to demonstrate antisense RNA-mediated gene silencing in eukaryotic cells (Melton, 1985; Harland and Weintraub, 1985; Wormington, 1986). These studies indicated that antisense RNA inhibited mRNA translation as the level of target mRNA was unchanged compared with controls while a large excess of antisense RNA was required for effective inhibition. In contrast, when injected into the nucleus, target mRNA was dramatically reduced while gene suppression was very efficient (Giebelhaus et al., 1988). Additionally, stably 17
Chapter 1
Introduction
expressed antisense genes have been shown to interfere with translation (Pecorino et al., 1988; Bunch and Goldstein, 1989; Ch'ng et al., 1989). In these reports expression of antisense RNA inhibited target gene activity by approximately 50% while there was no effect on the steady-state mRNA levels, nor on the sub-cellular distribution of the mRNA. The authors therefore concluded the site of antisense RNA-mediated inhibition was at the level of translation. Antisense RNA-mediated gene regulation at the level of translation has also been shown with the lin-4/lin-14 transcripts in C. elegans (Wightman et al., 1993). The level of Lin-14 protein is controlled by two small antisense transcripts generated from the lin-4 locus which are homologous to the 3' UTR of lin-14 mRNA (Lee et al., 1993; Wightman et al., 1993). Expression of this antisense RNA correlates with a down-regulation of target protein while the steady-state level of lin-14 mRNA remains the same. This suggests that the antisense RNA anneals to lin-14 mRNA in the cytoplasm and inhibits Lin-14 synthesis. This might be due to structural rearrangements of the 3' UTR which are critical for translational efficiency (Decker and Parker, 1995).
1.4.5
Interference w ith m ultiple steps in gene expression
In some instances it has been shown that antisense RNA can interfere with multiple steps of the gene expression pathway. For example, Cornelissen and Vandewiele (1989) demonstrated, in a plant model, the antisense RNA-mediated reduction in the steady-state mRNA level of the bar gene by approximately 4-fold while there was a 13-fold decrease in synthesis of its protein product. Additional analysis indicated that the antisense bar RNA controlled both the transcript level in the nucleus and translational efficiency in the cytoplasm while nucleocytoplasmic transport was not affected (Cornelissen, 1989).
18
Chapter 1
1.5
Introduction
Post-Transcriptional Gene Silencing
Close investigation of post-transcriptional gene silencing (PTGS) has recently suggested an alternative mode of action of antisense RNA. PTGS encompasses a variety of phenomena which are implicated in viral defense, control of transpositional elements, genetic imprinting, and endogenous gene regulation (Fire, 1999). Although originally a term used only in plants (Depicker and Van Montagu, 1997), it is clear that PTGS includes the observed antisense RNA-mediated gene suppression (Fire, 1999), co-suppression (or quelling in fungi) (Bingham, 1997; Cogoni and Macino, 1997a), and dsRNA-mediated gene interference (or RNA interference {RNAi} in animals) (Bruening, 1998; Ketting and Plasterk, 2000). Recent observations have indicated that antisense RNA-mediated gene silencing can be due to the specific degradation of the target via a dsRNA intermediate (Montgomery and Fire, 1998).
1.5.1
dsR N A -m ediated gene interference
Indeed, the direct introduction of dsRNA into model organisms has proven to be a very potent regulator of gene expression (Sharp, 1999; Bosher and LaBouesse, 2000). The utility of dsRNA-mediated gene interference has been demonstrated in a variety of organisms including C. elegans (Fire et al., 1998), plants (Waterhouse et al., 1998), Drosophila (Kennerdell and Carthew, 1998; Misquitta and Paterson, 1999), planaria (SanchezAlvarado and Newmark, 1999), trypanosomes (Ngo et al., 1998), Xenopus (Nakano et al., 2000), Hydra (Lohmann et al., 1999), zebrafish (Wargelius et al., 1999), and recently in mouse oocytes (Wianny and Zernicka-Goetz, 2000). In all of these systems dsRNA is introduced into the organism in the form of either in vitro prepared dsRNA, or DNA plasmids which can generate both antisense and sense RNA or an inverted repeat RNA (Table 1.4).
19
Chapter 1
Introduction
Table 1.4 Organisms exhibiting dsRNA-mediated gene silencing. Organism
Targeted genes
Source a
References
N icotiana tabacuum
Pro
DNA/RNA
(Waterhouse et al., 1998)
O ryza sativa
G US
DNA/RNA
(Waterhouse et al., 1998)
Arabidopsis thaliana
agam ous,clavata3,
DNA
(Chuang and Meyerowitz, 2000)
DNA/RNA
(Ngo et al., 1998)
RNA
(Fire et al., 1998)
apetala1,perianthia Trypanosom a brucei
α-tubulin,PFR ,actin, β-tubulin
C aenorhabditis elegans
unc-22,fem -1,unc-54, hlh-1,gfp,lacZ
(Tavernarakis et al., 2000)
c37a2.5,f26f12.7, m ec-4,unc-8 lir-1
DNA
(Bosher et al., 1999)
D rosophila
nautilus,tw ist,
RNA
(Misquitta and Paterson, 1999)
m elanogaster
daughterless,
RNA
(Kennerdell and Carthew, 1998)
w hite,engrailed,S59, dm ef2,lacZ w g,ftz,eve,ttk,fzA dsor1, dakt, erkA, pten, RNA
(Clemens et al., 2000)
dack,dsh3px1 Schm idtea
M yosin,opsin,α-tubulin
RNA
(Sanchez-Alvarado and Newmark, 1999)
m editerranea Periplaneta am ericana
engrailed
RNA
(Marie et al., 2000)
D anio rerio
ntl,flh,pax2.1,lacZ
RNA
(Wargelius et al., 1999)
sonic hedgehog,
RNA
(Li et al., 2000)
floating head H ydra m agnipapillata
ks1
RNA
(Lohmann et al., 1999)
Xenopus laevis
Xlim -1
RNA
(Nakano et al., 2000)
Mouse oocytes
gfp,c-m os,E-cadherin
RNA
(Wianny and Zernicka-Goetz, 2000)
a
Source of dsRNA is either from in vitro transcription (RNA) or gene expressed (DNA)
20
Chapter 1
Introduction
Additionally, another form of PTGS has been observed in which the introduction of extra copies of a target gene suppress both the endogenous and introduced transgene. This has been termed co-suppression in the original experiments performed in plant models (Napoli et al., 1990) or quelling from similar observations in fungi (Romano and Macino, 1992). Co-suppression has been demonstrated in an increasingly diverse range of organisms including Paramecium (Ruiz et al., 1998), Neurospora crassa (Cogoni and Macino, 1997b), plants (Jorgensen, 1995; Voinnet and Baulcombe, 1997), Dictyostelium (Scherczinger and Knecht, 1993), Drosophila (Pal-Bhadra et al., 1997), and in mammalian cells (Cameron and Jennings, 1991; Bahamian and Zarbl, 1999). Although the expression of additional sense genes can act by transcriptional repression of chromatin due to ectopic pairing and DNA methylation (Ingelbrecht et al., 1994), it is the alternative mechanism of post-transcriptional silencing, where there is an observed reduction in the steady-state level of target mRNA, which is of interest in the context of antisense RNA.
1.5.2
M echanism s ofPTG S
The formation of dsRNA is common to all categories of PTGS, however differences in the method of formation have been reported (Montgomery and Fire, 1998). The dsRNA can be formed either by i) the cryptic transcription of antisense RNA in cells where extra copies of the sense gene have been introduced, ii) the simultaneous expression of antisense and sense sequences, iii) the formation of RNA hairpins from inverted repeats or panhandles, or iv) the direct introduction of dsRNA (Montgomery and Fire, 1998) (Figure 1.2).
21
Chapter 1
Introduction
Fig. 1.2 Possible causes of dsRNA production. On the left is a series of experiments designed to generate a pure population of single-stranded RNA. On the right are possible mechanisms for the generation of dsRNA for these experiments. In each case low level transcription of the opposite strand driven by a cryptic promoter results in the production of complementary RNA to which the intended transcript can hybridise. This could occur for (a) an integrated sense transgene, (b) an integrated antisense transgene, (c) an integrated transgene array containing inverted repeats, and (d) during in vitro RNA synthesis. From Montgomery and Fire, 1998. 22
Chapter 1
Introduction
Inhibition of gene expression using dsRNA is somewhat paradoxical when looked at in the traditional view of antisense RNA-based mechanisms. If one considers the action of antisense RNA as being due to inhibition of translation via one or more of the processes described above (that is, interference with mRNA processing, transport, or translation) then introduction of pre-annealed dsRNA would not be expected to have an effect while introduction of additional sense RNA might be considered to inhibit antisense RNA action. This could occur by titrating available antisense RNA from interacting with the complementary mRNA target. Two models for how dsRNA mediates genetic interference are shown in Figure 1.3. The first model is gaining increasing support from both genetic and biochemical studies (Bass, 2000; Bosher and LaBouesse, 2000). The dsRNA is thought to act as a substrate for dsRNA-dependent RNA polymerase which generates a complementary RNA (cRNA). The antisense cRNA could then target mRNA for degradation or anneal to other sense RNAs to generate additional dsRNA. It has been shown in cell-free assays that long dsRNAs are cleaved by ribonucleases into short 21-25 nt dsRNAs. These can then act as guide sequences for the specific degradation of target mRNA (Tuschl et al., 1999; Hammond et al., 2000). These short RNA species have also been shown to exist in four different forms of PTGS in plants (Hamilton and Baulcombe, 1999) suggesting this phenomenon may act across a broad spectrum of species. Experiments in the Drosophila model have also shown that RNAi is mediated by nuclease degradation of the targeted mRNA (Tuschl et al., 1999; Hammond et al., 2000). The second model suggests the dsRNA is not processed into short species but, rather is acted upon by host-encoded proteins which facilitate catalytic degradation of target mRNA (Waterhouse et al., 1998). For example, RNase L may conjugate to dsRNA whereby specific mRNA degradation is promoted. The dsRNA protein complex would then be free to continue multiple rounds of target cleavage (Waterhouse et al., 1998).
23
Chapter 1
Introduction
Fig. 1.3 Models for post-transcriptional gene silencing. (a) dsRNA is amplified by an RNA-dependent RNA polymerase to generate cRNA. Antisense RNA then specifically degrades target mRNA. (b) A host factor(s) conjugates to the dsRNA which allows it to go though multiple round of target mRNA decay. From Fire, 1999. Additional evidence for this mechanism being a universal phenomena comes from the identification of a central component of PTGS in Neurosopra (Cogoni and Macino, 1999a), Arabidopsis (Dalmay et al., 2000), and C. elegans (Ketting et al., 1999; Tabara et al., 1999). Genetic screens in these organisms have identified homologues of the RNAdependent RNA polymerase as being a central factor in dsRNA-mediated gene silencing (qde-1; (Cogoni and Macino, 1999a), sde1; (Dalmay et al., 2000), ego-1; (Smardon et al., 2000)). Bioinformatic analysis has also revealed that homologues of this protein exist in other organisms including fission yeast (Cogoni and Macino, 1999a). These studies used mutagenesis approaches to screen for clones which had lost their RNAi activities. As would be expected, all the genes which have been identified using these strategies are not essential 24
Chapter 1
Introduction
for cell viability (Bosher and LaBouesse, 2000). Several other genes which are involved in PTGS have also been identified. These include a RecQ DNA helicase (qde-3) (Cogoni and Macino, 1999b), a RNase D homologue (mut-7) (Ketting et al., 1999), and a putative translation initiation factor (rde-1, qde-2, ago1) (Tabara et al., 1999; Catalanottto et al., 2000; Fagard et al., 2000). The identification of homologues of the translation initiation factor in nematodes, fungi, and plants also argues for PTGS being evolutionarily conserved (Fagard et al., 2000). The genes mut-2, rde-2, rde-4, and rde-7 have been identified as being involved in either the initiation or maintenance of RNAi (Tabara et al., 1999; Ketting et al., 1999; Grishok et al., 2000). Additionally, RNAi has been shown to be dependent on ATP which may be required for strand dissociation of dsRNA (Zamore et al., 2000; Bass, 2000). In the case of plants and nematodes it has been shown that RNAi acts in a substoichiometric fashion and has the ability to migrate between cells (Fire et al., 1998; Voinnet et al., 1998). This can be explained by the above model whereby small dsRNAs are amplified. These small duplexed RNAs may be small enough for transportation out of the primary site of RNAi and into distal tissues. This might be analogous to a “bystander effect” which is seen in genetically modified tumour cells (Freeman et al., 1993). Although dsRNA seems to have a catalytic or amplification step, the potency of dsRNA-mediated gene silencing seems to vary between organisms. For example, only a few molecules of dsRNA were required to demonstrate gene silencing in C. elegans (Fire et al., 1998) but was shown to be less robust in the vertebrate zebrafish where gene suppression was dependent on the concentration of introduced dsRNA (Wargelius et al., 1999; Li et al., 2000). This suggests that either the level of dsRNA did not reach the threshold required for activation of a catalytic event or that some of the factors involved in robust forms of PTGS are absent and/or inhibitors of PTGS are present in that organism. Like antisense RNA, dsRNA can act in both the nucleus and the cytoplasm. Although most RNAi effects have been observed when using exonic sequences (Fire et al., 1998; Montgomery et al., 1998), Bosher and colleagues recently demonstrated that RNAi can act at the level of pre-mRNA by targeting introns of the lir-1 and lin-26 genes with dsRNA (Bosher et al., 1999). It has also been shown that dsRNA does not affect the primary DNA sequence. Montgomery and colleagues (1998) found no alteration in the 25
Chapter 1
Introduction
DNA sequences analysed from nematodes affected by dsRNA, while transcription initiation and elongation was also unaltered.
1.5.3
Interference w ith PTG S
It has been suggested that ADAR activity can interfere with the RNAi mechanism (Tuschl et al., 1999; Bass, 2000). Although sub-stoichiometric amounts of dsRNA have been shown to be effective for PTGS it is also becoming clear that gene silencing works better if more dsRNA is employed (Li et al., 2000; Zamore et al., 2000). Firstly, this might be due to competition of PTGS-specific dsRNA-binding proteins with other dsRNA binding proteins such as ADAR. Secondly, ADAR-mediated modification may reduce the complementarity of the antisense RNAs with the target transcript, thereby preventing recognition of modified dsRNAs by proteins involved in PTGS. Interestingly, high levels of ADAR expression have been found in neural cells and these are somewhat reclacitrant to RNAi (Paul and Bass, 1998; Bass, 2000). Another reason why increasing the intracellular concentration of dsRNA enhances PTGS might be due to a dilution effect. If fragmented dsRNAs can be transported out of the cell then the presence of more dsRNA to begin with will result in more dsRNAs remaining within the cell. Similarly, this might counter any dilution effect caused by cell division (Bass, 2000). Plant viral defense strategies and PTGS act via similar mechanisms (Ratcliff et al., 1997; Angell and Baulcombe, 1999). This is perhaps not surprising since dsRNAs would be generated in both instances. Like animal viruses (Section 1.3.3), plant viruses also have ways of avoiding the host anti-viral response. Many plant viruses encode proteins that suppress PTGS (Anandalakshmi et al., 1998; Brigneti et al., 1998; Kasschau and Carrington, 1998; Voinnet et al., 1999; Lucy et al., 2000). The potyviral Hc-protease (HcPro) has been established as a suppressor of PTGS and has provided a link between PTGS and antiviral defense PTGS (Anandalakshmi et al., 1998; Brigneti et al., 1998; Kasschau and Carrington, 1998). The 2b protein of the cucumber mosaic virus (CMV) has also been identified as an inhibitor of PTGS (Brigneti et al., 1998). Consistent with these observations, Voinnet and colleagues (1999) identified the ACMV AC2, RYMV P1, and TBSV 19K pathogenicity factors as suppressors of PTGS in a GFP model plant system. 26
Chapter 1
Introduction
Additional proteins were identified which showed partial inhibition of PTGS. Interestingly, no common structural features were found in any of these proteins leading the authors to suggest that the PTGS suppression capabilities of different viruses has evolved independently.
1.6
Factors that Affect Antisense RNA Efficacy
There are a number of unsuccessful antisense RNA experiments that have been reported and it is likely that many more have failed and not been published (Salmons et al., 1986; Kerr et al., 1988; Law and Devenish, 1988; Bunch and Goldstein, 1989; Arndt et al., 1994; Olsson et al., 1997; Keon et al., 1999). Further, although several organisms have been recalcitrant to antisense-RNA mediated gene regulation, targeting genes in species which have already proven to be amenable to antisense RNA technology does not always result in successful gene inhibition. This is probably due to the fact that several parameters can affect the efficacy of an antisense RNA molecule. These factors include i) the secondary structure of the complementary RNAs and target site accessibility (local accessibility), ii) the stability of the antisense RNA molecule, iii) the ratio of antisense and target RNA, iv) the presence of RNA binding proteins which may inhibit or enhance hybridisation, v) the metabolic state of the cell, and vi) the co-localisation of the complementary RNAs within the cell (cellular accessibility) (Denhardt, 1992).
1.6.1
Localaccessibility
Detailed studies on antisense RNA hybridisation kinetics in prokaryotes has indicated that the secondary structure of both complementary molecules is important for RNA duplex formation (Wagner and Brantl, 1998). The first step of RNA:RNA annealing is the formation of the “kissing complex” though Watson-Crick base pairing or other basespecific interactions (Tomizawa, 1984). This usually occurs between loop sequences upon which there is successive formation of base pairs and the generation of a complete RNA duplex. Mutations in such loops result in a decreased rate of stable binding demonstrating the importance of the secondary structure in RNA annealing (Tomizawa, 1986). In prokaryotes short RNA duplexes may undergo constant dissociation and association, 27
Chapter 1
Introduction
however with longer RNA duplexes, such as those found in eukaryotes, dissociation has not been shown to occur measurably in vitro (Homann et al., 1996). The local accessibility of target mRNA has been investigated using antisense ODNs both in vitro and in vivo (Politz et al., 1995; Ho et al., 1996; Milner et al., 1997; Ho et al., 1998; Scherr and Rossi, 1998). Although these experimental screens were employed to identify the most effective antisense ODN for specific target sequences, they illustrate the difficulty of rationally designing effective antisense molecules and the role of RNA secondary structure in RNA hybridisation. Furthermore, compared with long antisense RNAs, antisense ODNs have limited stable intramolecular duplexes which results in reduced interference of duplex formation. Scherr and Rossi (1998) used a cell-free system to identify the most effective antisense ODN against the murine DNA methyltransferase (MTase) mRNA. An RNase H cleavage assay identified the most efficient oligonucleotide as cleaving target mRNA by approximately 85%. When used in vivo this ODN was also shown to be the most effective at inhibiting MTase expression. This group also demonstrated that theoretical prediction of RNA accessibility correlates with the cell-free experiments (Scherr et al., 2000). An alternative approach was used to determine target mRNA accessible sites by introducing oligonucleotides in vivo (Politz et al., 1995). Here, hybridised ODNs were identified by their ability to prime reverse transcription of the mRNA. The resulting cDNAs could be visualized by fluorescent in situ hybridisation (FISH). Oligonucleotides which did not hybridise could not generate cDNA. In silico analysis of RNA secondary structures has also been shown to have some predictive value of the efficacy of antisense RNAs (Denman, 1993; Patzel and Sczakiel, 1998) or antisense genes (Lehmann et al., 2000). In contrast to antisense ODNs, RNA duplex formation of long antisense RNA-based molecules is also dependent upon their own secondary structure as there is much greater intramolecular hybridisation (Patzel and Sczakiel, 1998). In general, fast annealing antisense RNAs have been found to be the best inhibitors of gene expression. Therefore, as for antisense ODNs, computer-based algorithms employing this criteria have been used as an initial screen for the most effective antisense RNA molecules (Rittner et al., 1993; Kronenwett et al., 1996; Patzel and Sczakiel, 1998).
28
Chapter 1
Introduction
Variation in antisense RNA efficacy when targeting different subregions of an HIV1 mRNA target has been studied in detail (Rittner and Sczakiel, 1991). It was concluded from this study that HIV-1 inhibition was most effective when antisense RNAs were targeted to regions of the target mRNA having minimal local secondary structure. However, identification of efficacious antisense constructs though empirical design can be a tedious process and has no guarantee of success. Ideally, an in vivo screen for the most effective gene-expressed antisense RNAs is required as it would account for most parameters which can affect antisense RNA within the cellular environment. Screening of libraries for identifying efficient gene suppression elements (GSEs) has been described in Section 1.2.4. Recently Arndt and colleagues (2000) used a fission yeast system to rapidly identify gene suppression constructs against several targets including ura4, c-myc, and Chk1 target sequences. In each case the effective antisense RNAs aligned to specific regions of the target sequence suggesting that certain domains may be more accessible for RNA duplex formation than others, while such sites varied between target sequences. On further analysis the antisense constructs were found to have similar efficacy when tested in mammalian cells (Arndt et al., 2000). Together these findings indicate that in silico, in vitro, cell-free, or in vivo screens should be employed for identifying the most effective antisense RNAs before trying to achieve targeted gene silencing in vivo.
1.6.2
R N A binding proteins
RNA structure, annealing dynamics, and stability are dependent on RNA-binding proteins (Pontius, 1993; Sczakiel, 1997). Additionally, there are many proteins that bind to duplexed RNA which may affect antisense RNA-mediated gene inhibition, including ADAR, PKR, RNA helicases, and RNase III (Fierro-Monti and Mathews, 2000) (Section 1.3.3). Several cellular proteins have been identified as facilitators of RNA duplex formation (Bertrand and Rossi, 1994). These include the ribonucleoprotein (RNP) A1 (Pontius and Berg, 1990; Munroe and Dong, 1992; Portman and Dreyfuss, 1994), the tumour suppressor protein p53 (Wu et al., 1995; Nedbal et al., 1997), the yeast initiation factor TifIII (Altmann et al., 1995), and the RNPs C1 and U (Portman and Dreyfuss, 1994). In addition, RNA binding proteins have been found which enhance ribozyme annealing and cleavage, such as the 29
Chapter 1
Introduction
HIV-1 NC protein (Tsuchihashi et al., 1993), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Sioud and Jespersen, 1996). These RNA binding proteins may act to facilitate RNA hybridisation through various mechanisms. For example, it has been suggested that the RNP A1 protein, and some other simple cationic detergents, act by increasing the annealing rate of the RNAs through the presentation of relatively unstructured polymeric domains (Pontius, 1993). An alternative mechanism for increasing RNA annealing is exemplified by the HIV-1 NC protein. This protein is thought to act as an RNA chaperon whereby it facilitates an RNA conformation which favours the generation of an RNA duplex (Herschlag et al., 1994). On the other hand, the p53 protein may act by stabilising intermolecular dsRNAs (Nedbal et al., 1997). RNA helicases are from the DEAD-box family of proteins and have roles in transcription, pre-mRNA splicing, RNA maturation, RNA transport, translation, and RNA degradation (de la Cruz et al., 1999). It is likely that unwinding of RNA duplexes also affects PTGS. This could result in inhibition of the antisense effect by resolving dsRNA, or it is conceivable that such helicases could enhance gene silencing if an RNAi-like mechanism was active (Section 1.5.2). For example, unwinding of dsRNA would be required in conjunction with an RNA-dependent RNA polymerase during amplification of dsRNAs (Bass, 2000). In bacteria, the endoribonuclease, RNase III, is responsible for the degradation of dsRNAs (Krinke and Wulff, 1990). Although it is not clear what kind of ribonucleases may be active in antisense RNA-mediated gene silencing, there are homologues of RNase III present in several eukaryotic organisms including S. pombe (Xu et al., 1990). A dsRNase has also been characterised in Dictyostelium (Nellen and Lichtenstein, 1993) and ribonuclease activity has recently been identified in RNAi cell-free assays (Section 1.5.2) (Tuschl et al., 1999; Hammond et al., 2000) further suggesting that its activity is central to PTGS. Clearly, the availability of such RNA binding proteins, or the sub-cellular compartmentalisation of these factors, could dramatically affect the annealing of antisense and sense RNA, and the stability and/or degradation of dsRNAs, thereby influencing the efficacy of gene silencing.
30
Chapter 1
1.6.3
Introduction
A ntisense R N A stability
The stability of antisense RNA transcripts is partly determined by RNA-binding proteins (Pontius, 1993; Sczakiel, 1997). Since stable transcripts have an increased probability of encountering their complementary substrate they are consequently more effective at inhibiting target gene expression. It is also clear that the sequence of an RNA can affect its stability. For example, sequences in the 3’ UTR have been shown to affect the decay rate of mRNAs (Ross, 1996). This can be due to degradation signals present in the RNA sequence, or RNA-binding proteins which recognize specific sequences in the transcript. In prokaryotes bulges in the 3’ stem-loop of the Cop A antisense RNA render it susceptible to RNase III cleavage (Hjalt and Wagner, 1995), while RNA-OUT is stabilised by a stem domain (Case et al., 1989). An illustration of the importance of antisense RNA stability in eukaryotes was demonstrated by Kim and Wold (Kim and Wold, 1985). They showed that removing certain sequences from an antisense TK gene reduced the stability of the TK antisense RNA and consequently decreased the efficacy of TK inhibition. A general approach which has been employed for enhancing antisense stability has been to engineer the antisense sequence as part of a chimeric transcript (Kim and Wold, 1985; Sun et al., 1994). Again, this can increase the antisense RNA steady-state level often resulting in greater inhibition of the target gene.
1.6.4
C ellular m etabolism
A hand-full of reports have addressed the effects of temporal expression of antisense RNA and the rate of cellular metabolism on the efficacy of antisense RNA-mediated gene suppression. The yeast S. cerevisiae has been refractory to antisense RNA-based technology (Atkins et al., 1994) while ribozyme activity had only been reported when it was positioned in cis with the target gene (Egli and Braus, 1994; Ferbeyre et al., 1995). The structural similarities of the hammerhead ribozyme and spliceosomal RNAs were suggested to be a reason for this lack of ribozyme activity in yeast (Castanotto et al., 1998). However, by arresting yeast cultures in the G1 phase of the cell cycle it was shown that ribozymes were able to cleave approximately 50% of the ADE1 target gene in trans (Ferbeyre et al., 1996). No antisense effect was observed in the mutant ribozyme control. This suggested 31
Chapter 1
Introduction
that the cellular metabolism of the budding yeast is simply too rapid for effective ribozyme activity. An extension of this work was shown by the same group when they employed an E. coli model system (Chen et al., 1997). Ribozyme and antisense activity was examined when the rate of transcription was increased or when translation was slowed. Neither antisense or ribozyme-mediated gene inhibition was seen in wild type cells, nor was inhibition observed when the rate of transcription was increased. In contrast, when translation was slowed both antisense and ribozyme RNAs efficiently inhibited target gene activity. It was therefore suggested that ribosomes can interfere with RNA duplex formation in the wild type E. coli. This also illustrates how such parameters can affect antisense RNA-based technology in vivo. The naturally-occurring PSV-A antisense RNA has been shown to control the constitutively expressed PSV-A transcript during development of the slime mold Dictyostellium discoideum (Hildebrandt and Nellen, 1992). This antisense effect was found to be regulated during the developmental cycle (Sadiq et al., 1994). At certain stages of Dictyostelium development the complementary RNAs no longer interacted thereby abolishing PSV-A regulation. It is possible that this inhibition of antisense RNA-mediated gene silencing is due to the presence of developmentally regulated proteins, such as those described in Section 1.6.2, which act on the complementary transcripts or RNA duplex at certain stages of the developmental cycle.
1.6.5
A ntisense dose and position effects
Even from the pioneering studies using microinjected antisense RNA it was clear that an excess of antisense over target RNA was more effective at inhibiting protein synthesis (Harland and Weintraub, 1985; Melton, 1985). Often there is a correlation between the intracellular dose of antisense RNA and target gene inhibition. For example, Kim and Wold (1985) altered the intracellular dose of an antisense TK-dihydrofolate reductase (DHFR) chimera by increasing the dose of methotrexate in the cell culture. Higher concentrations of methotrexate resulted in a higher steady-state level of the chimeric antisense RNA and consequently enhanced TK inhibition. Similarly, strong promoters are often employed in antisense genes to ensure an increased ratio of antisense over target RNA. For instance, the 32
Chapter 1
Introduction
U6 promoter has been employed to drive expression of HIV-1 therapeutic constructs in human cells (Good et al., 1997). The U6 gene has a very high level of expression and the U6 snRNA is localised to the nucleus which could have advantages for co-localisation with target transcripts (Section 1.6.6). When antisense genes are stably integrated into the host genome variable levels of RNA expression are observed (Qian et al., 1988; Van der Krol et al., 1990). This is due to the influence of the surrounding chromosomal architecture on transgene expression and is known as “position effect” (PE). Two types of PE exist in eukaryotes; stable PE and position effect variegation (PEV) (Henikoff, 1992). These epigenetic effects can impact on either the rate of gene transcription or the probability of the promoter achieving and maintaining an active state (Henikoff, 1992). PE can frequently be due to promoter occlusion or polymerase interference from surrounding transcriptional units. The degree to which a gene is affected has also been shown to be independent of the type of gene which is placed at a particular locus (Siegal and Hartl, 1998). Studies of mammalian clonal cell lines have revealed variations in the steady-state level of transduced genes. For example, PCR quantitation of the number of neo positive clones is often much higher than the number of G418-resistant colonies, suggesting that not all of the clones are expressing the transgene (Neff et al., 1997). Transgenes such as lacZ have also been used as probes to determine the most active chomosomal domains (Allen et al., 1988). To overcome potential PE and possible transgene silencing, transgenes have been engineered to contain sequences such as the β-globin locus control region (LCR) (Milot et al., 1996). It is thought that these sequences can shelter the transgene from PE by opening the chomatin structure to allow formation of the transcriptional machinery. Other sequences such as matrix attachment regions, enhancing elements, and chomatin insulators have also been investigated for their ability to facilitate position-independent transgene expression. Such approaches may overcome the associated problems of PE when targeting genes with antisense RNA technologies. PEV has also been previously reported in fission yeast (Allshire et al., 1994; Nimmo et al., 1994). PEV results from a transgene being placed close to heterochomatic regions such as centromeres or telomeres. For example, placement of the ade6 gene (which generates a red-colour phenotype) close to fission yeast centromeres resulted in colonies 33
Chapter 1
Introduction
exhibiting red and white sectoring showing the instability of transgene expression (Allshire et al., 1994). In this scenario it is hypothesised that the spread of heterochomatin into the adjacent transgene results in the variegated level of clonal transgene expression. It is often necessary to screen for clones to identify those which exhibit the highest steady-state level of antisense RNA because some clones may show little or no transgene expression. Alternatively, pooled populations are examined which will demonstrate an average level of total antisense RNA expression (Sarver et al., 1990; Sun et al., 1995). The copy number of stably-expressed antisense genes has also been shown to correlate with the steady-state level of antisense RNA, which in turn, correlates with the degree of target gene silencing (Heinrich et al., 1995). However, epigenetic silencing of multiple copy transgenes has also been demonstrated (Garrick et al., 1998).
1.6.6
C o-localisation ofcom plem entary R N A s
The co-localisation of complementary transcripts within the cell is the primary requirement for antisense RNA-mediated gene silencing. The ability of RNAs to encounter each other within the cellular millieu may be determined by a number of factors including i) the relative position of antisense and target genes, ii) the asymmetrical localisation of RNA transcripts, and iii) the sequestering of transcripts in sub-cellular compartments (Arndt and Rank, 1997). It is clear that the nucleus is functionally organized and that the cellular architecture is highly ordered (Bridger and Bickmore, 1998; Lamond and Earnshaw, 1998). Genomic sequences reside in specific territories within the nucleus (Kurz et al., 1996; Marshall et al., 1996) while genes may be “gated” to specific nuclear pore complexes (NPCs) creating nucleocytoplasmic sectoring of mRNAs (Blobel, 1985). Figure 1.4 shows a model of the mammalian interphase nucleus. Several structural entities exist including integral membrane proteins which may have a role in the defined positioning of chomosomes within the nucleus. Fluorescent in situ hybridisation studies have demonstrated the presence of distinct subnuclear compartments where RNA processing occurs including splicing “speckles” [Figure 1.4; (Singer and Green, 1997; Misteli and Spector, 1998)]. Additionally, it has been shown that RNA can be transported to the cytoplasm via specific “tracks” 34
Chapter 1
Introduction
(Lawrence et al., 1989; Rosbash and Singer, 1993). Femino and colleagues (1998) have recently visualised the movement of single RNA transcripts in situ showing the track-like distribution of nascently transcribed molecules. There are also many examples of RNAs which localise to specific cellular compartments in a variety of organisms including Drosophila, Xenopus, ascidians, echinoderms, zebrafish, yeast, and mammals (Bashirullah et al., 1998). Such localisation is usually determined by sequences found in the 3’ UTR (St Johnston, 1995). These have been termed localisation tags or “zipcodes”. Taken together, these observations indicate that the position of antisense and target genes may impact on the ability of antisense RNA to interact with complementary transcripts.
Figure 1.4 Organisation of the eukaryotic nucleus during interphase. RNA (yellow) is transcribed at particular chomosome teritories (blue) and follows specific “tracks” though the interchomosomal domain compartments to splicing speckles and then out through the nuclear pore complex into the cytoplasm. Adapted from Bridger and Bickmore, 1998. Several studies have addressed the importance of co-localising antisense and sense RNAs for enhancing gene silencing (Arndt and Rank, 1997). It was observed that direct injection of anti-HIV ribozyme constructs into the nucleus caused efficient inhibition of the target gene, while no significant gene suppression was observed when the ribozyme was introduced into the cytoplasm (Hormes et al., 1997). Several groups have employed snRNA 35
Chapter 1
Introduction
as vectors to specifically localise antisense-based genes to the nucleus, specifically in the nucleolus (Izant, 1992; Michienzi et al., 1996; Bertrand et al., 1997; Good et al., 1997). U1 snRNA has been engineered to contain a ribozyme targeted against HIV-1 Rev pre-mRNA (Michienzi et al., 1996). The splice site of this snRNA was also modified to match that of Rev in order to increase the specificity of the U1 ribozyme for the Rev precursor. This resulted in compartmentalisation of the ribozyme in the nucleus and effective inhibition of HIV. A similar approach has been taken with U6 (Good et al., 1997) and U3 (Samarsky et al., 1999) snRNA chimeras for co-localising ribozymes and target mRNA. Another approach taken to co-localise antisense and target transcripts was to insert an antisense construct into ribsosmal RNA (rRNA) (Sweeney et al., 1996). Antisense genes were inserted into sites of T. thermophila rRNA that did not interfere with its function. This system is advantageous as rRNAs are abundant, stable, and come in contact with all translated mRNAs. This strategy demonstrated efficient inhibition of all genes tested. Localisation signals have been exploited to enhance co-localisation of complementary transcripts (Sullenger and Cech, 1993; Pal et al., 1998; Lee et al., 1999). Anti-HIV ribozymes were tethered to the retroviral packaging signal thereby facilitating the interaction of ribozyme and viral gene transcripts (Sullenger and Cech, 1993; Pal et al., 1998). For example, Sullenger and Cech demonstrated 90% inhibition of an infectious virus containing a lacZ reporter using this technique (Sullenger and Cech, 1993). Alternatively, Rossi and colleagues took advantage of the β-actin localisation signal contained in the 3’ UTR (Kislauskis et al., 1994) to demonstrate that co-localisation of a ribozyme and target substrate could facilitate gene inhibition (Lee et al., 1999). When the ribozyme and substrate contained the same 3’ UTRs there was a significant increase in co-localisation and a consequent enhancement in gene silencing. Although the level of target gene inhibition is often dependent on the steady-state level of antisense RNA, a number of reports have indicated that this is not always the case (Table 1.5). Table 1.5 summarises studies where variations in the steady-state levels of antisense gene expression between clonal lines were observed. Clones showing the most effective target gene inhibition were often found to exhibit the lowest level of antisense RNA. This observation has been demonstrated widely in plants (Tabler, 1993). Additionally, there are examples where an antisense-based gene is more effective when 36
Chapter 1
Introduction
expressed at lower levels than the target (Nishikura and Murray, 1987; Sheehy et al., 1988), while it has been shown that massive over-expression of antisense genes relative to the target have failed to inhibit target gene expression (Kerr et al., 1988; Bunch and Goldstein, 1989). The reasons for this are unclear if the model of antisense action is based on interaction of stoichiometric amounts of sense and antisense RNA. These somewhat paradoxical observations have led to the speculation that the effectiveness of antisense RNA-mediated gene regulation could be influenced by the location of the antisense gene relative to the position of the target gene in the genome (coined “location effect”; (Arndt, 1993; Arndt and Rank, 1997)). The relative position of the complementary genes may affect the ability of their RNA transcripts to co-localise. Similarly, this disparity could be due to differences in the level of transport of the two RNAs. If the antisense RNA cannot access the target mRNA in the nucleus then it will have to locate it in the vast space of the cytoplasm if it is to have an effect. Alternatively, transcripts could be sequestered in different compartments by RNA binding proteins (Denhardt, 1992).
Table 1.5 Examples of antisense experiments where there is no correlation between antisense dose and target gene suppression. Organism
Target
Construct
Clones
References
D rosophila
ftz
ribozyme
4
(Zhao and Pick, 1993)
D rosophila
w hite
ribozyme
3
(Heinrich et al., 1995)
Human
env
Transdominant
6
(Bevec et al., 1994)
Human
gag
antisense
10
(Sczakiel and Pawlita, 1991)
Human
psi
ribozyme
2
(Lowenstein and Symonds, 1997)
Human
bcr-abl
ribozyme
8
(Wright et al., 1998)
plant
CHS
antisense
8
(Van der Krol et al., 1990)
plant
10kd
antisense
36
(Stockhaus et al., 1990)
The location effect hypothesis is supported by systems where the spatial coupling of antisense and ribozyme genes has resulted in efficient gene silencing (Table 1.6). This is illustrated by ribozyme studies in yeast where only those constructs placed in cis to their target were effective, while no gene silencing was observed when ribozymes were located distally to the target gene and had to function in trans (Atkins and Gerlach, 1994; Egli and Braus, 1994; Ferbeyre et al., 1995). Similar results have been demonstrated in E. coli where 37
Chapter 1
Introduction
inhibition of a lacZ gene was only achieved when the ribozyme was expressed in cis (Chuat and Galibert, 1989). This was also seen with antisense genes against micF (Aiba et al., 1987) and galK (Hasan et al., 1988) where inhibition of their respective target genes was only observed when the complementary genes were spatially coupled. Spatial coupling of a ribozyme gene with the white gene in a Drosophila model has also demonstrated enhanced gene silencing (Heinrich et al., 1995). When the ribozyme gene was not linked to the target a weaker degree of white gene inhibition was seen. A similar strategy with an antisense gene specific for the endogenous ILV2 target gene was employed in an attempt to address location effect in yeast (Arndt, 1993; Arndt and Rank, 1997). However, antisense-mediated gene silencing could not be achieved in this system.
Table 1.6 Systems where complementary genes were spatially coupled. Organism
Target
Construct
References
E.coli
lacZ
ribozyme
(Chuat and Galibert, 1989)
E.coli
m icF
antisense
(Aiba et al., 1987)
E.coli
galK
antisense
(Hasan et al., 1988)
S.cerevisiae
AD E1
ribozyme
(Ferbeyre et al., 1995)
S.cerevisiae
C AT
ribozyme
(Atkins and Gerlach, 1994)
S.cerevisiae
ILV2
antisense
(Arndt, 1993)
D rosophila
w hite
ribozyme
(Heinrich et al., 1995)
mouse
M BP
antisense
(Tosic et al., 1990)
human
H IV
ribozyme
(Dropulic and Jeang, 1994)
plant
N IV525
antisense
(Coen and Carpenter, 1988)
38
Chapter 1
1.7
Introduction
Aims of this Work
Several parameters exist which can influence the efficacy of antisense RNA-mediated gene silencing. These include co-localisation of complementary RNAs, RNA size, RNA secondary structure and hybridisation kinetics, the availability of specific RNA binding proteins, and the intracellular concentration of antisense RNA. The location effect hypothesis has been established to explain the variation in antisense RNA efficacy when antisense genes are integrated at different genomic locations independent of the intracellular dose of antisense RNA. Alternatively, the phenomenon of dsRNA-mediated gene interference has been recently described which may explain such contradictions. A cellular model is required to systematically address the influence of these parameters. Such a genetic system is the recently described lacZ fission yeast model (Arndt et al., 1995; Arndt et al., 2000). Schizosaccharomyces pombe has been shown to be amenable to antisense regulation while its similar RNA biology to mammalian organisms makes it ideal for studying antisense mechanisms in vivo. The major aims of this thesis were to use the lacZ fission yeast model to i) investigate the influence of antisense gene location on target gene silencing, ii) test the role of dsRNA in antisense RNA-mediated gene inhibition, and iii) screen for host-encoded factors which affect the efficacy of antisense RNA-mediated gene silencing in vivo. More specifically, the influence of antisense gene location was tested by: i) integrating a single copy antisense lacZ gene into various genomic locations of a fission yeast strain which contained the target gene in a fixed position (Chapter 3), ii) integrating the antisense gene at the same locus as the target gene (Chapter 4), iii) generating an overlapping lacZ locus where the antisense and sense genes were convergently transcribed (Chapter 4), iv) generating a diploid strain where the antisense and target genes were alleles of the same locus (Chapter 4). The influence of dsRNA was tested by: i) expressing additional sense lacZ RNA in an antisense-expressing lacZ strain (Chapter 5), ii) expressing a lacZ panhandle RNA in a lacZ strain (Chapter 5), and 39
Chapter 1
Introduction
iii) over-expressing an RNA helicase gene in an antisense-expressing strain (Chapter 5). To screen for host-encoded factors which enhance gene silencing, a fission yeast cDNA library was over-expressed in antisense lacZ strains, and resident plasmids were characterised (Chapter 6).
40
Chapter 2
Materials and Methods
CHAPTER 2 MATERIALS AND METHODS
2.1
Materials
Table 2.1 lists the materials used in this study and their sources. Water used was of at least reverse osmosis quality (dH2O). Solutions were sterilised by autoclaving at 120°C for 20 min or by filtration through a cellulose acetate filter (0.2 µm).
Table 2.1 Source of Materials. Material
Source
City
Acetic acid
BDH Laboratory Supplies
Dorset, UK
Agarose
Bio Rad Laboratories
Hercules, CA, USA
Alkaline phosphatase
Roche Molecular Biosciences
Mannheim, Germany
Ammonium chloride
BDH Laboratory Supplies
Dorset, UK
Am pliTaq DNA Polymerase
Perkin Elmer Biosystems
Foster City, CA, USA
Bacto agar
Bacto Laboratories Pty. Ltd.
Liverpool, NSW, Australia
Biotin
Sigma Aldrich
St Louis, MO, USA
Boric acid
Amresco Inc.
Solon, MO, USA
BSA (Bovine serum albumin)
New England Biolabs Inc.
Beverly, MA, USA
Bromophenol blue
Sigma Aldrich
St Louis, MO, USA
1-Butanol
BDH Laboratory Supplies
Dorset, UK
Calcium chloride
BDH Laboratory Supplies
Dorset, UK
Caesium chloride
Roche Molecular Biosciences
Mannheim, Germany
Citric acid
Sigma Aldrich
St Louis, MO, USA
Cupric sulphate
Sigma Aldrich
St Louis, MO, USA
DAPI (4’ 6-diamidino-2-
Sigma Aldrich
St Louis, MO, USA
DEPC (Diethylpyrocarbonate)
Sigma Aldrich
St Louis, MO, USA
DNA mass ladder
Gibco BRL
Grand Island, NY, USA
EDTA (Ethylenediaminetetraacetic
BDH Laboratory Supplies
Dorset, UK
phenylindole)
41
Chapter 2
Materials and Methods
acid) Ethanol absolute
BDH Laboratory Supplies
Dorset, UK
Ethidium bromide
Sigma Aldrich
St Louis, MO, USA
Express Hyb
Clontech Laboratories Inc.
Palo Alto, CA, USA
Ferric chloride
Sigma Aldrich
St Louis, MO, USA
Formaldehyde
BDH Laboratory Supplies
Dorset, UK
Formamide
BDH Laboratory Supplies
Dorset, UK
Glucose
BDH Laboratory Supplies
Dorset, UK
Glusulase
Dupont
Wilmington, DE, USA
Glycergel
Dako Corporation
Carpenteria, CA, USA
Glycerol
BDH Laboratory Supplies
Dorset, UK
Glycogen carrier
Roche Molecular Biosciences
Mannheim, Germany
Hydrochloric acid
BDH Laboratory Supplies
Dorset, UK
Inositol
Sigma Aldrich
St Louis, MO, USA
IPTG (isopropyl-β-D-
Roche Molecular Biosciences
Mannheim, Germany
Iso-amyl alcohol
BDH Laboratory Supplies
Dorset, UK
Iso-propanol
BDH Laboratory Supplies
Dorset, UK
Klenow fragment
New England Biolabs Inc.
Beverly, MA, USA
Lambda/H indIII
Roche Molecular Biosciences
Mannheim, Germany
Lithium chloride
Roche Molecular Biosciences
Mannheim, Germany
Magnesium chloride
BDH Laboratory Supplies
Dorset, UK
Magnesium sulphate
BDH Laboratory Supplies
Dorset, UK
Manganese sulphate
Sigma Aldrich
St Louis, MO, USA
ME (Malt Extract)
BIO 101 Inc.
Vista, CA, USA
Molybdic acid
Sigma Aldrich
St Louis, MO, USA
MOPS (3-{N-Morpholino}
Sigma Aldrich
St Louis, MO, USA
Nicotinic acid
Sigma Aldrich
St Louis, MO, USA
ONPG (O -nitrophenyl-β-D-
Sigma Aldrich
St Louis, MO, USA
Oxoid yeast extract
Bacto Laboratories Pty. Ltd.
Liverpool, NSW, Australia
32PγdATP
GeneWorks Pty. Ltd.
Adelaide, SA, Australia
32PαdCTP
GeneWorks Pty. Ltd.
Adelaide, SA, Australia
pBR322/H aeIII
Roche Molecular Biosciences
Mannheim, Germany
thiogalactopyranoside)
propanesulphonic acid)
galactopyranoside)
42
Chapter 2
Materials and Methods
Pantothenic acid
Sigma Aldrich
St Louis, MO, USA
Pfu Turbo
Stratagene
La Jolla, CA, USA
Pharmacia Nick Column
Amersham Pharmacia Biotech
Buckinghamshire, UK
Phenol-chloroform-isoamylalcohol
Amresco Inc.
Solon, MO, USA
Phenylenediamine
Sigma Aldrich
St Louis, MO, USA
Phloxin B
Sigma Aldrich
St Louis, MO, USA
Polynucleotide kinase
New England Biolabs Inc.
Beverly, MA, USA
Potassium acetate
BDH Laboratory Supplies
Dorset, UK
Potassium chloride
BDH Laboratory Supplies
Dorset, UK
Potassium hydrogen phthalate
Sigma Aldrich
St Louis, MO, USA
Potassium iodide
BDH Laboratory Supplies
Dorset, UK
Proteinase K
Roche Molecular Biosciences
Mannheim, Germany
pUC19/H paII
GeneWorks Pty. Ltd.
Adelaide, SA, Australia
RNA Ladder (0.24-9.5 Kb)
Gibco BRL
Grand Island, NY, USA
RNase free DNase 1
Promega
Madison, WN, USA
rRNasin
Promega
Madison, WN, USA
Sephadex G50-80
Sigma Aldrich
St Louis, MO, USA
Sodium acetate
BDH Laboratory Supplies
Dorset, UK
Sodium chloride
BDH Laboratory Supplies
Dorset, UK
SDS (Sodium dodecyl sulphate)
BDH Laboratory Supplies
Dorset, UK
di-Sodium hydrogen
BDH Laboratory Supplies
Dorset, UK
Sodium hydroxide
BDH Laboratory Supplies
Dorset, UK
Sodium phosphate
BDH Laboratory Supplies
Dorset, UK
Sodium sulphate
BDH Laboratory Supplies
Dorset, UK
Sorbitol
BDH Laboratory Supplies
Dorset, UK
SPP-1 DNA/Eco RI
GeneWorks Pty. Ltd.
Adelaide, SA, Australia
T4 DNA ligase
New England Biolabs Inc.
Beverly, MA, USA
Tris
BDH Laboratory Supplies
Dorset, UK
Triton X-100
Sigma Aldrich
St Louis, MO, USA
tRNA carrier
Sigma Aldrich
St Louis, MO, USA
X-gal (5-bromo-4-chloro-3-indoyl-β-
Sigma Aldrich
St Louis, MO, USA
Zinc sulphate
Sigma Aldrich
St Louis, MO, USA
Zymolyase-20T
Sigma Aldrich
St Louis, MO, USA
orthophosphate anhydrous
D-galactoside)
43
Chapter 2
Materials and Methods
2.2
Fission Yeast Strains and Culture
2.2.1
Fission YeastStrains
The fission yeast strains used in this study are listed in Table 2.1. Yeast cultures were grown at 30°C with rotation (200 rpm), and stored by resuspending in a total of 15% glycerol, vortexing and freezing at -70°C. Strains were re-isolated by scraping cells from partially thawed frozen glycerol stocks, and streaking on appropriate medium.
Table 2.2 Fission yeast strains used for this study. Strain
Genotype
Sourcea
1913
h-,leu1-32
NCYC
1914
h+,leu1-32
NCYC
972
h-, wild type
NCYC
2037
h+,ura4-D 18
NCYC
1859
h-,ade6-704
NCYC
FYC11
h-,ade6-M 210
ATCC
FYC12
h-,ade6-M 216
ATCC
FYC14
h+,ade6-M 210
ATCC
FYC15
h+,ade6-M 216
ATCC
SP41
h+,ade6-704,ura4-D 18
G. Arndt
AML1
h-,ura4::adh1-c-m yc-lacZ,leu1-32
G. Arndt
RB3-2
h-,ura4::adh1-lacZ,leu1-32
G. Arndt
a
2.2.2
NCYC: National Collection of Yeast Cultures; ATCC: American Type Culture Collection.
M edia
The media employed to support fission yeast cell growth were prepared according to Moreno et al. (1991). Edinburgh minimal medium (EMM) was used for selective vegetative growth (Table 2.2). Supplements were added as required (225 mg/L adenine, 44
Chapter 2
Materials and Methods
leucine, and/or uracil). Malt extract (ME) was used for conjugation and sporulation. It contained 3% (w/v) Bacto-malt extract. YES (yeast extract + supplements) was used for vegetative growth and contained 0.5% (w/v) Oxoid yeast extract, 3.0% (w/v) dextrose, and 225 mg/L adenine, leucine, uracil, histidine, and lysine. Solid media was made by adding 2% (w/v) Bacto agar. Repression of nmt1 transcription was achieved by the addition of thiamine to EMM media at a final concentration of 4 µM (Moreno et al., 1991).
Table 2.3 EMM Amount
Reagent
Final concentration
3 g/L
potassium hydrogen phthallate
(14.7mM)
2.2 g/L
Na2HPO4
(15.5 mM)
5 g/L
NH4Cl
(93.5 mM)
2% (w/v)
glucose
(111 mM)
20 ml/L
salts (50X stock) Table 2.3
1 ml/L
vitamins (1000X stock) Table 2.4
0.1 ml/L
minerals (10,000X stock) Table 2.5
Table 2.4 50X Salts Amount
Reagent
Final concentration
52.5 g/L
MgCl2.6H20
(0.26 M)
0.735 g/L
CaCl2.2H20
(4.99 mM)
50 g/L
KCl
(0.67 M)
2 g/L
Na2SO4
(14.l mM)
Amount
Reagent
Final concentration
1 g/L
pantothenic acid
(4.20 mM)
10 g/L
nicotinic acid
(8l.2 mM)
10 g/L
inositol
(55.5 mM)
10 mg/L
biotin
(40.8 µM)
Table 2.5 1000X Vitamins
45
Chapter 2
Materials and Methods
Table 2.6 10,000X Minerals Amount
Reagent
Final concentration
5 g/L
boric acid
(80.9 mM)
4 g/L
MnSO4
(23.7 mM)
4 g/L
ZnSO4.7H2O
(13.9 mM)
2 g/L
FeCl2.6H2O
(7.40 mM)
0.4 g/L
molybdic acid
(2.47 mM)
1 g/L
KI
(6.02 mM)
0.4 g/L
CuSO4.5H2O
(1.60 mM)
10 g/L
citric acid
(47.6 mM)
2.2.3
G enetic crosses
Strains were streaked on YES and grown at 30°C for 3 days. Single colonies of opposite mating type were mixed on nitrogen deficient medium (ME) and incubated at room temperature for 2 to 3 days. The presence of ascii was checked by light microscopy and, if present, random spore analysis was performed. A loopful of cells was inoculated into 5 ml water, vortexed, and glusulase was added to a final concentration of 0.05%. Cells were then incubated for approximately 7 h at 37°C with rotation. Spores were counted with a haemocytometer and plated on selective EMM medium at a density of approximately 300 colony forming units (CFU) per plate. A PCR protocol was used to rapidly identify the mating type of selected strains (Sunnerhagen, 1993) (Section 2.7.2).
2.2.4
D iploid construction
The fission yeast life cycle is illustrated in Figure 2.1. S. pombe normally grows in the haploid state, however, under certain growth conditions strains of opposite mating type will conjugate and then either undergo meiosis or be maintained as diploids (Munz et al., 1989). Diploids were generated using the ade6-M210/ade6-M216 interallelic complementation system (Moreno et al., 1991). Strains of opposite mating type, one of which contained the ade6-M10 mutant allele and the other the ade6-M216 mutant allele, were crossed on ME media and then “rescued” from sporulation by transferring cells to selective medium containing nitrogen (EMM). This medium also contained 5 mg/L phloxin B for checking 46
Chapter 2
Materials and Methods
ploidy. The ade6-M210/ade6-M216 mutant alleles complement each other to generate a diploid cell prototrophic for adenine. Haploid strains containing either of these alleles will not survive in selective medium.
Fig. 2.1 The fission yeast life cycle. The left side of the diagram (bold lines) represents the normal haploid life cycle. The right side (thin lines) illustrates the events which occur when zygotes develop into diploid cells. From, Munz et al.1989.
2.2.5
Fluorescentm icroscopy
Cells were grown to mid-logarithmic phase in liquid culture. One ml cells were centrifuged at 300 g for 4 min and resuspended in approximately 50 µl water. 5 µl cells were dispensed onto a slide and spread to obtain a cell monolayer. Cells were air-dried and 5 µl of 1X DAPI solution (1 µg/ml DAPI, 1 mg/ml p-phenylenediamine antifade, 50% v/v glycerol) added before applying a cover slip. Nail varnish was used to seal the sample. Cells were viewed using a Nikon fluorescent microscope with ultra violet filters.
47
Chapter 2
2.2.6
Materials and Methods
Yeasttransform ation
Yeast cells were transformed by electropration as previously described (Prentice, 1992). Cultures were grown to mid-logarithmic phase (~ 1 x 107 cells/ml) and washed three times in ice-cold 1.2 M sorbitol. Cells were centrifuged between washes at 300 g for 5 min at 4°C, resuspended to 1 x 109 cells/ml, and 200 µl were added to 5 µg DNA in a 0.2 cm gap cuvette (Biorad). Cells were electroporated at 25 µF, 200 ohms, and 2.25 kv in an electroporator (Biorad), immediately plated onto appropriate selective media and grown at 30°C for 3 to 7 days.
2.2.7
Selection ofstable integrants
Yeast plasmids were integrated into fission yeast strains in single copy by using the sup35/ade6-704 complementation system (Carr et al., 1989). The ade6-704 allele is a nonsense mutation of the ade6 gene (Hawthorne and Leupold, 1974) which generates a red phenotype when grown in limiting amounts of adenine (10 µg/ml). The sup3-5 gene can suppress this phenotype (Hottinger et al., 1982), however, if present in more than one copy it also has a deleterious effect on protein synthesis, while a single copy is still able to generate a cell which is prototrophic for adenine. Therefore, following transformation, stable integration of a single copy of the sup3-5 gene can be identified by screening for fast growing white colonies. Transformants were initially plated on selective medium and then grown in non-selective medium for approximately 20 generations to remove episomal plasmids before being replica-plated onto selective medium. Stable integration was then confirmed by Southern analysis (Section 2.9). Targeted integration at the ura4 locus was performed as previously described (Grimm et al., 1988). Plasmids containing cassettes flanked by the 1.8 kb BamHI-EcoRI ura4 DNA fragment were electroporated into target strains and transformants were plated on selective medium containing 1 mg/ml 5-fluoro-orotic acid (FOA). Resistance to this toxic analogue is conferred only if the ura4 gene is not expressing its encoded product.
48
Chapter 2
Materials and Methods
β-galactosidase assays
2.2.8
A semi-quantitative overlay assay was employed for rapid screening of yeast transformants (Arndt et al., 2000). Transformants were grown to mid-logarithmic phase, plated on EMM solid media and grown at 30°C for 3 days. Colonies were overlaid with medium containing 0.5 M sodium phosphate, 0.5% agarose, 2% dimethylformamide, 0.01 % SDS, and 500 µg/ml X-gal (Progen, Australia). Plates were incubated at 37°C for 10 min to 3 h, and visualised. β−galactosidase activity was quantified by a modified version of the cell permeabilisation assay described by Kippert (1995). Cells were grown in selective media to mid-logarithmic phase and resuspended in 1 ml Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4) containing 0.1% sarcosyl and 1.54% n-propanol. To each sample 200 µl Z buffer containing o-nitrophenyl-β-D-galactopyranoside (ONPG) (4 mg/ml) was added, briefly mixed and incubated at 30˚C for 45 min. The reaction was terminated by adding 500 µl of 1 M Na 2CO3. The samples were centrifuged at 1000 g for 5 min and the absorbance of the supernatant was read at 420 nm. β−galactosidase units were calculated according to Ausubel et al. (Ausubel et al., 1987) and normalised for cell number: Units = [OD420/(OD595 x volume x time] x 1000. In most cases, units were then converted to a percent of the control strain. Error bars represent standard deviations in all histograms thoughout this thesis.
2.3
Bacterial Strains and Culture
2.3.1
B acterialstrains
Various Eschericia coli strains were used to propagate plasmids in this study and these are listed in Table 2.7. E. coli cells were grown in liquid Luria-Bertani (LB) medium (1% Bacto-tryptone, 0.5% Bacto-yeast extract, and 0.5% NaCl) containing antibiotic at 50 µg/ml (if required) at 37°C with rotation (200 rpm). Cultures were frozen in a total of 15% (v/v) glycerol at -70°C. Strains were revived by partially thawing frozen cells and streaking
49
Chapter 2
Materials and Methods
on appropriate medium. Solid LB plates were prepared by including 1.5% Bacto-agar in LB medium.
Table 2.7 Bacterial strains used in this study. Strain
Genotype
Source
DH5α
deoR ,endA1,gyrA96,hsdR 17(rk-m k+),recA1,relA1,supE44,thi-
Gibco/BRL
1,∆(lacZYA-argFV169),phi-80∆lacZ∆M 15,F-,lam bdaDH10B
F-,m crA ∆ (m rr-hsdR M S-m crBC )f80∆lacZD M 15 ∆lacX74 deoR
Gibco/BRL
recA1 endA1 araD 139 ∆ (ara,leu)7697 galU galK lam bda-,rpsL nupG SURE
e14-(M crA-)∆ (m crC B-hsdSM R -m rr)171 endA1 supE44 thi-1
Stratagene
gyrA96 relA1 lac recB recJ sbcC um u::Tn5 (Kanr)uvrC [F’proAB laclqZD (M 15 Tn10 (Tetr)]
2.3.2
B acterialand yeastplasm ids
The bacterial and yeast plasmids used and generated in this study are listed in Table 2.8. The plasmids contained either ampicillin (amp) or kanamycin (kan) resistance markers, and an E. coli origin of replication (ori). Yeast episomal plasmids also contained an autonomous replicating sequence (ars).
Table 2.8 Bacterial and yeast plasmids used in this study. Plasmid
Comments
Source/Reference
pBGS
Cloning vector
Gibco/BRL
pCG5
ura4 KO vector
J. Kholi; (Grimm et al., 1988)
pSP72
Cloning vector
Promega
pGEM3Zf
Cloning vector
Promega
pNEB194
Cloning vector
G. Arndt; (Arndt et al., 1995)
pRIP1/s
sup3-5,LEU 2
G. Arndt; (Maundrell, 1993)
pRIP2/s
sup3-5,ura4
G. Arndt; (Maundrell, 1993)
pREP1
LEU 2,ars
G. Arndt; (Maundrell, 1993)
pREP2
ura4,ars
G. Arndt; (Maundrell, 1993)
pREP3
LEU 2,ars
G. Arndt; (Maundrell, 1993)
50
Chapter 2
Materials and Methods
pREP4
ura4,ars
G. Arndt; (Maundrell, 1993)
pADH5
pNEB194 + adh1 5'
G. Arndt
pGT2
pREP1 + long lacZ antisense
G. Arndt; (Arndt et al., 1995)
pGT23
ura4 KO vector
G. Arndt; (Arndt et al., 1995)
pGT29
nm t1 cassette in ura4 KO vector
G. Arndt
pGT59
pREP1 + short 5' lacZ antisense
G. Arndt; (Arndt et al., 1995)
pGT61
pREP1 + short 3' lacZ antisense
G. Arndt; (Arndt et al., 1995)
pGT62
pREP1 + long lacZ C laI frameshift sense
G. Arndt; (Arndt et al., 1995)
pGT118
pREP1, MCS modified
G. Arndt; (Arndt et al., 1995)
pG14-6
pRIP1/s + long lacZ antisense
This study
pH88-1
pRIP1/s + insert
This study
pI2-1
pRIP1/s + long lacZ antisense + XhoI
This study
pJ11-7
pRIP2/s + lacZ antisense
This study
pJ66-1
pGT28 + lacZ
This study
pJ66-2
pGT28 + lacZ antisense
This study
pK48-1
pGT29 + lacZ antisense
This study
pK76-1
pADH5 + nm t1-5'
This study
pK85-1
pRIP1/s + XhoI linker
This study
pL29-1
pGT10 + N otI linker
This study
pL29-17
pL29-1 + nm t1 5'-adh1 5'
This study
pL35-5
pL29-17 + lacZ (ori1)
This study
pL82-9
pL29-17 + lacZ antisense
This study
pL89-1
pRIP2/s-lacZfs
This study
pL89-5
pRIP2/s-lacZfs antisense
This study
pL90-1
pRIP2/s with sup3-5 removed
This study
pL99-1
pL90-1 + lacZfs (antisense)
This study
pL103-1
pL89-1 with sup3-5 removed
This study
pL121-14
pRIP2/s + N otI linker
This study
pM24-14
pL121-14 + lacZfs
This study
pM30-8
pRIP2/s + lacZ panhandle
This study
pM53-1
pREP4 + lacZ panhandle
This study
pM81-2
pREP4 + functional lacZ panhandle
This study
pM85-1
pREP4 + functional lacZ
This study
pM91-1
pREP4 + functional lacZ repeat
This study
pCM17
pGT118 + c-m yc antisense
G. Arndt; (Arndt et al., 2000)
pN12-1
pREP4 + c-m yc sense
This study
51
Chapter 2
Materials and Methods
pN38-1
pREP4 + functional ded1
This study
pN47-21
pREP4 + functional thi1
This study
2.3.3
B acterialtransform ation
Electrocompetent DH5α was prepared by growing cells in LB broth to mid-logarithmic phase (OD 600 of 0.5 to 0.7). Cells were gently washed in ice-cold water twice and once in 10% glycerol. Cells were centrifuged at 500 g for 15 min at 4°C between washes and finally resuspended to a concentration of 1-3 x 1010 cells/ml in 10% glycerol. Cells were aliquoted in 50 µl lots and snap frozen in liquid nitrogen. Cells were stored at -70°C for up to two months. Electrocompetent cells were thawed on ice and then 20-50 µl dispensed into a prechilled 0.2 cm gap electroporation cuvette (Biorad). DNA was added to the cells and gently mixed. Cells were electroporated at 25 µF, 200 ohms, and 2.5 kv in an electroporator (Biorad) and 1 ml LB added to transformed cells. Cells were then plated on solid LB media containing appropriate antibiotics and grown at 37°C overnight. Single colonies were inoculated into liquid medium for plasmid DNA isolation (Section 2.5).
2.4
Yeast Nucleic Acid Isolation
2.4.1
YeasttotalD N A large preparation
Large-scale DNA preparations were performed as previously described (Moreno et al., 1991). Yeast cells were grown in 100 ml of appropriate medium to late stationary phase (OD595 of 2-3), centrifuged at 300 g for 5 min, and resuspended in 5 ml of buffer A (50 mM citrate/phosphate pH 5.6 [7.1 g/L Na2HPO4, 11.5 g/L citric acid], 40 mM EDTA pH 8.0, 1.2M sorbitol). To each sample, 15 mg Zymolyase-20T was added and incubated at 37°C for 30 min. To ensure cell wall digestion was complete, 1 µl 10% SDS was added to 10 µl of sample and visualised by phase-contrast microsopy. Once digestion was complete cells were pelleted and resuspended in 15 ml 5X TE (50 mM Tris-HCl pH 6.5, 5 mM EDTA). A volume of 1.5 ml 10% SDS was added and mixed. Five ml of 5 M potassium acetate was 52
Chapter 2
Materials and Methods
then added and the suspension was incubated on ice for 30 min. The sample was centrifuged at 500 g for 15 min and filtered though gauze. Following this, 20 ml ice-cold isopropanol was added to the DNA and incubated at -20°C for 5 min. Following centrifugation at 1,100g for 10 min, the DNA pellet was dried, resuspended in 3 ml 5X TE with RNAse (20 µg/ml), and incubated at 37 °C for 2 h. The sample was then extracted with 3 ml phenol-chloroform (1:1) in a 15 ml corex tube and centrifuged at 1,100 g for 10 min. The aqueous layer was transferred to a new tube and 0.3 ml of 3 M sodium acetate and 7.5 ml 100% ethanol was added, mixed, and incubated at -20°C for 1-5 h. The precipitated DNA was centrifuged at 1,100 g for 10 min and washed with 5 ml 70% ethanol. The pelleted DNA was vacuum-dried and resuspended in 200-1000 µl TE. DNA concentration was quantified by reading the OD260 and OD280 absorbances in a UV-visible spectrophotometer (Shimadzu).
2.4.2
YeasttotalD N A m inipreparation
Small-scale DNA preparations were performed as previously described (Hoffman and Winston, 1987). Yeast cells were grown in 10-50 ml of appropriate medium to late stationary phase (OD595 of 2-3), centrifuged at 300 g for 5 min, and resuspended in 200 µl of DNA extraction buffer (2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris-HCl pH8.0, 1 mM EDTA) in a 1.5 ml microfuge tube. To each sample, 0.3 g of acid-washed glass beads and an equal volume of phenol-chloroform-isoamylalcohol (25 : 24 : 1) were added. Samples were then vortexed for 2 min if plasmids were being recovered or 4 min for genomic DNA isolation. Samples were microfuged at 1,600 g for 5 min and the aqueous phase transferred to a new tube. Two volumes of 100% ethanol was added and samples were incubated at -70°C for 20 min. Samples were microfuged at 1,600 g for 5 min, pellets vacuum-dried, and resuspended in 400 µl TE plus 3 µl of RNase A (10 mg / ml). Samples were incubated at 37°C for 10 min and then 10 µl 4 M ammonium acetate and 1 ml 100% ethanol were added and DNA precipitated at -70°C for 20 min. Following centrifugation at 1,600 g for 10 min, DNA was vacuum-dried and resuspend in 50 µl TE. If episomal plasmids were being recovered, DNA was used for E. coli transformation prior to RNase addition. 53
Chapter 2
2.4.3
Materials and Methods
YeasttotalR N A preparation
A 10 to 50 ml yeast culture was grown to mid-logarithmic phase, centrifuged at 300 g for 5 min at 4°C, and cell pellets resuspended in 300 µl LETS buffer (0.1 M LiCl, 0.01 M EDTA, 0.01 M Tris-HCl pH 7.5, 0.2% SDS). Samples could be stored at -70°C at this stage. An equal volume of acid-washed glass beads were added and the sample vortexed for 2 min. Samples were kept ice-cold for the duration of processing. An equal volume of LETS-equilibrated phenol was added and samples microfuged at 1,600 g for 5 min at 4°C. Supernatant was recovered and extracted with an equal volume of phenol-chloroformisoamylalcohol (25 : 24: 1). Supernatant (approximately 400 µl) was transferred to a new tube and 8 µl 10 M LiCl and 2.5 ml 100% ethanol was added to the sample. RNA was precipitated at -70°C for 1 h. RNA was then pelleted by microfuging at 1,600 g for 10 min at 4°C, vacuum-dried, and resuspended in 300 µl water. RNA samples were washed by adding 6 µl 10 M LiCl and 750 µl 100% ethanol, precipitating at -70 °C for 1 h, and microfuging at 1,600 g for 10 min at 4°C. RNA was vacuum-dried and resuspended in 40 µl water.
2.5
Bacterial Nucleic Acid Isolation
2.5.1
B acterialD N A large preparation
The caesium chloride density gradient procedure was performed for isolating pure plasmid DNA with high yield (Sambrook et al., 1989). Cells were grown to saturation in 500 ml LB medium containing appropriate antibiotic. Cells were centrifuged at 400 g for 5 min, resuspended in 16 ml solution A (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM EDTA, 10 mg/ml lysozyme) and incubated on ice for 5 min. Following this, 32 ml solution B (0.2 N NaOH, 1% SDS) was added and gently mixed. After incubating on ice for 5 min, 24 ml solution C (1.8 M potassium acetate and 11.5% acetic acid) was added and gently mixed. Samples were incubated on ice for 20 min, and centrifuged at 500 g for 15 min. The
54
Chapter 2
Materials and Methods
supernatant was filtered though gauze and 2 volumes of 100% ethanol was added. The samples were precipitated at -20°C for 30 min, centrifuged at 500 g for 15 min, air-dried, and resuspended in 5 ml TE. To precipitate RNA, 1.4 g LiCl was added and samples were placed on ice for 5 min. Samples were then centrifuged at 1,000 g for 5 min, supernatant transferred to a new tube, and 2 vol 100% ethanol added, followed by incubation at -20°C for 30 min. Following this, samples were centrifuged at 2,200 g for 10 min, pellets airdried, and resuspended in 1.5 ml TE. 1.8 g CsCl and 100 µl ethidium bromide (10 mg/ml) were added and the samples were loaded into ultracentrifuge tubes (Beckman). Samples were centrifuged at 30,000 g for 24 h at 20°C to achieve gradient equilibrium. The ethidium bromide stained plasmid band was removed and butanol extracted several times. The DNA sample was diluted with 3 vol water and precipitated by adding 0.1 vol 3 M sodium acetate and 2.5 vol 100% ethanol at -20°C for 1 to 16 h. DNA was centrifuged at 2,200 g for 15 min, washed with 70% ethanol, air-dried, and resuspended in 200-1000 µl TE. DNA concentration was quantitated by reading the OD260 and OD280 absorbances.
2.5.2
B acterialD N A m inipreparation
The QIAprep Spin miniprep kit (Qiagen) was employed for small-scale plasmid DNA preparations to be used for cloning procedures as according to the manufacturer’s instructions. DNA concentration was quantitated by running a sample next to a DNA mass ladder on an agarose gel.
2.5.3
B acterialD N A quick preparation
A boiling method was employed for screening E. coli transformants as previously described (Sambrook et al., 1989). Single colonies were inoculated into 1.5 ml LB medium plus appropriate antibiotic and grown to saturation. Cells were microfuged at 1,600 g for 1 min and resuspended in 250 µl STET buffer (8% w/v sucrose, 0.5% Triton X-100, 50 mM EDTA, and 10 mM Tris-HCl pH 8.0). After this, 15 µl fresh lysozyme solution (10 mg/ml) was added and cells were vortexed for 10 min in a bench-top shaker. Samples were then boiled for 1 min, centrifuged at 1,600 g for 10 min and protein pellets removed. Half a
55
Chapter 2
Materials and Methods
volume of 7.5 M ammonium acetate and 2 vol of 100% ethanol were added, the samples mixed, and precipitated at -70°C for 1 h. Following microfugation at 1,600 g for 10 min, DNA was washed with 70% ethanol, vacuum-dried, and resuspended in 50 µl TE. When performing restriction digests 1 µl RNase A (10 mg/ml) was added to the loading buffer prior to gel electrophoresis.
2.6
Recombinant DNA Construction
2.6.1
R estriction enzym e digests
Restriction enzymes and buffers were supplied by New England Biolabs Inc., Beverly, MA, USA, and are listed in Table 2.9. Digests were performed as per the manufacturer’s instructions. Generally, when dual restriction digests were required a double-digest was performed using the recommended compatible buffer. In rare cases dual digests were carried out in a step-wise fashion with the first reaction being performed with the restriction enzyme requiring the lowest concentration of salt. Following this, reaction conditions were adjusted to favour the second restriction enzyme. Restriction digests were analysed by agarose gel electrophoresis.
Table 2.9 Restriction enzymes used in this study. Enzyme
Restriction site
Buffer a
AatII
gacgt/c
50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT pH 7.9
Bam HI
b
g/gatcc
150 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
BglII
a/gatct
100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
C laI b
at/cgat
50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT pH 7.9
D raI
ttt/aaa
50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT pH 7.9
EcoRI
g/aattc
50 mM NaCl, 100 mM Tris-HCl, 10 mM MgCl2, 0.025% Triton X-100 pH 7.5
EcoRV b
gat/atc
50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
56
Chapter 2
Materials and Methods
H indIII
a/agctt
50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
N aeI
gcc/ggc
10 mM Bis Tris Propane-HCl, 10 mM MgCl2, 1 mM DTT pH 7.0
N coI
c/catgg
50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT pH 7.9
ca/tatg
N deI
50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT pH 7.9
b
N heI
N laIII b
g/ctagc
50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
catg/
50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT pH 7.9
b
N otI
PacI b Pm eI
b
gc/ggccgc
100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
ttaat/taa
10 mM Bis Tris Propane-HCl, 10 mM MgCl2, 1 mM DTT pH 7.0
gttt/aaac
50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 1 mM DTT pH 7.9
PstI
ctgca/g
100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
PvuII
cag/ctg
50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
SacI
gagct/c
10 mM Bis Tris Propane-HCl, 10 mM MgCl2, 1 mM DTT pH 7.0
g/tcgac
150 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
/gatc
100 mM NaCl, 10 mM Bis Tris Propane-HCl, 10 mM MgCl2, 1 mM
SalI
b
Sau3AI b
DTT pH 7.0 ScaI
agt/act
100 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.4
gcatg/c
50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
XbaI
b
t/ctaga
50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
XhoI
b
c/tcgag
50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT pH 7.9
c/ccggg
10 mM Bis Tris Propane-HCl, 10 mM MgCl2, 1 mM DTT pH 7.0
SphI
Xm aI a b
2.6.2
DTT = dithiotheitol 100 µg/ml BSA supplemented
A garose gelelectrophoresis
In most cases 0.4 to 1.8% agarose gels were made and run in 0.5X TBE buffer (44.5 mM Tris, 44.5 mM boric acid, and 1 mM EDTA). Ethidium bromide (1 µg/ml) was added to the agarose gel for DNA visualisation. Molecular size standards used in this study were: HindIII digested lambda DNA which gives 23.1, 9.4, 6.6, 4.4, 2.3, 2.0, 0.56, and 0.125 kb fragments; or HpaII digested pUC19 DNA which gives 501, 489, 404, 331, 242, 190, 147, 111, 110, 67, 34, 34, and 26 bp fragments; or EcoRI digested SPP-1 DNA which gives 57
Chapter 2
Materials and Methods
8.51, 7.35, 6.11, 4.84, 3.59, 2.81, 1.95, 1.86, 1.51, 1.39, 1.16, 0.98, 0.72, 0.48, and 0.36 kb fragments. DNA samples were mixed with 0.1% bromophenol blue/glycerol and electrophoresed in appropriate buffer at 30 to 120 V for 10 to 120 min. Gels were illuminated with ultraviolet light, photographed on a gel documentation apparatus (Eagle Eye II Still Video System; Stratagene, La Jolla, Ca, USA), and visualised using the EagleSight software package (V3.2; Stratagene).
2.6.3
D N A recovery from agarose gels
For recovery of DNA fragments from agarose gels 1X TAE buffer (40 mM Tris, 20 mM acetic acid, and 2 mM EDTA pH 8.0) was employed. Two protocols were utilised: the GeneClean II kit (BIO 101 Inc.) uses glass milk technology for binding DNA from dissolved agarose, while the QIAquick gel extraction kit (QIAGEN) uses spin-column technology for DNA binding. Protocols were followed as according to the manufacturer’s instructions.
2.6.4
D N A cloning
DNA cloning was performed as previously described (Sambrook et al., 1989) . DNA ligations were generally performed using a vector to insert molar ratio of 1:3. Vector and insert DNA fragments were incubated at 16°C for 16 h with 400 U (NEB cohesive end ligation units) T4 DNA ligase in a 10 µl reaction containing 50 mM Tris-HCl (pH7.5), 10 mM MgCl2, 10 mM DTT, 1 mM ATP, and 25 µg/ml BSA. If the ends of the prepared vector DNA were complementary to each other, then the vector was treated with calf intestinal alkaline phosphatase (CIP) to remove the phosphate groups from the 5’-ends to prevent self-ligation. The digested vector was extracted first with phenol-chloroformisomaylalcohol and ethanol precipitated before resuspending in 1X CIP buffer (50 mM Tris-HCl, 0.1 mM EDTA, pH 8.0) and adding 1 to 20 U CIP. Alternatively, the digested DNA sample buffer was adjusted by adding an appropriate volume of 10X CIP buffer. Samples were incubated at 37°C for 45 min and then deactivated by phenol extraction. DNA was precipitated by adding a half vol 7.5 M ammonium acetate and 2 vol of 100% ethanol. DNA was washed with 70% ethanol, vacuum-dried, and resuspended in 10 µl 58
Chapter 2
Materials and Methods
water. The DNA concentration was checked by running an aliquot on an agarose gel next to a DNA mass standard. Digested insert was phenol-extracted, precipitated, and its concentration determined as above. In some cases it was necessary to end-fill a 5’ overhang. This was achieved by purifying digested samples with phenol extraction and ethanol precipitation, and resuspending the dried DNA in 1X Klenow buffer (10 mM Tris-HCl pH 7.5, 5 mM MgCl2, 7.5 mM DTT) 40 µM of each dNTP, 0.1 mg/ml BSA, 1-10 U Klenow polymerase, and incubating at room temperature for 10 min. The reaction was deactivated by either phenol extraction or by heating at 75°C for 10 min. Restriction sites were modified by the addition of appropriate linkers (Table 2.10). Linkers were prepared by mixing complementary oligonucleotides at an equal molar ratio, and incubating at 90°C for 10 min and allowing to cool to room temperature. These were then used in standard ligation reactions.
Table 2.10 Linkers used in this study. Primer
Sequence (5’ to 3’)
Site
XHO-NOT1
CCGGGCGGCCGC
XhoI
SXH1
CTCGAGATCATG
SphI
SXH2
ATCTCGAGCATG
SphI
2.6.5
D N A sequencing
Dideoxy sequencing (Sanger et al., 1977) was performed using a T7 Sequencing Kit (Amersham Pharmacia Biotech) according to the manufacturers instructions. Samples were run on an 8% (w/v) polyacrylamide gel and exposed to Kodak X-ray film. Alternatively, sequencing was performed by the Australian Genome Research Facility (St Lucia, QLD, Australia) with an ABI PRISM automated sequencer (PE Biosystems). Table 2.11 lists the sequencing primers used in this study.
59
Chapter 2
Materials and Methods
Table 2.11 Sequencing primers used in this study. Primer
Sequence (5’ to 3’)
Target
5NMT1A
ATCTCATTCTCACTTTCTGA
nm t1 5’
3NMT3C
CGTAATATGCAGCTTGAATG
nm t1 3'
5NMTX
GGGTGGTGGACAGGTGCCTTCGCT
nm t1 5'
5SUP3B
CACATGAACAAGGAAGTACA
sup3-5
3SUP3B
TGCCCGCGCAGGTTCAAATC
sup3-5
5SUP3C
TGATGTAATTGTTGGGATTC
XhoI insert
3SUP3C
TTGGTGTAGCGTTTTGATGA
XhoI insert
2.7
Polymerase Chain Reaction (PCR)
PCR (Saiki et al., 1988) was employed as i) a diagnostic for the presence of antisense and target lacZ DNA sequences, ii) to analyse cloned library DNA inserts, and iii) to amplify genomic flanking regions of integrated DNA.
2.7.1
Prim ers
The suitability of primers was determined by using primer analysis software (Oligo 6.51, Molecular Biology Insights Inc. Cascade, CO, USA). Primers used in this study are listed in Table 2.12. Oligonucleotides were synthesised by Sigma Genosys (Castle Hill, NSW, Australia) or Pacific Oligos (Lismore, NSW, Australia) at 200 nmol scale with reverse phase or Polyacrylamide gel purification. Some of the listed primers were also employed for DNA sequencing (Section 2.6.5).
Table 2.12 PCR primers used in this study. Primer
Sequence (5’ to 3’)
Target
5AMPA
TGGCGTTACCCAACTTAATC
am p
5SUP3A
GGTGAAAGTTCCCTCAAGAA
sup3-5
3SUP3A
AAACAACCGCTGATGACTTA
sup3-5
5SUP3B
CACATGAACAAGGAAGTACA
sup3-5
3SUP3B
TGCCCGCGCAGGTTCAAATC
sup3-5
5SUP3C
TGATGTAATTGTTGGGATTC
XhoI insert
60
Chapter 2
Materials and Methods
3SUP3C
TTGGTGTAGCGTTTTGATGA
Xho I insert
MAT2P
AAATTGTATTGGTGTTACTAACC
MAT2P
MAT3M
GTAGGTGTAGAGTGTGGAGGG
MAT3M
MAT1
AAAGAGAGTGAGAAGAAGGG
MAT1
NMT5-2
TGAAAGCTTTTATAGTCGCTTTGTTAAATCATATG
nm t1 5'
NMT5-1
TGAAAGCTTAGGAAGAGGAATCCTGGCATATCATC
pGT118
NMT3-1
TGAAAGCTTTACCCGGGGATCCTTAGTTAGTTAAG
pGT118
NMT3-2
TGAAAGCTTACTTTCTAAAAGCGAAAAACAAAATC
nm t1 3'
3NMT3A
ACTGGCAAGGGAGACATTCC
nm t1 3'
3NMT3B
AGGGAGACATTCCTTTTACC
nm t1 3'
CLA1-LACZ
AAGAGATCTCATCGATAATTTCACCGCCGAAAGGC
lacZ
PVUII-LACZ
AAGAGATCTTCAGTATCGGCGGAATTACAGCTGAG
lacZ
URA4-3EXT
AAGCTTGTGATATTGACGAAACTTT
ura4 3'
5URA4-3SAL
ACGTCGACTGAATTCTAGCGATAT
ura4 5'
3URA4-3PST
ACCTGCAGGGAAGCTTGTGATATT
ura4 3'
5NMT5-NOT1
ATGCGGCCGCTAGAGGATCAGAAAATT A
nm t1 5'
3ADH5-NOT1
ATGCGGCCGCTTCTTTTACCGATAGTAC
adh1 5'
3ADH5-NOT1B
ATGCGGCCGCGACCTAAGAAAATGGCTA
adh1 5'
5DED1-BAMHI
ATGGGATCCCAACCAAACACTTCAACTCAG
ded1
3DED1-BAMHI
ATGGGATCCTCAGAAGCCTGTGCATAACAC
ded1
5THI1-BGLII
ATGAGATCTGTGGTTGGTATTCTAGAGAGA
thi1
3THI1-BGLII
ATGAGATCTAACAAAGACCTGCAAAAAACC
thi1
5LACZ-NOTI
ATGCGGCCGCAATTCCCGGGGATCGAAAGA
lacZ
3LACZ-NOTI
ATGCGGCCGCAATGCGGGTCGCTTCACTTA
lacZ
2.7.2
PC R cycling conditions
PCR cycling parameters used in this study are listed in Table 2.13. AmpliTaq DNA Polymerase (PE Biosystems) was used for standard PCR reactions with the supplied buffer II (1X; 10 mM Tris-HCl, pH 8.3, 50 mM KCl). Optimisation of magnesium concentration and annealing temperature was usually performed for each new set of primers. For long PCR (generally for amplicons greater than 2 kb), PfuTurbo DNA Polymerase (Stratagene) was employed. The buffer (1X) used with this enzyme contained 20 mM Tris-HCl pH 8.8, 2 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, and 0.1 mg/ml nuclease-free BSA. 61
Chapter 2
Materials and Methods
Table 2.13 PCR cycling parameters used in this study. PCR/Enzyme
cycling parameters
Primers
[Mg]
antisense lacZ,
1x 94°, 3'; 30x [94°,30''; 55°, 1'; 72°, 2']; 72°, 7'
PVUII-LACZ
1.5 mM
NMT5-1
Am pliTaq target lacZ,
1x 94°, 5'; 30x [94°, 30''; 60°, 1'; 72°, 5']; 72°, 7'
ADH5
PfuTurbo
URA4 3EXT
antisense/target, 1x 94°, 3'; 30x [94°, 30''; 55°, 1'; 72°, 2']; 72°, 7'
PVUII-LACZ
Am pliTaq
NMT5-1
2.0 mM
1.5 mM
URA4 3EXT Library insert,
1x 94°, 3'; 30x [94°, 30''; 60°, 1'; 72°, 2.5']; 72°, 7'
1x 94°, 3'; 30x [94°, 30''; 55°, 1'; 72°, 4']; 72°, 7'
1x 94°, 5'; 30x [94°, 30''; 50°, 30''; 72°, 20']
1.5 mM
5AMPA
2.0 mM
NMT3-2
PfuTurbo mating type,
NMT5-1 NMT3-2
Am pliTaq LI-PCR,
2.0 mM
3SUP3B
PfuTurbo nm t1,
5SUP3B
1x 94°, 5'; 30x [94, 1'; 58°, 1' ; 72°, 1.5']
MAT1
1.5 mM
MAT2P
Am pliTaq
MAT3M
2.7.3
PC R productpurification
PCR products were purified using the QIAquick PCR purification kit (QIAGEN) according to the manufacturer’s instructions. Purified products were either employed for cloning procedures or for sequencing reactions.
2.8
Radiolabelling DNA
DNA probes for hybridisation with Northern and Southern blots were radiolabelled using both the end-labelling and random-primed labelling methods (Sambrook et al., 1989).
2.8.1
End-labelling
The 50-nt lacZ oligonucleotide (5’-GTT ACT CGC TCA CAT TTA ATG TTG ATG AAA GCT GGC TAC AGG AAG GCC AG-3’) was end-labelled by denaturing at 100°C for 5 62
Chapter 2
Materials and Methods
min and placing on ice. One µl γ-32P dATP (10 mCi/ml) was added to the probe, followed by addition of 2 µl polynucleotide kinase (PNK) buffer and 1 µl PNK (10 U). The mixture was made up to 20 µl with dH 2O and incubated at 37°C for 1 h. The enzyme was deactivated by heating to 65°C for 10 min. 80 µl TE was added and unincorporated nucleotides were removed by running the sample though a Sephadex G50 NICK column (Pharmacia) with TE. From this column, 800 µl radiolabelled DNA was collected. This DNA was used immediately or stored at -80°C.
2.8.2
R andom -Prim ed labelling
Radiolabelled probes were generated by the random-primed labelling method (Feinberg and Vogelstein, 1983) using the Mega Primed DNA Labelling Kit (Amersham) according to the manufacturer’s instructions. The probes used in this study were i) the 2 kb PstI/SacI nmt1 fragment from pRIP1/s, ii) the 960 bp BamHI/ClaI lacZ fragment from pGT2, and iii) the 570 bp HindIII/EcoRI ura4 3’ fragment from pGT5 (Arndt et al., 2000). Ten to 100 ng DNA was added to 5 µl primer solution, made up to 26 µl with water, denatured at 100°C for 5 min, and placed on ice. Four µl dATP, dGTP, dTTP mixture, 5 µl α-32P dCTP (10 mCi/ml), and 5 µl reaction mixture were added. Two µl Klenow enzyme was added, the solution mixed, and incubated at 37°C for 30 min. The reaction was stopped by extracting with phenol-chloroform-isoamylalcohol. Unincorporated α-32P dCTP was removed by loading the mixture onto a Sephadex G-50 NICK column (Pharmacia). The radiolabelled DNA was used immediately or stored at -80°C.
63
Chapter 2
Materials and Methods
2.9
DNA and RNA Analysis
2.9.1
D N A transfer to nylon m em brane
Agarose gels were prepared for DNA transfer by soaking in 300 ml 0.2 M HCl (depurinisation) for 10 min, rinsing in dH2O, soaking in 300 ml 1.5 M NaCl/0.5 M NaOH (denaturation) for 45 min and rinsing again. Gels were then neutralised by soaking once in 300 ml 1 M Tris (pH 7.4)/1.5 M NaCl, for 30 min. Hybond-N nylon membrane (Amersham), used for binding DNA, was prepared by pre-wetting with dH 2O and then soaking in 2X SSC for 10 min. DNA transfer from the gel to the nylon membrane was achieved by capillary action (Southern, 1975). After overnight transfer, the membrane was exposed to UV light for 90 s in a Stratagene-UV Stratalinker 1800, to cross-link the DNA to the membrane.
2.9.2
H ybridisation ofradiolabelled probe
Radiolabelled probe was hybridised to the nylon membrane containing the cross-linked DNA or RNA using ExpressHyb Hybridisation Solution (Clontech) following the manufacturer’s directions. The hybridisation protocol is essentially the same for DNA and RNA except for incubation temperatures. The first temperature listed was used for Southern hybridisations (60°C) while the temperature in parentheses was used for Northern hybridisations (68°C). The membrane was initially prehybridised to prevent non-specific binding of the probe to the membrane by pre-wetting in 6X SSC and placing in a bottle (300 mm x 25 mm) (Hybaid) to which 10 ml of ExpressHyb solution pre-heated to 60°C (68°C) was added. Prehybridisation was performed for at least 1 h at 60°C (68°C) in a Hybaid rotisserie oven. Radiolabelled DNA probe was boiled for 5 min and placed on ice. The probe was added to 10 ml ExpressHyb solution pre-heated to 60°C (68°C) and mixed. The prehybridisation solution was replaced with this, and the membrane was hybridised for at least 2 h at 60°C (68°C) in the rotisserie oven. 64
Chapter 2
Materials and Methods
The hybridisation solution was discarded and the membrane was transferred to a plastic container. The membrane was washed thee times with 200 ml 2X SSC/0.05% SDS for 30 min at room temperature and once with 0.1X SSC/0.1% SDS for 45 min at 50°C in a water bath. The membrane was drained of excess moisture, heat-sealed in a plastic bag, and exposed to a phosphorimaging screen (Kodak). Radiolabelled probes were removed from membranes by washing in a high-percent detergent solution (Sambrook et al., 1989). The membrane was soaked for 1 h in 400 ml 0.5 % SDS pre-heated to 100°C on an orbital shaker. Excess liquid was drained and the membrane was heat-sealed in a plastic bag. The membrane was exposed to a phosphorimaging screen overnight to check if probe removal was successful.
2.9.3
D enaturing gelelectrophoresis
RNA was separated on a 1% denaturing agarose gel. To make this gel, 2 g agarose was dissolved in 150 ml dH2O by heating in a microwave until all the agarose had gone into solution. After the solution had cooled to 70°C, 32 ml formaldehyde (12.3M) and 20 ml 10 X MOPS (0.2 M MOPS, 0.05 M sodium actetate, 0.01 M EDTA, pH 7.0) was added and the molten agarose solution was poured into a gel platform (BioRad). Electrophoresis was performed in 1X MOPS buffer with a potential difference of 4 volts/cm applied across the gel for 2-5 h. RNA samples contained 2 to 15 µg RNA in 10 µl formamide, 3.3 µl formaldehyde, 2 µl 10X MOPS and 1 µl ethidium bromide (0.5 mg/ml). Samples were heated to 65°C for 15 min and placed on ice. Two µl RNA loading buffer (1 mg/ml ethidium bromide 50% glycerol, 1 mM EDTA pH 8.0, 5 mg/ml bromophenol blue) was added and the samples were loaded onto the gel. An RNA ladder ranging in size from 0.24 to 9.5 kb (6 fragments) was included in the gel to estimate the size of the RNA transcripts. The 28S and 18S ribosomal bands acted as internal markers, having 3.5 and 1.8 kb respectively. After electrophoresis, the gel was photographed on an Eagle Eye II Still Video System (Stratagene, La Jolla, Ca, USA).
65
Chapter 2
2.9.4
Materials and Methods
R N A transfer to nylon m em brane
Hybond-N nylon membrane was pre-wet with dH2O. RNA transfer was achieved via capillary action (Southern, 1975). Transfer was allowed to proceed overnight after which the membrane was photographed and the RNA cross-linked to the membrane in a Stratalinker. The gel was examined with a UV transilluminator to confirm RNA transfer.
2.9.5
Phosphorim age analysis
Densitometry was employed to analyse the level of gene expression. After hybridisation with a radiolabelled probe (Section 2.9.2), Northern blots were exposed on a phosphorimaging screen (Molecular Dynamics) for 1 to 15 h. The resulting image was scanned on a phosphorimager (Molecular Dynamics) and analysed using the ImageQuant software package (Molecular Dynamics).
66
Chapter 3
Antisense gene location effect
CHAPTER 3 THE INFLUENCE OF ANTISENSE GENE LOCATION ON TARGET GENE SUPPRESSION Parts of this chapter have been published in Biotechniques (2000) 28:838-844 and Antisense Nucleic Acid Drug Devel. (2000) 10:29-34
3.1
Introduction
One unexplained observation of antisense RNA studies is the variation in target gene suppression observed between independent clones expressing the same antisense gene. The primary hypothesis which has been proposed to explain this involves a form of epigenetic regulation known as position effect. This is based on the influence of surrounding chomosomal DNA on the level of transgene expression (Henikoff, 1992). However, variation in antisense efficacy occasionally appears to be independent of the steady-state level of antisense RNA, thereby ruling out a simple antisense dose effect (Table 1.5). An alternative hypothesis which would account for these anomalies involves the spatial organisation of both the antisense and target genes in the nucleus. For example, it has been shown that individual genes often generate mRNA transcripts which follow discrete tracks away from the site of transcription (Femino et al., 1998), while the co-localisation of transgenes and their protein products has also been demonstrated (Gussoni et al., 1996). Additionally, individual genomic loci occupy defined positions within the nucleus which may have consequences for interactions between separate genes (Marshall et al., 1996). It has therefore been hypothesised that the relative position of an integrated antisense gene and its target gene may affect the ability of their expressed RNAs to co-localise (Denhardt, 1992; Arndt and Rank, 1997). However, to date, there have been no direct studies
67
Chapter 3
Antisense gene location effect
addressing the impact of the relative genomic location of the antisense and target genes on antisense RNA efficacy. While the budding yeast S. cerevisiae has remained recalcitrant to antisense technology (Atkins et al., 1994), the fission yeast S. pombe has been shown to be amenable to antisense RNA-mediated gene regulation (Arndt et al., 1995). Its genetic tractability and the sequencing of its genome have made it an ideal model for dissecting factors involved in efficient antisense-mediated gene silencing. Furthermore, it shares many common characteristics of RNA biology with mammalian systems including promoter function, TATA contexts, snRNA sequences, and intron junctions (Kaufer et al., 1985; Russell, 1989; Shuster and Guthie, 1990; Kaufer and Potashkin, 2000). Initially, attempts to regulate the endogenous ade6 gene by antisense and ribozyme constructs were unsuccessful (Atkins et al., 1995), however further experiments targeting the integrated E. coli lacZ gene under control of the SV40 promoter resulted in quantitative silencing of β-galactosidase activity (Arndt et al., 1995). These experiments employed constructs including the full-length antisense lacZ fragment driven by the conditional nmt1 promoter (Maundrell, 1993). Inhibition of lacZ expression was shown to be antisense RNA-dependent and reversible, while antisense sequences of different length showed different levels of efficacy. This model has since been employed to identify the most effective antisense constructs against a variety of genes including lacZ, ura4, c-myc, and Chk1 (Arndt et al., 2000). In most cases these constructs were shown to be equally successful at inhibiting the genes in human cells perhaps reflecting the similarities of RNA biology in these organisms (Arndt et al., 2000; Clarke et al., 2000). This chapter describes the use of the lacZ fission yeast model to investigate the influence of antisense gene location in target gene regulation. To this end, a set of strains were generated with a target lacZ gene at a fixed locus and antisense genes at a number of different genomic locations. A long-inverse PCR (LI-PCR) strategy was developed to characterise the genomic regions flanking the integrated antisense gene. This enabled the precise mapping of the antisense gene in relation to the target lacZ locus. The steady-state levels of antisense RNA were analysed as was the degree of target gene inhibition. The impact of classical position effect and the relative locations of the antisense and target genes on antisense RNA-mediated gene suppression is discussed. 68
Chapter 3
Antisense gene location effect
3.2
Methods
3.2.1
C onstruction ofrandom integrants
Several criteria needed to be satisfied for the generation of strains which could be used to analyse the effect of antisense gene location on target gene silencing. First, stable integration of the antisense vector needed to be achieved in single-copy. Second, homologous recombination (and therefore disruption) of the antisense and target lacZ genes had to be avoided. Third, the antisense genes needed to be integrated at different genomic locations. As homologous recombination occurs at high frequency in S. pombe (Grimm and Kohli, 1988; Grallert et al., 1993), a strategy was devised to avoid recombination of the antisense plasmid at the target gene and to generate strains in which the antisense gene was at a variety of genomic locations (Fig. 3.1). The strain RB3-2, which has been described previously (Arndt et al., 2000; Raponi et al., 2000a), was central to this study. RB3-2 contains the E. coli lacZ gene which encodes the β-galactosidase enzyme (Wallenfels and Weil, 1972). The level of βgalactosidase activity is directly related to the degree of lacZ gene expression, and therefore forms the basis of a quantitative reporter system (Arndt et al., 1995). RB3-2 was constructed by replacing the ura4 wild-type gene in strain 972 with the lacZ gene under control of the fission yeast adh1 promoter and ura4 3' processing signal (Patrikakis et al., 1996) via homologous recombination (Fig. 3.2A). A stable integrant was characterised and crossed to strain 1914 (h+, leu1-32) to generate strain RB3-2 (h-, ura4::adh1-lacZ, leu132). The strain G17-16, which was used for direct integration of the antisense plasmid, was constructed by crossing the strain 1859 (h-, ade6-704) with the strain RB3-2 and selecting for the following genotype: h-, ura4::adh1-lacZ, leu1-32, ade6-704. The strain H14-14, which does not contain the target lacZ gene, was generated by mating 1914 with 1859 and selecting for h+, ade6-704, leu1-32.
69
Chapter 3
Antisense gene location effect
Fig. 3.1 Strategy for constructing antisense lacZ random integrant strains. A S. pom be sub-genomic library of long genomic inserts was generated in the antisense lacZ integrating vector. This library was then used to transform either a strain that did not contain the 3.5 kb lacZ target gene (H14-14) or one that did (G17-6) . The H14-14 stable integrants were then mated with the strain RB3-2 to introduce the target lacZ gene. Strains containing both the antisense and target lacZ genes were then further characterised.
70
Chapter 3
Antisense gene location effect
Fig. 3.2 The target lacZ gene and antisense lacZ integrating vector. (A) The lacZ gene is driven by the adh1 promoter and contains the ura4 3’ termination sequence. It is integrated at the ura4 locus on chomosome III in the strain RB3-2. (B) The antisense lacZ integrating vector, pI2-1 is based on pRIP1/s (Maundrell, 1993). It contains the S.cerevisiae LEU 2 selectable marker which complements the S.pom be leu1-32 mutation. The sup3-5 nonsense suppressor is deleterious in multicopy and complements the ade6-704 mutation allowing for selection of single-copy integrants. The SphI site was modified to include an XhoI site for cloning sub-genomic fragments. The antisense lacZ gene is under control of the conditional nm t1 promoter. Transcription can be repressed by adding thiamine to the culture medium.
71
Chapter 3
Antisense gene location effect
Initially, the antisense lacZ integration vector (pI2-1) was generated by subcloning the fulllength lacZ fragment (Arndt et al., 1995) into pRIP1/s (Fig. 3.2B). An XhoI linker was inserted into the unique SphI restriction site. This restriction site was then used to clone a sub-genomic library (Barbet et al., 1992). Genomic DNA from strain 1913 was partially digested with Sau3AI, and fragments of 2 kb to 7 kb in size were gel-purified. The Sau3A1digested genomic inserts and the XhoI-digested vector were partially end-filled to give complementary overhangs. Ligation of these fragments and transformation into the E. coli strain DH10B generated a library of approximately 103 clones with a 45% insert frequency and fragments ranging in size from 2 to 7 kb (Fig. 3.3). Although the total number of clones was relatively low (probably a reflection of the large size of the plasmids), the library (named pH94) was adequate for integrating the antisense gene at random genomic locations.
Fig. 3.3 Insert analysis of pH94 library. Sixteen primary E.colitransformants were PCR-analysed for cloning efficiency of the genomic library using the forward primer 5SUP3B and reverse primer 3SUP3B (see Table 2.12) and cycling. Clones containing vector alone produced an amplicon of 384 bp while transformants containing plasmids with inserts generated amplicons between 2 and 7 kb. Controls included pREP2 which does not contain the primer binding sites, pRIP1/s which is the parental vector, and pH88-1 which has a cloned insert of 3 kb.
72
Chapter 3
3.2.2
Antisense gene location effect
Long inverse PC R (LI-PC R )
LI-PCR was used to analyse the flanking sequences of the integrated antisense gene in order to determine the precise site of integration. Figure 3.4 indicates the strategy employed for this study. Approximately 200 ng of S. pombe genomic DNA was digested with 20 U BamHI and BglII for 3 h, heat-deactivated and then diluted with 1X T4 DNA ligase buffer to a final DNA concentration of 2.5 ng/µl. This low concentration of DNA is important for achieving intramolecular ligation. T4 DNA ligase was added to a final concentration of 4 U/µl for ligation at 15˚C for 16 h. The ligation reaction was extracted with phenol-chloroform-isoamylalcohol and precipitated with 0.1 vol 3 M sodium acetate, 2 vol ethanol, and 20 µg glycogen carrier at -70°C for 1 h. The sample was then centrifuged at 12,000 g for 10 min, washed with 70% ethanol, dried, and resuspended to a concentration of 20 ng/µl. A total of 40 ng of the ligated DNA was used as a template for amplification using primers which specifically amplify the upstream genomic flanking sequence (Fig. 3.4). PfuTurbo™ DNA polymerase was used due to its ability to amplify genomic targets up to 10 kb in length and inherent hot start properties. Wax beads (AmpliWax PCR Gem 100) were employed to assist with increasing specificity and product yield. If intermolecular ligation had occurred multiple amplicons would have been generated. PCR products were purified and concentrated with QIAquick PCR purification columns (QIAGEN) and directly sequenced with the primer 3SUP3C using an ABI PRISM automated sequencer. The specific amplification of a single product allows the circumvention of gel purification and cloning procedures inherent in standard approaches (Ochman et al., 1993; Triglia et al., 1988; Pang and Knecht, 1997; Shyamala and Ames, 1989; Jones and Winistorfer, 1992; Willis et al., 1997; Jones and Winistorfer, 1997). A BLASTN search was performed with sequenced products against the available EMBL S. pombe genomic database (Stoesser et al., 1998).
73
Chapter 3
Antisense gene location effect
Fig. 3.4 The LI-PCR strategy. The transgene (hatched) was cloned between the promoter and terminator sequences (filled) as a Bam HI fragment. After integration, digestion of genomic DNA with Bam HI and BglII cuts both the upstream and downstream flanking sequences (bold lines) at unknown distances from the transgene. Self-ligation of genomic DNA forms multiple circular molecules, two of which contain the upstream or downstream flanking sequences of the integrated vector. Thin lines indicate vector backbone and bold lines indicate genomic DNA. Arrows A and B represent primers specific for vector sequence.
74
Chapter 3
Antisense gene location effect
3.3
Results
3.3.1
C onstruction ofrandom integrants – strategy I
To readily test for potential position effects, the pH94 library was integrated into the target strain (H14-14) in single-copy by using the sup3-5/ade6-704 complementation system (Section 2.2.7) (Carr et al., 1989). Stable integrants were isolated and then mated with RB3-2 to introduce the target lacZ gene. The presence of the full-length lacZ antisense gene was confirmed by Southern analysis (Fig. 3.5A). Ten from 15 stable integrants contained the antisense gene. The target lacZ gene-specific band is seen in all RB3-2-based strains (~30 kb). Additional bands can be seen in strains I10-1, I10-5, and I10-10. This may have been due to contamination of the probe with vector backbone. The reason for the absence of the antisense gene in a sub-set of strains is not known, however, for rapid identification of those which did contain the antisense gene a diagnostic PCR protocol was devised (Fig. 3.5B; Section 2.7.2). This confirmed the absence of the antisense gene in five of the I10 strains and was used for all further diagnosis of stable integrants. Antisense gene expression was demonstrated by Northern blot analysis (Fig. 3.5D). In all strains containing the antisense gene an RNA transcript of approximately 3.7 kb was observed. This is the size expected for the antisense lacZ cassette containing the nmt1 5’ and 3’ untranslated regions (UTRs). To demonstrate that the target lacZ gene was being expressed following strain crosses, Northern blots were reprobed for the adh1-lacZ-ura4 3’ cassette (Fig. 3.5E). In all cases target gene expression was observed. An additional 21 strains containing the antisense and target genes were generated using this approach.
75
Chapter 3
Antisense gene location effect
Fig. 3.5 Integration and expression analysis of the antisense lacZ gene. (A) Representative example of Southern blot analysis. DNA was digested with Pst1, fractionated on a 0.4% agarose gel, and transfered to a nylon membrane. The membrane was probed with the lacZ fragment (Section 2.8.2). (B) Antisense lacZ specific primers were employed to generate a 1 kb amplicon in positive strains. (C) The presence of the lacZ antisense gene in I10 strains was confirmed by antisense lacZ specific PCR. (D) Northern analysis of I10 strains. RNA was separated on a 1% MOPS/formaldehyde agarose gel, transferred to a nylon membrane and probed with the nm t1 fragment (Section 2.8.2). The endogenous nm t1 RNA (1.3 kb) was used to normalise the steady-state level of antisense lacZ RNA (3.7 kb). (E) The membrane was stripped and reprobed with DNA specific for the ura4 3’ sequence (Section 2.8.2). The target gene transcript (3.7 kb) is not present in the negative control strain 1913.
76
Chapter 3
3.3.2
Antisense gene location effect
G enetic crossing does notaffectβ-galactosidase activity
Antisense strains generated from H14-14 transformation had been crossed with RB3-2 and spores were selected for leu+ (antisense lacZ) and ura4- (target lacZ) phenotypes. Before analysing the resulting strains for antisense RNA-mediated silencing of the lacZ gene, it was first necessary to investigate whether the introduction of different genetic backgrounds could affect target gene activity in derived strains. To this end, the lacZ-expressing strain (RB3-2) was mated to the untransformed H14-14 strain and 12 individual spores were selected which were auxotrophic for both leucine (leu-) and uracil (ura4-). Single colonies from each of the resulting strains were subjected to β-galactosidase analysis (Fig. 3.6A). Except for two outliers, the variation of β-galactosidase activity between strains was within 10%. Five single colonies of the two outliers (strains 1 and 6) and RB3-2 were then reassayed to determine if this variation was reproducible. Figure 3.6B shows that the activity of these “outliers” was similar to that of RB3-2 demonstrating that the large differences in activity were aberrations of the initial assay. When the mean value was calculated there was no significant difference between the activity of RB3-2 and strains 1 and 6 (Fig. 3.6C). It was therefore concluded that the genetic cross does not affect lacZ gene activity. Additionally, these results indicate that at least three individual colonies need to be assayed in triplicate to obtain accurate values of β-galactosidase activity.
Fig. 3.6 Analysis of β-galactosidase activity in mated strains. (A) One colony of 12 independent strains from a H14-14 x RB3-2 cross, and a single colony of the parental strain RB3-2, were assayed for β-galactosidase activity. (B) A repeat assay of five indepenent colonies (a-e) of strains 1, 6, and RB3-2 was performed. (C) The mean and standard deviations are shown from the results of (B). 77
Chapter 3
3.3.3
Antisense gene location effect
C onstruction ofrandom integrants – strategy II
A total of 17 stable integrants were initially isolated by transforming the pH94 library directly into strain G17-16 which contains the lacZ target gene. Because of the probable high frequency of homologous recombination at the target gene locus a PCR strategy was devised to rapidly screen for these integrant types (Fig. 3.7A). If the target gene had been disrupted by homologous recombination with the antisense lacZ vector, the ADH5’/URA4 3’EXT primer pair would not generate a PCR amplicon. PCR diagnosis of these strains suggested that the antisense vector had recombined at the lacZ locus in eight of these strains (Fig. 3.7B). The predicted recombination structure was confirmed using Southern analysis (Section 4.3.3). Therefore, using the two integration approaches, a total of 40 strains which contained the target lacZ gene at a fixed locus and a single-copy antisense lacZ gene at other genomic locations were generated. Thirty-one strains were made using the first strategy (Section 3.3.1) and nine using the approach described here. The next step was to identify the exact genomic position of the integrated antisense genes.
Fig. 3.7 PCR analysis of lacZ target gene in G17-16 transformants. (A) The forward primer ADH5’ and reverse primer URA4 3’EXT generate a 4.8 kb PCR product specific for the entire ORF of the lacZ target gene. (B) 100 ng of yeast DNA was subjected to PCR amplification of the lacZ ORF. RB3-2 was used as a positive control.
78
Chapter 3
3.3.4
Antisense gene location effect
C haracterisation offlanking sequences using LI-PC R
Although Southern analysis can give an indication of the relative chomosomal location of a gene this study required the exact mapping of the integrated antisense vector in each strain generated. The long distance inverse PCR method (Jones and Winistorfer, 1997; Willis et al., 1997) was therefore adapted to enable the direct amplification and sequencing of flanking fragments of relatively large size. This strategy does not require knowledge of restriction sites surrounding the insertion sequence, and does not involve a bacterial cloning step. Furthermore, it facilitates the rapid analysis of large numbers of flanking sequences up to 10 kb adjacent to an insertion tag. The strategy, designated long inverse-PCR (LI-PCR), is shown in Figure 3.4. Digestion with two restriction endonucleases that produce compatible cohesive ends and the use of a thermostable polymerase is central to this LIPCR approach. The use of two 6-base recognition enzymes, with one flanking the insertion tag, ensures that the plasmids generated following ligation will be reasonably sized (≤ 10 kb) for long-PCR amplification. Depending on which sites are available in the vector, one can choose a number of other restriction endonuclease combinations which produce compatible ends. This approach also avoids the fastidious procedure of blunt-ending the PCR products prior to ligation. Single amplicons were generated for all transformants containing the lacZ transgene indicating that LI-PCR was specific and that intramolecular ligation had been facilitated (Fig. 3.8). These amplicons contained both an unknown length of flanking sequence and a portion of vector which was dependent on the site of vector recombination. The products were sequenced and aligned to the S.pombe genomic database. Each amplicon gave matches against cosmids enabling the precise mapping of the integrated vector. Thirteen of the 40 strains analysed had the antisense gene integrated at unique chomosomal sites. Table 3.1 shows the sequence and cosmid locations of these 13 strains. The junction sequence was also determined in 10 of the strains indicating the type of restriction site (BamHI or BglII) most proximal to the integrated sequence. BLASTN analysis indicated that the majority of the remaining strains had the antisense gene located at the endogenous nmt1 site (cosmid SPCC1223).
79
Chapter 3
Antisense gene location effect
Fig. 3.8 LI-PCR of random integrants. Amplicon sizes ranged from 6 to 10 kb. The integrating vector (pG14-6) was amplified as a 12 kb positive control. The low molecular weight marker is EcoRI-restricted SPP-1 bacteriophage DNA with bands ranging from 0.36 to 8.51 kb. The high molecular weight marker is H indIIIrestricted λ DNA with bands ranging from 0.56 to 23.1 kb.
Table 3.1 Mapping of integrated antisense lacZ plasmids in S.pom be. strain
junction sequencea
cosmid
P(N)b
I10-4
ND
SPAC222
2.60E-77 ND
J45-1
ND
C191
7.70E-82 ND
K40-2
ND
SPAC16
1.00E-48 ND
J45-3
TTACCCGGGGATCTTATCAGATAATTGAAATCTA
SPAC328
8.90E-71 BglII
I10-9
TTACCCGGGGATCTGCAAGGTCGAGATCGCTTTG
SPCC1620 5.50E-42 BglII
J16-22
TTACCCGGGGATCCTATTGGGTGACACCGCAACT
SPAC23D3 1.30E-82 Bam HI
J16-32
TTACCCGGGGATCTGCTGATGCGCACGCCCAAAC SPBC646
4.60E-82 BglII
J16-35
TTACCCGGGGATCTGTAGACCACTTTATGTTTAT
5.40E-96 BglII
J16-42
TTACCCGGGGATCCAACCCGGGAGCCGCTGCATG SPCC1840 1.30E-98 Bam HI
J16-45
TTACCCGGGGATCCTGCTTCGTGCTACTTTCATT
SPCC1235 3.20E-93 Bam HI
J45-10
TTACCCGGGGATCTGTTAGGGTGGGACCAACTTA
SPAC17G6 1.50E-54 BglII
J45-14
TTACCCGGGGATCTGCTCGGGTGCGATGGACTTG SPAC23A1 9.10E-33 BglII
K40-7
TTACCCGGGGATCTGATTGGGTGCCACAAATTAA
a b
SPBC3B8
Sitec
SPCC1223 2.90E-76 BglII
Vector sequence is indicated in bold. The probability [P(N)] of genomic sequence having homology to sequenced cosmids is also indicated. Scores of less than 10-10 were considered highly significant. c Religation to either a Bam HI or BglII site was determined from the junction sequence (underlined). ND not done
80
Chapter 3
Antisense gene location effect
In summary, 13 strains were identified in which the antisense gene was located at unique genomic sites (Fig. 3.9). Each arm of the three fission yeast chromosomes was represented by at least one strain. This included antisense genes located close to centromeric regions (J45-10, J56-11), telomeric regions (J16-42) and proximal to the target gene locus (J16-45).
Fig. 3.9 Distribution of antisense integration sites in fission yeast strains. The three S. pom be chromosomes are shown diagramatically. Genomic positions were identified by sequencing the DNA flanking the integrated vector using the LI-PCR protocol. The target lacZ gene locus is indicated positioned on the left arm of chromosome III.
3.3.5
C o-localisation of the targetand antisense lacZ genes does not
affectlacZ suppression Following the construction of 13 unique strains in which the target gene position was fixed and the antisense gene location was different, the specific activity of β−galactosidase was determined in these strains in both the presence and absense of antisense RNA (Fig. 3.10). RB3-2 transformed with the episomally expressed antisense lacZ gene consistently showed approximately 55% lacZ silencing and was used as a positive control in all experiments. Down-regulation of the lacZ gene ranged from approximately 25% to 45% in the random 81
Chapter 3
Antisense gene location effect
integrants. To determine if lacZ inhibition was dependent on antisense RNA transcription, the nmt1-driven cassette was repressed by growing cells in the presence of thiamine (Maundrell, 1990). Addition of thiamine to the culture medium returned β−galactosidase activity to control level in all strains indicating that lacZ suppression was dependent on antisense transcription (Fig. 3.10). Additionally, strain J16-45, which has the antisense gene located only 79 kb away from the lacZ target on chomosome III, revealed no enhancement of β−galactosidase down-regulation when compared with strains in which the antisense gene was located at other genomic loci (Fig. 3.10). These results indicated that the relative location of the antisense and target genes in the host genome probably does not affect antisense RNA–mediated gene suppression in S. pombe.
Fig. 3.10 Analysis of β−galactosidase activity in random integrant strains. Strains were grown in the absence of thiamine and assayed for β−galactosidase activity (grey histograms). The negative control was the parental strain RB3-2 and the positive control was RB3-2 transformed with episomally-expressed antisense lacZ. Strains were also assayed in the presence of thiamine (black histograms). Three independent colonies were assayed in triplicate for each strain. 82
Chapter 3
3.3.6
Antisense gene location effect
lacZ suppression correlates w ith antisense dose
Northern analysis of 11 of the unique integrants demonstrated varying levels of antisense RNA expression (Fig. 3.11). This directly demonstrated the effect of genomic position on transgene expression (Section 1.6.5). Further analysis showed that the variation in the antisense RNA steady-state levels between strains correlated with differences in β−galactosidase activity (Fig. 3.11). Linear regression analysis of antisense RNA steadystate levels versus β−galactosidase suppression for all strains in this study gave a coefficient of determination of 0.906, indicating that the correlation between antisense dose and gene suppression was highly significant (Fig 3.11). This indicated that the degree of lacZ down-regulation was due to transgene position-dependent antisense RNA expression levels. To confirm this apparent antisense RNA dose effect, a strain was identified which contained two copies of the antisense gene (Fig. 3.12A). Northern analysis indicated that the relative steady-state level of antisense RNA in this strain (designated J56-7) was almost twice that of strain K40-7 which contains only one antisense gene (Fig. 3.12B). Furthermore, J56-7 demonstrated 55% down-regulation of β−galactosidase activity compared with only 35% in K40-7 (Fig. 3.12C). In total, it was concluded that the steadystate RNA levels of integrated antisense genes are affected by their genomic position in S. pombe, and that this consequently affects the intracellular concentration of antisense RNA and therefore the level of target gene suppression.
83
Chapter 3
Antisense gene location effect
Fig. 3.11 Antisense RNA-mediated gene silencing is dose-dependent. Relative antisense RNA steady-state levels were plotted against lacZ suppression for each strain and linear regression analysis was performed. lacZ suppression was determined by measuring the activity of β−galactosidase when strains were grown in the absence of thiamine. Three independent colonies were assayed in triplicate for each transformant (variation ranged from 0.5% to 4%). All strains returned to control levels of β−galactosidase activity when grown in the presence of thiamine. Total RNA from each strain was probed with the 2.2 kb nm t1 fragment. The antisense signal was normalised with the endogenous nm t1 transcript and quantitated by phosphorimager analysis. Northern blots were performed in duplicate and signals were averaged. All strains contain one copy of the antisense lacZ gene except for J56-7 which contains two copies.
84
Chapter 3
Antisense gene location effect
Fig. 3.12 Dose effect of antisense lacZ RNA. (A) Southern analysis of antisense transformants. Genomic DNA was digested with PstI and probed with the lacZ fragment. (B) Total RNA was probed with the nm t1 fragment. The antisense signal was normalised with the endogenous nm t1 transcript and quantitated by phosphorimage analysis. (C) β−galactosidase suppression was determined when strains were grown in the absence of thiamine. Addition of thiamine returned β−galactosidase activity to control level.
85
Chapter 3
Antisense gene location effect
3.4
Discussion
3.4.1
Sum m ary
The genetic tractability of fission yeast and its amenability to antisense RNA-mediated gene inhibition have made it an ideal model for studying factors that affect antisense gene regulation in vivo. This chapter has described experiments using the lacZ fission yeast model to test the influence of antisense gene location on target gene silencing. A strategy was devised to avoid homologous recombination of the antisense and target lacZ genes and to integrate the antisense gene at random genomic locations. This included introducing long random genomic fragments into the antisense lacZ plasmid and transforming strains which either contained the target lacZ gene or not. In the latter case, the target lacZ gene was then introduced through mating. Forty strains containing the target gene at a fixed locus and a single-copy antisense gene at another location were generated using these techniques. To rapidly identify the precise genomic location of the antisense genes, a long inverse-PCR strategy was developed. Sequenced amplicons were analysed and it was shown that 13 had the antisense gene located at distinct loci which mapped to different regions of the three host chomosomes. These strains were then analysed for β-galactosidase activity and antisense gene expression. It was concluded that the relative position of the antisense and target genes did not affect the degree of target gene inhibition. Instead, an increase in antisense RNA concentration resulted in more effective lacZ suppression, with the antisense RNA steady-state levels appearing to be dependent on genomic position effects and transgene copy number.
3.4.2
G eneration ofrandom integrants
Targeted integration via homologous recombination is a standard technique employed in S. pombe (Grimm et al., 1988). Similar to budding yeast, homologous recombination occurs at high frequency and is favoured over non-homologous (or illegitimate) recombination (Grimm and Kohli, 1988). This phenomenon was exploited in this study to generate strains which contained a target lacZ gene at a fixed locus and a single-copy antisense gene in 86
Chapter 3
Antisense gene location effect
various random chromosomal locations. First, homologous recombination was used to replace the endogenous ura4 gene with the lacZ target cassette. Second, a sub-genomic library was introduced into the antisense plasmid to force targeted integration at random genomic locations. Following isolation of 40 stable integrants in which the antisense and target lacZ genes were functional, analysis of the genomic sequences flanking the antisense gene demonstrated that 13 strains had integrated at unique chromosomal positions while the majority of strains contained the antisense gene at the nmt1 locus. This was probably due to homologous recombination with the nmt1 cassette in the integrating vector library pH94. The frequency of integration at this locus (27/40) correlated with the frequency of antisense vectors in pH94 which did not contain long genomic library sequence.
3.4.3
LI-PC R and characterisation oftransgene location
With the near-complete sequencing of the fission yeast genome the precise mapping of integrated transgenes has become facile. The primary requirement for this study was a technique for high-throughput identification of genomic sequence flanking the integrated DNA. To this end, it was necessary to isolate and characterise the sequences flanking the integrated plasmid. However, traditional cloning and plasmid rescue methods employed for identifying such flanking sequences are cumbersome, while alternative PCR-based techniques such as inverse PCR (Ochman et al., 1993; Triglia et al., 1988) partial inverse PCR (Pang and Knecht, 1997), ligation-linker PCR (Shyamala and Ames, 1989), and panhandle PCR (Jones and Winistorfer, 1992) are limited by the number of steps required prior to DNA sequencing and the frequent need for prior restriction mapping analysis. While long distance inverse PCR and panhandle PCR have recently been used to characterise fragments up to 5.4 kb (Willis et al., 1997) and 9.4 kb (Jones and Winistorfer, 1997) respectively, these techniques are still limited by additional cloning or amplification steps. A simple and rapid method for the characterisation of long regions of DNA flanking known sequences was developed in this study. This technique was employed for mapping the site of integration of the antisense lacZ vector in the 40 stable transformants generated. By employing compatible 6-base restriction endonucleases prior to ligation and a 87
Chapter 3
Antisense gene location effect
thermostable polymerase for long PCR, specific amplicons were generated suitable for direct sequencing. Amplicons up to 9 kb were generated from fission yeast genomic DNA and were directly sequenced. The robustness of this strategy has also been shown by amplifying flanking regions up to 7 kb in more complex human genomic DNA (Raponi et al., 2000b). The simplicity of this technique should complement strategies currently employed for the characterisation of flanking sequences while its application for mapping insertion tags and promoter analysis should become more general as the complete sequence of more organisms, including humans, becomes available.
3.4.4
Position effectand antisense R N A dose
The steady-state level of lacZ antisense RNA was shown to vary between transformants in which the antisense gene was located at different chromosomal locations. Northern analysis of eleven such strains indicated that the relative steady-state level of antisense RNA ranged through half-an-order of magnitude. This indicated that the genomic position affected the level of transgene expression. This is an illustration of classical stable position effect (PE), which is due to the influence of the surrounding chromosomal architecture on transgene expression (Section 1.6.5). Apart from the demonstration of PEV at fission yeast heterochromatic regions (Allshire et al., 1994; Nimmo et al., 1994), to our knowledge this is the first demonstration of stable PE in S. pombe. Several studies have shown that PE can affect the steady-state RNA level of antisense genes which are stably integrated into the host genome (Qian et al., 1988; Van der Krol et al., 1990; Cannon et al., 1990; Heinrich et al., 1995). The resulting intracellular concentration of antisense RNA did not always correlate with the level of target gene silencing, leading to the location effect hypothesis. However, the results presented in this chapter have demonstrated that, in fission yeast, the silencing of a reporter gene is directly related to the intracellular concentration of antisense RNA (Raponi et al., 2000a). Target gene silencing ranged from approximately 25% to 55%. The highest level of silencing was seen in a strain containing two integrated copies of the antisense gene. This was similar to the level of suppression observed in RB3-2 transformed with the episomally expressed multicopy antisense plasmid, pGT2. Twenty-seven strains were characterised which had the 88
Chapter 3
Antisense gene location effect
antisense lacZ gene integrated at the same chromosomal locus. As expected, the level of lacZ inhibition was similar in each case (data not shown). The strain K40-7 was chosen as a representative of this genomic location and showed approximately 35% antisense RNAmediated lacZ gene silencing. The dose effect of stably integrated antisense genes shown here is in agreement with experiments where a range of antisense lacZ RNA concentrations was generated in the strain RB3-2 from episomally-expressed plasmids (G. Arndt and D. Atkins, unpublished data). In that study the antisense gene was controlled by variants of the nmt1 promoter which drive lower levels of expression (Basi et al., 1993). Decreased antisense expression resulted in a concomitant decrease in lacZ gene inhibition. Further, by co-expressing the antisense gene on two separate episomal plasmids the level of gene silencing was increased.
3.4.5
Location effectand co-localisation ofcom plem entary genes
Few studies have investigated the genomic location of integrated antisense genes and its correlation with gene silencing. Van der Krol et al. (1990) mapped the location of an antisense gene specific for the endogenous CHS-A locus (chomosome V) by segregating phenotypic markers in plant transformants. In most cases the antisense CHS gene had integrated in chomosome I and no correlation with flower phenotype could be established. In the present study 13 strains exhibited integration of the antisense lacZ gene into different chromosomal positions including all arms of the three fission yeast chomsomes. Six strains had the antisense gene located in chromosome I, two in chomosome II, and five in chomosome III. When β-galactosidase activity was examined in these strains no clear correlation between the relative locations of the complementary genes and the degree of lacZ inhibition could be drawn. For example, one strain (J16-45) had the antisense gene located only 79 kb away from the target gene locus, yet it demonstrated only 30% suppression which was the median level of gene silencing. If co-localising the antisense and target genes was to affect antisense RNA efficacy it would have been expected that J16-45 would demonstrate the highest level of lacZ inhibition. Although this was not the case, it may be that even more dramatic spatial coupling would be required to demonstrate enhanced gene silencing. An example of this includes the spatial coupling of the Drosophila 89
Chapter 3
Antisense gene location effect
white gene with a complementary ribozyme construct (Heinrich et al., 1995). When the complementary RNAs were expressed from the same DNA sequence more effective gene silencing was observed. Several strategies for co-localising the lacZ target and antisense genes have therefore been investigated (Chapter 4).
90
Chapter 4
Antisense and target gene location
CHAPTER 4 THE EFFECT OF ANTISENSE AND TARGET GENE CO-LOCALISATION Parts of this chapter have been published in Antisense Nucleic Acid Drug Devel. (2000) 10:29-34
4.1
Introduction
Spatial coupling of complementary RNAs has been described as a strategy for enhancing the efficiency of antisense RNA-mediated gene silencing (Section 1.6.6). This has been demonstrated by engineering complementary genes on the same construct (Heinrich et al., 1995), employing specific expression cassettes (Bertrand et al., 1997; Good et al., 1997; Samarsky et al., 1999), or by introducing RNA localisation sequences into the 3’ UTR of the target and antisense-based genes (Sullenger and Cech, 1993; Lee et al., 1999). For example, Sullenger and Cech (1993) demonstrated dramatic enhancement of viral inhibition in a mammalian cell system by tethering a viral packaging signal to a viralspecific ribozyme. These authors suggested that the transport of antisense-based RNA to sub-cellular compartments could increase the efficacy of gene silencing. Similarly, enhanced ribozyme effectiveness was shown by introducing a β-actin localisation sequence into the 3’ UTR of both target and ribozyme genes (Lee et al., 1999). Sweeney and colleagues (1996) employed a novel approach to overcome the incorrect intracellular localisation of antisense RNAs by embedding the antisense gene in ribosomal RNA subunits. This strategy enhanced the spatial co-localisation of antisense transcripts with target mRNAs during translation. Coupling of complementary genes is also seen in naturally-occurring systems. Generation of endogenous antisense RNA can occur by convergent transcription of the antisense strand of open reading frames (Section 1.3) (Knee and Murphy, 1997). The 91
Chapter 4
Antisense and target gene location
possible inhibition of the complementary gene could be due to two possibilities. First, expression of antisense RNA from an overlapping transcriptional unit could inhibit the target gene by acting in trans (Hildebrandt and Nellen, 1992). Alternatively, collision of the opposing polymerases can inhibit mRNA transcription through superhelical tension (Ward and Murray, 1979). The latter is commonly refered to as transcriptional (or polymerase) interference and is one factor which has been attributed to classical position effects (Proudfoot, 1986; Ingelbrecht et al., 1991). For example, transcriptional read-through into a convergently oriented downstream gene has been shown to inhibit the expression of this gene (Ingelbrecht et al., 1991). It was also demonstrated that addition of a termination signal between the transcriptional units can block the read-through and restore gene expression (Ingelbrecht et al., 1991). An example of interference of overlapping transcriptional units is the endogenous regulation of the α1(I) collagen gene in chicken chondrocytes (Farrell and Lukens, 1995). When transcription of the overlapping sense gene was induced, a reduction in antisense RNA was observed. This indicated that antisense transcription might impede α1(I) collagen mRNA transcription by collision of the opposing polymerases. X chromosome-inactivation is also a possible example of this type of genetic regulation (Lee and Lu, 1999). Prior to differentiation Xist RNA and its antisense counterpart, Tsix, are present at very low levels and both X chromosomes are active. However, following differentiation Tsix transcription is down-regulated and a concomitant increase in Xist RNA is observed. Xist RNA is thought to coat the X-chromosome thereby rendering it inoperative (Clemson et al., 1996). The Tsix gene completely overlaps the 15 kb Xist gene and it has been hypothesised that the mechanism for Xist silencing is either via trans-acting antisense RNA or by transcriptional interference (Heard et al., 1999). Similarly, convergent transcription has been implicated in genomic imprinting (Wutz et al., 1997). Methylation of different regions of a gene is a mechanism by which a gene is expressed from either the maternal or paternal chromosome (Ainscough and Surani, 1996) and it has been shown that this methylation can impact upon transcription of overlapping antisense genes (Wutz et al., 1997; Rougelle et al., 1998). For example, when a methylated region of the imprinted gene Igf2r was removed the gene was expressed regardless of its parental origin (Wutz et al., 1997). Loss of the methylated sequence corresponded with loss of an antisense transcript which was expressed from the paternal 92
Chapter 4
Antisense and target gene location
chromosome. When the antisense gene was expressed the sense gene was inhibited indicating that antisense RNA was involved in the imprinting of this gene. Since the complementary Igf2r genes overlap, one mechanism of silencing on the paternal chromosome could be polymerase interference. An imprinted antisense RNA for the ubiquitin protein ligase 3A gene, UBE3A, has also been recently described (Rougelle et al., 1998). These examples indicate that transcription of convergent antisense sequences may be a general, naturally-occurring, mechanism of epigenetic regulation of imprinted genes. There are illustrations of genomic rearrangements which have resulted in the positioning of antisense genes in close-proximity to the target locus (Kidd and Young, 1986; Coen and Carpenter, 1988; Tosic et al., 1990; Okano et al., 1991). Tosic and colleagues (1990) described myelin-deficient (mld) mutant mice which carried a tandem duplication of the Mbp gene. This inverted repeat, which encodes antisense RNA complementary to exons 3 and 7 of the Mbp mRNA, was located immediately up-stream of the wild-type gene in mld mice (Okano et al., 1991). These mice displayed a dramatic reduction of Mbp mRNA in the cytoplasm suggesting inhibition of nucleo-cytoplasmic transport by the antisense RNA. In a second example, in the plant Antirrhinum majus, a rearrangement of the nivea locus resulted in an inverted duplication of the promoter region (Coen and Carpenter, 1988). A reduction in the steady-state mRNA level of this gene was observed with a consequent phenotypic change in flower pigmentation. It was suggested by the authors that the mutant and wild-type alleles physically associated during expression causing a high local concentration of antisense RNA in the vicinity of the target mRNA. It was shown in Chapter 3 that the location of the antisense gene relative to the target gene locus did not impact upon the degree of target gene silencing in fission yeast. In those studies the closest the antisense gene was to the target locus was 79 kb. To further examine the issue of antisense and target gene proximity, a series of studies were undertaken to determine if antisense RNA efficacy could be enhanced by positioning the antisense gene in even closer proximity to the target lacZ gene. This was achieved by i) generating a diploid strain in which the antisense gene was located at the opposite allele, ii) integrating the antisense gene within the same genomic locus as the target, and iii) generating a convergent transcription cassette in which the antisense gene completely
93
Chapter 4
Antisense and target gene location
overlapped with the lacZ ORF. The utility of these approaches for inhibiting the target gene is discussed.
94
Chapter 4
Antisense and target gene location
4.2
Methods
4.2.1
C onstruction ofdiploid strains
Fission yeast normally exist in a haploid state (see Fig. 2.1). The effect of expressing the antisense lacZ gene at the opposite allele of the target gene was therefore investigated by generating and maintaining diploid strains (Fig. 4.1). This was achieved by mating a strain which contained the target lacZ gene at the ura4 locus with another which contained the antisense lacZ gene at the same genomic location (L51-1). Control strains included the nmt1 cassette alone (L57-2) or a ura4 knockout at the opposite allele (L57-1), or the antisense gene positioned at a distal locus (K33-4). To this end, a strain containing the target lacZ gene was initially constructed by crossing RB3-2 (h-, leu1-32, ura4::adh1-lacZura4-3') with FYC14 (h+, ade6-M210). Random spore analysis was performed and spores were selected which were auxotrophic for uracil and adenine. The resulting strain was named K32-3 (h+, ura4::adh1-lacZ-ura4-3', ade6-M210).
Fig. 4.1 Design of diploid strains used in this study. The lacZ antisense cassette was integrated at the same locus on chromosome III as the target lacZ gene (L511). Strains were mated and maintained as diploids. The structure of the control strains L57-2, L57-1, and K33-4 are indicated. 95
Chapter 4
Antisense and target gene location
The strains used for conjugation with K32-3 were then engineered. First, a ura4-specific integration vector containing the antisense lacZ gene driven by the nmt1 conditional promoter was constructed. The ura4 integration plasmid, pCG5, described by Grimm et al. (1988), initially had its unique BamHI site replaced with EcoRI to generate pGT23 (M. Patrikakis and D. Atkins, unpublished data). The nmt1 cassette from pREP2 was then subcloned into the HindIII site as a blunt-ended fragment to generate pGT29 (M. Patrikakis and D. Atkins, unpublished data). The lacZ gene was subcloned in the antisense orientation into the BamHI site of pGT29 to produce plasmid pK48-1. This plasmid was digested with EcoRI, and electroporated into FYC12 (h-, ade6-M216). FOA-selection led to the identification of the transformant L6-23 (h-, ade6-M216, ura4::nmt1 5'-ASlacZ-nmt1 3'). The control strain L6-12 (h-, ade6-M216, ura4::nmt1 5'-nmt1 3'), containing the nmt1 cassette at the ura4 locus, was generated by transforming FYC12 with EcoRI-digested pGT29 and selecting on FOA-containing medium. Northern analysis demonstrated that both L6-12 and L6-23 were expressing the appropriate expression cassettes (data not shown). The control strain L6-1 (h-, ade6-M216, ura4-D18), which was devoid of a transcriptional unit at the ura4 locus, was generated by transforming FYC12 with EcoRIdigested pGT23. The positive control strain, J83-2 (h-, ade6-M216, SPCC1223::nmt1 5'-ASlacZ-nmt1 3'), which consisted of the antisense lacZ gene at a different locus, was made by crossing H102-2 (h+, SPCC1223::nmt1 5’-ASlacZ-nmt1 3’) to J75-2 (h-, ade6-M216, leu1-32). H102-2 was the parental strain of K40-7 which demonstrated approximately 35% inhibition of β-galactosidase activity when in the haploid state (Section 3.3.6). Characterisation of the genomic sequence flanking the integrated plasmid in this strain determined that the antisense gene was located in the region of cosmid SPCC1223 which is on the right arm of chomosome III (Section 3.3.5). The above strains (L6-23, L6-12, L6-1, J83-2) were then crossed independently with K32-3 on ME medium at room temperature for 24 h. Strains were rescued from meiosis on selective medium and maintained in a diploid state by interallelic complementation of the ade6 mutant alleles (Section 2.2.4). Cells that undergo meiosis and
96
Chapter 4
Antisense and target gene location
sporulate at this stage will not survive due to the lack of adenine in the media. This produced diploid strains with the genotypes listed in Table 4.1.
Table 4.1 Diploid strains constructed for this study. Strain
Genotype
Haploid strain
Description
L51-1
h+,ura4::adh1-lacZ-ura4 3’,ade6-M 210 h-,ura4::nm t1 5’-ASlacZ-nm t1 3’,ade6-M 216
K32-3 L6-21
antisense lacZ at opposite allele.
L57-2
h+,ura4::adh1-lacZ-ura4 3’,ade6-M 210 h-,ura4::nm t1 5’-nm t1 3’,ade6-M 216
K32-3 L6-12
nm t1 cassette at opposite allele.
L57-1
h+,ura4::adh1-lacZ-ura4 3’,ade6-M 210 h-,ura4-D 18,ade6-M 216
K32-3 L6-1
ura4 knockout at opposite allele.
K33-4
h+,ura4::adh-lacZ,ade6-M 210 K32-3 h-,SPC C 1223::nm t1 5’-ASlacZ-nm t1 3’,ade6-M 216 J83-2
4.2.2
C onstruction ofthe close proxim ity strain
antisense lacZ at distal locus.
The “close proximity” strain was constructed by following a two-step process. First, a strain was generated which contained the lacZ gene at the ura4 locus flanked by the adh1 and nmt1 promoters in convergent orientation. To this end, the integration plasmid, pL82-9, was engineered as shown in Figure 4.2. The target strain H14-2 (h+, ade6-704, leu1-32) was generated by mating 1914 (h+, leu1-32) with 1859 (h-, ade6-704) performing random spore analysis, and identifying an ascospore with the desired genotype. This strain was then transformed with the PacI-PmeI digested pL82-9 and transformants grown on FOAcontaining media to select for a yeast transformant containing the stably-integrated cassette. Southern analysis confirmed that the convergent lacZ cassette had integrated at the ura4 locus (data not shown). This strain (named L88-1) was then transformed with the plasmid pK74-1 in which the lacZ gene was flanked by two divergent terminating sequences (Fig. 4.3A). pK74-1 was constructed by digesting pG14-6 with PstI and SalI and purifying the vector backbone. The ura4 3' terminator was PCR-amplifed from pGT113 (Arndt et al., 1995) to give a SalI 5’ end and a PstI 3' end using the primers 5URA4-3SAL and 3URA43PST, respectively (Section 2.7). The amplified product was directionally cloned into the 9.8 kb vector backbone to produce pK65-4. The 0.5 kb PstI sup3-5 fragment was then subcloned from pI2-1 into pK65-4 to generate pK74-1. 97
Chapter 4
Antisense and target gene location
Fig. 4.2 Generation of the ura4 integration vector pL82-9. The nm t1 5' fragment was isolated as a PstI-SalI fragment from the pI2-1 plasmid and cloned into pSP72. The nm t1 5’ fragment was then removed as an AatII/Bam HI fragment and subcloned into pADH5 to give pK76-1. The nm t1 5'-adh1 5' cassette from pK76-1 was then PCR amplified to give N otI ends. A N otI linker was introduced into the Sm aI site of pGT10 to generate pL18-1. The N otI nm t1 5'-adh1 5' fragment was then subcloned into this plasmid to generate pL29-17. Finally, the 3.5 kb Bam HI fragment was introduced into pL29-17 to generate the plasmid, pL82-9.
98
Chapter 4
Antisense and target gene location
Figure 4.3A illustrates the construction of the "close proximity" strain, L97-1. Homologous recombination between the lacZ sequences in pK74-1 and L88-1 generated this strain where both a functional target lacZ and antisense lacZ cassettes were positioned within the ura4 locus. Southern blot analysis of two individual transformants is shown (Fig. 4.3B). L97-1 demonstrated the correct bands while L97-2 did not indicating that the appropriate recombination event had not occurred in that strain (Fig. 4.3B). As expected, the ura4 3’specific probe did not hybridise to the intermediate strain L88-1. Amplification of the correctly recombined cassette was also demonstrated by PCR analysis (Fig. 4.3C). Using primers specific for the adh1 5’ promoter (ADH5’) and ura4 3’ terminator (URA4 3EXT), a 4 kb amplicon of the target lacZ cassette was generated only in L97-1 and the positive control, RB3-2.
99
Chapter 4
Antisense and target gene location
Fig. 4.3 Construction of the close proximity strain, L97-1. (A) The ura4 gene was replaced with the lacZ gene flanked by the adh1 5’ and nm t1 5’ promoters in convergent orientation to generate L88-1. This strain was then transformed with the plasmid pK74-1 which contained the lacZ gene flanked by the nm t1 3’ and ura4 3’ terminator sequences in divergent orientation. Successful homologous recombination between the lacZ sequences produced the strain L97-1 in which the functional target lacZ and functional antisense lacZ genes had been generated, separated by 6 kb of vector sequence. (B) Southern analysis was performed on two transformants isolated from the targeted integration. The target strain L88-1 was employed as a negative control. DNA was probed with the ura4 3’ fragment. (C) Genomic DNA was PCR-amplified with the primers ADH5' and URA4 3'EXT which are indicated in (A) by half arrows. The target lacZ amplicon was 4 kb. RB32 was employed as a positive control. 100
Chapter 4
Antisense and target gene location
4.3
Results
4.3.1
Expression ofcom plem entary genes from opposite alleles
Fission yeast strains were generated in which various sequences, including the antisense gene, were positioned at the opposite allele of the target lacZ gene (Table 4.1). Prior to βgalactosidase assays, cells were visualised under a light microscope to confirm their diploid state. Diploid cells are approximately twice the size of haploids and have double the DNA content. Genomic DNA could be visualised by staining cells with the fluorescent dye DAPI. An example of this is shown in Figure 4.4A. Both control strains (L57-1 and L57-2) demonstrated similar β-galactosidase activity indicating that transcription of the nmt1 cassette does not impact on lacZ expression. Compared to these strains, the antisense strain, L51-1, demonstrated a 17% reduction in β-galactosidase activity. The diploid strain K33-4 showed a 45% reduction in enzyme activity (Fig. 4.4B). Surprisingly, this indicated that expression of the antisense gene at the opposite allele was less effective than expressing it at another genomic location. To determine if this was due to genomic position effect, the steady-state level of the antisense RNA in the diploid strains was determined by Northern analysis. This demonstrated that L51-1 expressed approximately half the level of antisense RNA found in K33-4 (Fig. 4.4C). As expected, when L51-1 was grown in the presence of thiamine antisense RNA expression was abrogated (Fig. 4.4C). This was reflected in a return to control levels of β-galactosidase activity when antisense transcription was repressed (data not shown). The degree of gene silencing therefore correlated with the intracellular concentration of antisense RNA. This was an additional example of the effect of genomic position on transgene expression. In summary, expressing the antisense gene at the opposite allele to the target lacZ gene did not improve target gene regulation in this system.
101
Chapter 4
Antisense and target gene location
Fig. 4.4 Expression of complementary RNAs at opposite alleles. (A) Microscopic analysis of haploid and diploid strains. Cells were stained with DAPI and visualised under ultra-violet light. The identical fields were also photographed under white light. (B) Diploid strains were assayed for β-galactosidase activity in the absence of thiamine. L57-1 and L57-2 are diploid control strains that do not contain an antisense gene. L51-1 contains the antisense lacZ gene at the opposite allele. K33-4 is the positive control which contains the antisense lacZ gene on the right arm of chromosome III. Three independent colonies were assayed in triplicate for each strain. β-galactosidase activity was expressed as a percent of L57-1 (C) Northern analysis of diploid strains. RNA was fractionated on a 1% MOPS/formaldehyde agarose gel and probed with a fragment of the nm t1 cassette. L51-1 was grown in the presence and absence of thiamine. The relative steadystate RNA level was calculated by normalising the antisense lacZ RNA signal to the endogenous nm t1 RNA signal. L51-1 was assayed in duplicate for antisense RNA analysis.
102
Chapter 4
4.3.2
Antisense and target gene location
Expression ofcom plem entary genes from the sam e locus
Spatial coupling of homologous chromosomes might not occur in mitotic cells. Hence, a second strategy to test if spatial coupling of complementary RNAs could enhance gene silencing was employed by positioning the antisense gene 6 kb downstream of the target lacZ gene within the same genomic locus. This “close proximity strain” was called L97-1. When grown in the presence of thiamine, β-galactosidase activity of L97-1 was approximately 400 Units (Fig. 4.5A). This was 8-fold higher than the strain RB3-2 which contained the lacZ cassette only. Because L97-1 was constructed using a different strategy to RB3-2 (Arndt et al., 2000), the only available control for this strain was L97-1 itself, when antisense transcription was inhibited. When the antisense lacZ gene was activated by growing L97-1 in the absence of thiamine, β-galactosidase activity decreased by 27% (Fig. 4.5A). The question which arose from these results was why the enzyme activity seen in L97-1 was higher than that of RB3-2. To investigate any differences in the primary DNA structure of these strains, analysis of the 5’ leader sequences was performed. This was achieved by sequencing the junction of the nmt1 promoter and lacZ DNA with the primer 5NMTX (Section 2.6.5). The results indicated that RB3-2 contained a putative hairpin structure which was not found in L97-1 (Fig. 4.5B). It has previously been shown in yeast that such RNA secondary structures can impact on the rate of mRNA translation (Laso et al., 1993). The absence of this sequence in L97-1, which was likely due to the recombination process, may have allowed for more efficient translation of the lacZ mRNA. Northern analysis confirmed the presence of antisense RNA in L97-1 which was of the expected size (approximately 3.7 kb; Fig. 4.5C). Importantly, the steady-state level of the lacZ mRNA in L97-1 was the same as the control strain RB3-2. This was indicated following normalisation of the target lacZ RNA signal with the endogenous nmt1 transcript (Fig. 4.5C). Therefore, although an 8-fold higher level of target protein activity was present in L97-1, the same amount of target mRNA was available for antisense RNA hybridisation compared with other RB3-2-based strains. The presence of antisense RNA also confirmed that lacZ suppression in L97-1 was due to PTGS. In total, these results indicated that
103
Chapter 4
Antisense and target gene location
antisense RNA produced from within the target gene locus region was no more effective than the same gene integrated at other genomic loci.
Fig. 4.5 Analysis of lacZ expression in L97-1. (A) β-galactosidase activity was determined in strains RB3-2 and L97-1 when grown in the presence (grey histogram) and absence (black histogram) of thiamine. (B) The putative hairpin structure present in the 5’ leader sequence of the lacZ cassette in RB3-2 is shown. (C) RNA was probed for target mRNA using the ura4 3’ fragment (top panel) and for antisense RNA with the nm t1 fragment (lower panel). Both the control strain, RB3-2, and L97-1 were assayed in duplicate.
4.3.3
C onvergenttranscription atthe targetgene locus
When the target strain, G17-16, was transformed with the antisense plasmid, pI2-1, the majority of resulting integrants exhibited homologous recombination at the lacZ target gene locus (Section 3.3.3). Genomic analysis of several of these strains indicated that they had all recombined to generate a lacZ cassette with convergent promoters at the 5’ and 3’ ends and a lacZ cassette with flanking divergent terminators (Fig. 4.6A). Southern analysis of one of these strains (G34-10) is indicated in Figure 4.6B. This analysis showed that the target lacZ gene was disrupted with the loss of the 11 kb BglII diagnostic band found in control strains (RB3-2 and G17-16). Instead, two bands of 12 kb and 10.7 kb were present which corresponded to lacZ sequences flanked by the terminators and promoters 104
Chapter 4
Antisense and target gene location
respectively (Fig. 4.6A). When the Southern blot was re-probed with a ura4 3’-specific fragment, only the 12 kb fragment was observed (Fig. 4.6B). These results confirmed the predicted structure of the cassette following homologous recombination.
Fig. 4.6 Southern analysis of convergent cassette. (A) Homologous recombination of the antisense plasmid pI2-1 and the target lacZ gene in the strain G17-16 generated the convergent transcription cassette (strain G34-10). The lacZ locus in G17-16 is flanked by BglII restriction sites and does not contain an SphI site. The lacZ cassettes in G34-10 give 10.7 kb and 12 kb BglII/SphI fragments. (B) Genomic DNA was digested with SphI and BglII, separated on a 0.8% agarose gel, and transferred to a nylon membrane. The filter was probed with the lacZ fragment and the ura4 3’ fragment. The filter was stripped with 0.5% SDS between hybridisations. 105
Chapter 4
Antisense and target gene location
It is predicted that homologous recombination at the lacZ locus will generate a convergent transcription cassette as illustrated in Figure 4.7A. In this scenario the adh1-driven lacZ transcript would read through the antisense sequence of the nmt1 promoter and terminate downstream, probably at the termination site present in the sup3-5 gene (Hottinger et al., 1982). Northern analysis showed that the transcript specific for the nmt1-lacZ sequence was approximately 4.5 kb in length which is longer than the antisense lacZ transcript seen in the control strain K40-7 (Fig. 4.7B). As expected, all strains exhibited the endogenous nmt1 transcript which was abrogated when the strains were grown in the presence of thiamine. When nmt1 transcription was repressed, the steady-state level of the 4.5 kb RNA transcript increased by approximately three-fold. Clearly, in the strain G34-10, the nmt1 DNA probe is hybridising to the adh1-driven lacZ mRNA. Furthermore, no RNA signal was observed when the Northern blot was re-probed with the ura4 3’ terminator sequence indicating that cassettes containing this terminator were not being expressed (data not shown). This was additional evidence for the presence of the recombined lacZ cassette flanked by divergent terminators as this sequence would not be transcriptionally functional (Fig. 4.6A). To analyse antisense RNA transcription in the strain G34-10 in more detail, RNA was probed with a 50 nt antisense-specific lacZ oligonucleotide (Section 2.9.1). A strong signal corresponding to the antisense lacZ transcript was seen in the control strain (Fig. 4.7B). However, only a weak signal could be visualised in G34-10. This indicated that the nmt1-driven antisense lacZ was being expressed at a much lower level than in the strain containing the antisense gene at a different locus (K40-7). It also demonstrated that the adh1-driven lacZ transcript was dominant in its expression pattern compared to the nmt1driven antisense sequence. As expected, an antisense lacZ-specific signal was not observed when G34-10 was grown in the presence of thiamine.
106
Chapter 4
Antisense and target gene location
Fig. 4.7 Analysis of the convergent transcription strain G34-10. (A) The functional cassette contains the adh1 5’-lacZ target. Transcription reads through the antisense nm t1 5’ promoter and terminates at the stop site of the sup3-5 gene. Cryptic termination of the nm t1-driven lacZ antisense transcript occurs within the ura4 3’ flank. (B) RNA was fractionated on a 1% MOPS/formaldehyde agarose gel and transferred to a nylon membrane. The blot was probed with a nm t1 fragment (top panel). The endogenous nm t1 transcript is shown at 1.3 kb. The antisense lacZ transcript is 3.7 kb and the read-through lacZ transcript is approximately 4.5 kb. The membrane was stripped and reprobed with an antisense lacZ-specific oligonucletide probe. The read-through antisense transcript is approximately 4.5 kb in length. Strains were grown in the presence or absence of thiamine. RNA loading is indicated by the ethidium bromide stained gel. (C) β-galactosidase activity of RB3-2, K40-7, and G34-10 strains in the presence (grey histogram) and absence (black histogram) of thiamine.
107
Chapter 4
Antisense and target gene location
Analysis of β-galactosidase activity demonstrated 70% inhibition in the convergent transcription strain, G34-10 (Fig. 4.7C). In the presence of thiamine, β-galactosidase activity was similar to control strains. G34-10 therefore exhibited a two-fold greater degree of target gene silencing than a strain expressing the antisense gene at a separate locus. The potency of gene silencing observed in G34-10 is probably due to transcriptional interference in cis. As it was previously shown that the antisense gene suppressed βgalactosidase activity by only 27% when positioned at the same locus (Section 4.3.2), it is most probable that the mechanism of lacZ inhibition in G34-10 was due to polymerase interference. However, even though a low level of antisense RNA was present, it cannot be ruled out that lacZ silencing was not also mediated in trans to some degree. In conclusion, interference of lacZ gene expression by convergent transcription was an effective strategy for conditional gene silencing.
108
Chapter 4
Antisense and target gene location
4.4
Discussion
4.4.1
Sum m ary
The aim of this chapter was to investigate different strategies for co-localising complementary genes in the lacZ fission yeast model. Theoretically, by spatially coupling antisense and target genes, their respective RNAs should be generated in the same subcellular compartment thereby increasing the probability of hybridisation of the two transcripts. This may result in an enhancement of target gene silencing compared to antisense genes at sites distal to the target gene. In testing this hypothesis, it was initially found that antisense RNA expression at the opposite allele of the target lacZ gene in a diploid strain resulted in less effective lacZ silencing than in a strain where the antisense gene was integrated at a distal locus. This was primarily due to classical position effects resulting in a low steady-state level of antisense RNA in this strain. By taking advantage of the high frequency of homologous recombination in fission yeast, a second novel strategy was developed to position the antisense gene directly downstream of the target lacZ gene. Again, the engineered strain did not demonstrate an enhancement of gene silencing compared with strains where the antisense gene was positioned at distal loci. Finally, a strain was characterised which contained the full-length overlapping complementary lacZ sequences in a convergent orientation. This strain exhibited potent and conditional lacZ inhibition, however, detailed analysis suggested that target gene silencing was likely mediated at the level of transcription. In total, it was concluded that spatial coupling of complementary genes is not a critical factor for effective antisense RNA-mediated gene suppression in this model.
4.4.2
Expression ofcom plem entary genes atopposite alleles
Two strategies were devised to investigate the effect of co-localising complementary genes. The first involved generating a diploid strain in which the target and antisense genes were positioned at opposite alleles (Fig. 4.1). Allelic pairing has been previously demonstrated during meisosis in both budding yeast (Weiner and Kleckner, 1994) and fission yeast (Bahler et al., 1993). Somatic pairing of homologues has also been shown to occur during 109
Chapter 4
Antisense and target gene location
mitosis in S. cerevisiae (Burgess et al., 1999; Burgess and Kleckner, 1999) and Drosophila (Fung et al., 1998), while other examples exist in plants (Hollick et al., 1997), fungi (Aramayo and Metzenberg, 1996), mammals (LaSalle and Lalande, 1996), and Drosophila (Henikoff and Comai, 1998). In diploid yeast cells, homologous pairing occurs via multiple interactions that occur approximately once every 70 kb (Burgess et al., 1999). Burgess and Kleckner (1999) recently used a novel recombination assay to show that collisions between homologous sequences occur more frequently if they are present as alleles on homologous chromosomes, and that, if they reside on non-homologous chromosomes, they are more likely to interact if they are at similar distances from the centromere. Furthermore, a greater frequency of genetic recombination has been observed when homologous sequences are in close proximity in cis (Lichten and Haber, 1989). These observations suggest that homologous genes have a greater probability of interacting if they are in close proximity with each other. While pairing of homologous transgenes has been suggested to be important in epigenetic regulation (Henikoff, 1997), few reports have indicated that it may be important for post-transcriptional gene silencing (Coen and Carpenter, 1988). One example in plants involved the characterisation of the mutant allele niv-525 (Coen and Carpenter, 1988). It was shown that the antisense RNA generated from this genetic rearrangement acted in trans to inhibit the wild-type Niv+ allele in heterozygotes. In this system the level of Niv transcript was 10-12.5% relative to the wild-type homozygote. The efficient silencing of Niv led the authors to suggest that high levels of localised niv-525 antisense RNA was being generated near the wild-type locus by the nature of the complementary genes located at opposite alleles. The results presented in this chapter indicated that positioning of an antisense lacZ gene at the opposite allele (ura4 locus) of the target gene in a diploid strain (L51-1) does not enhance antisense RNA-mediated gene silencing. The level of lacZ inhibition was shown to be less than in strains in which the antisense gene was positioned at a distal locus (K33-4), however, this was found to be due to a low intracellular concentration of antisense RNA in L51-1. As described in Chapter 3, the observed differences in transgene RNA steady-state level is likely due to classical genomic position effect. Why was co-localising complementary genes by positioning them at opposite alleles not an effective strategy for 110
Chapter 4
Antisense and target gene location
enhancing target gene silencing? It must be noted that although alleles have been shown to pair in S. cerevisiae, it is not clear if alleles of the ura4 locus pair with a similar frequency during mitosis in S. pombe.
4.4.3
Expression ofcom plem entary genes atthe sam e locus
To ensure spatial coupling of the complementary transgenes, a second approach was taken which involved the generation of a fission yeast strain containing both the target and antisense lacZ genes at the same locus separated by only 6 kb of exogenous plasmid sequence. This involved homologous recombination between an integrated lacZ cassette within the ura4 locus flanked by two convergent promoters and a plasmid containing a lacZ cassette flanked by two divergent terminators. It was found that the β-galactosidase activity in the resulting strain (L97-1) was 8-fold higher than that of RB3-2-based strains in which the functional target lacZ gene had been integrated using an alternative strategy (Grimm et al., 1988). Analysis of the 5’ leader sequence of the lacZ gene indicated that a putative hairpin structure present in RB3-2 was absent in L97-1. Secondary structures of this nature have previously been shown to modulate the level of mRNA translation in yeast (Laso et al., 1993; Sagliocco et al., 1993). RNA analysis showed that both RB3-2 and L97-1 had similar steady-state levels of lacZ mRNA indicating that the differences in the 5’ leader sequence was not affecting RNA transcription or stability but rather the rate of translation. This was an important observation since the identical amount of target mRNA was available for antisense RNA hybridisation in both strains. This allowed a comparison of lacZ inhibition in L97-1 with strains in which the antisense gene was integrated at different loci. It was shown in Chapter 3 that antisense RNA-mediated gene inhibition of the lacZ ranged from 25% to 45% in strains with a single-copy antisense gene integrated at a variety of genomic locations. When antisense RNA transcription was activated in L97-1, βgalactosidase activity was reduced by 27%. As this level of lacZ inhibition was no greater than that seen in other strains, it was therefore concluded that spatial coupling of antisense and target genes did not influence the degree of gene silencing.
111
Chapter 4
4.4.4
Antisense and target gene location
C onvergenttranscription ofcom plem entary genes
Expression of antisense RNA from the target gene via convergent transcription is perhaps the ultimate approach for co-localising complementary RNA transcripts. Indeed, many examples exist of endogenous antisense RNAs which are generated from overlapping convergent sequences within transcriptional units (Section 1.3) (Knee and Murphy, 1997). Homologous recombination of the target lacZ sequence with the introduced antisense lacZ plasmid resulted in the generation of a functional lacZ cassette flanked by convergent promoters. As the 3’ flank contained the nmt1 promoter in the antisense orientation, inhibition of β-galactosidase activity was conditional. Activation of nmt1 transcription resulted in a 70% reduction in β-galactosidase activity in the strain G34-10. This was reflected in a similar reduction in the steady-state level of lacZ mRNA. The nmt1-driven antisense lacZ RNA could be detected by Northern analysis but it was present at very low levels compared with other antisense-expressing strains. This indicated that the mechanism of lacZ gene silencing was primarily due to transcriptional interference from polymerase collision. Taken together, the results presented in this chapter show that spatial coupling of complementary genes does not enhance antisense RNA-mediated gene silencing. However, it does not exclude the possibility that RNA co-localisation can enhance antisense-mediated gene suppression in S. pombe. For example, it has been demonstrated that co-localisation of target mRNA and ribozymes in sub-cellular compartments can dramatically enhance gene suppression (Sullenger and Cech, 1993; Hormes et al., 1997). It is possible that the strains generated in the present study produce target and antisense RNAs that follow different paths from the nucleus and arrive in distinct cytoplasmic sectors (St Johnston, 1995), thereby avoiding optimal co-localisation. Such differences in nucleo-cytoplasmic transport and sub-cellular localisation may be due to differences in the 5' and 3' untranslated regions of the antisense and target lacZ RNA transcripts (Hazelrigg, 1998). For example, the target gene contained adh1 5’ UTR and ura4 3’ UTR sequences while the antisense gene contained nmt1 5’ and 3’ UTR sequences. Therefore, under such circumstances, even colocalisation of the respective genes may not enhance co-localisation of the complementary RNAs.
112
Chapter 4
Antisense and target gene location
The experiments described above also differ from previous studies by one important factor. That is, examples which have shown increased efficacy when complementary genes were spatially coupled in eukaryotes were all ribozyme based studies (Egli and Braus, 1994; Ferbeyre et al., 1995; Heinrich et al., 1995). An important difference between antisense RNA and ribozymes is that the latter requires completion of a catalytic cycle prior to being available for interaction with another substrate molecule. It may be that gene colocalisation is an important factor for increasing the kinetics of ribozyme cleavage but it may not be as important for antisense RNA efficacy. During the course of this study, it became clear that the variations in antisense RNA-mediated gene silencing observed between clonal lines in many plant studies were likely due to the formation of dsRNA (Fire et al., 1998; Montgomery and Fire, 1998). These observations argued against the “location effect” hypothesis and suggested, instead, that the fortuitous position-dependent transcription of the antisense strand generated dsRNA. We therefore sought to investigate the use of dsRNA as a mediator of gene silencing in the lacZ fission yeast model (Chapter 5).
113
Chapter 5
dsRNA-mediated gene silencing in fission yeast
CHAPTER 5 THE EFFECT OF DOUBLE-STRANDED RNA IN FISSION YEAST
Parts of this chapter have been submitted for publication
5.1
Introduction
In this thesis, the primary hypothesis proposed for the observed differences in antisense RNA-mediated suppression between clonal lines, independent of antisense RNA dose, was the relative location of complementary genes within the nucleus (“location effect”). However, data presented in the previous chapters have shown that the spatial-coupling of complementary genes does not enhance antisense RNA-mediated gene silencing in fission yeast. An alternative explanation for these anomalies may be related to the recently described phenomenon of RNA interference (RNAi; Fire et al., 1998) (Section 1.5). The lack of correlation between antisense RNA steady-state levels and antisense efficacy demonstrated in previous studies, may be due to the formation of a threshold level of dsRNA in a subset of clonal transformants and consequent activation of an RNAi-like mechanism. This would depend upon the site of antisense gene integration and the fortuitous transcription of the opposite strand by a cryptic promoter (Montgomery and Fire, 1998). Similarly, this would explain gene silencing mediated by the integration of additional copies of the transgene (co-suppression). The utility of dsRNA-mediated gene interference (known as RNAi in animals) has been demonstrated in a variety of organisms including C. elegans (Fire et al., 1998), plants (Waterhouse et al., 1998), Drosophila (Kennerdell and Carthew, 1998; Misquitta and Paterson, 1999), planaria (Sanchez-Alvarado and Newmark, 1999), trypanosomes (Ngo et al., 1998), Hydra (Lohmann et al., 1999), zebrafish (Wargelius et al., 1999; Li et al., 2000),
114
Chapter 5
dsRNA-mediated gene silencing in fission yeast
and recently in mammalian oocytes and preimplantaion embryos (Wianny and ZernickaGoetz, 2000). Additionally, another form of PTGS in which extra copies of a target gene suppress both the endogenous and introduced transgene (co-suppression or quelling) has been observed in Paramecium (Ruiz et al., 1998), Neurospora crassa (Cogoni and Macino, 1997b), plants (Voinnet and Baulcombe, 1997), Dictyostelium (Scherczinger and Knecht, 1993), and in mammalian cells (Cameron and Jennings, 1991; Bahamian and Zarbl, 1999). It has been suggested that in the different categories of PTGS, the culprit dsRNA is formed either by i) the cryptic transcription of antisense RNA in cells where extra copies of the sense gene have been introduced, ii) the simultaneous expression of antisense and sense sequences, iii) the formation of RNA hairpins from inverted repeats, or iv) the direct introduction of dsRNA (Montgomery and Fire, 1998). The dsRNA is thought to act as a substrate for dsRNA-dependent RNA polymerase which generates a complementary RNA (cRNA) (Dougherty and Parks, 1995; Cogoni and Macino, 1999a). This cRNA may target mRNA for degradation or hybridise to antisense RNA to generate additional dsRNA. It has been shown that the long dsRNA is fragmented into small dsRNA species (Zamore et al., 2000). In support of this hypothesis a small antisense RNA of 25 nt was recently identified in four different forms of PTGS in plants (Hamilton and Baulcombe, 1999) and in a Drosophila cell-free assay (Hammond et al., 2000; Zamore et al., 2000). Experiments in the Drosophila model have also shown that RNAi is mediated by nuclease degradation of the targeted mRNA (Tuschl et al., 1999; Hammond et al., 2000; Zamore et al., 2000). In the case of plants and worms it has been shown that PTGS acts in a substoichiometric fashion and has the ability to migrate between cells (Fire et al., 1998; Voinnet et al., 1998). However, the potency of PTGS seems to vary between organisms. For example, dsRNA appears to have an amplification or catalytic component in most of the organisms investigated but was shown to be less robust in the vertebrate zebrafish where gene suppression was dependent on the concentration of introduced dsRNA (Wargelius et al., 1999). This suggests that either the level of dsRNA has not reached the threshold which may be required for activation of a catalytic event or that some of the factors involved in robust forms of PTGS are absent and/or inhibitors of PTGS are present in that organism.
115
Chapter 5
dsRNA-mediated gene silencing in fission yeast
The lacZ fission yeast model has been employed to investigate features of antisenseRNA technology in vivo (Arndt et al., 1995; Raponi et al., 2000a). It has previously been shown that gene inhibition is dependent on the concentration of antisense RNA (Chapter 3) while co-localisation of antisense and target genes does not affect the level of target gene suppression in this system (Chapter 4) (Raponi et al., 2000a). Additionally, the size of the antisense transcript (Arndt et al., 1995; Clarke et al., 2000), and the region to which it is targeted (Arndt et al., 2000) can affect the efficacy of target gene inhibition. In this chapter it is demonstrated that antisense RNA-mediated gene regulation is enhanced by expression of additional sense RNA. Furthermore, expression of lacZ panhandle RNA also enhanced target gene suppression, indicating that the generation of dsRNA through either intermolecular or intramolecular hybridisation is central to antisense RNA-mediated gene silencing in S. pombe. The usefulness of this model is further extended by over-expressing the fission yeast ATP-dependent RNA helicase ded1 to further show that antisense RNAmediated gene regulation is linked to dsRNA-mediated gene silencing, and, also to illustrate that concomitant expression of host-encoded factors can enhance PTGS. The use of this model for the elucidation of the mechanisms involved in PTGS and the differences between PTGS in fission yeast and other organisms is discussed.
116
Chapter 5
dsRNA-mediated gene silencing in fission yeast
5.2
Methods
5.2.1
C onstruction ofsense lacZ-expressing strains
The generation of strains containing a single-copy of an integrated antisense lacZ gene was described in Chapter 3. A version of the integrating vector containing a sense lacZ gene was made by sub-cloning the full-length non-coding BamHI lacZ fragment (Arndt et al., 1995) into the BamHI site of pRIP2/s in the sense orientation (Maundrell, 1993). The noncoding lacZ fragment was generated by introducing a frame-shift mutation at the ClaI restriction site (Arndt et al., 1995) . This was transformed into the strain SP41 (h+, ade6704, ura4-D18), and a single-copy integrant was isolated (M60-3). M60-3 was then mated with RB3-2 to introduce the target lacZ gene. The construction of the long lacZ antisense containing episomal plasmid, pGT2, and corresponding control plasmids have been described (Arndt et al., 1995). The non-coding lacZ sense fragment was subcloned into the BamHI site of pREP4 to generate the plasmid pM54-3.
5.2.2
C onstruction oflacZ panhandle-expressing strains
A lacZ panhandle vector was engineered containing the full-length 3.5 kb non-coding lacZ sequence with a 2.5 kb inverted repeat (Fig. 5.2A). This construct generates a panhandle transcript of approximately 6.2 kb in length with a 1 kb loop and 2.5 kb of selfcomplementarity. This gene was initially integrated into a fission yeast strain in single-copy and the target gene was then introduced through genetic crossing. The lacZ panhandle integration vector, pM30-8, was generated by first introducing a NotI site into the XmaI site of pRIP1/s (Maundrell, 1993) using the self-complementary linker XHO-NOTI to generate pL121-14. The 2.5 kb sequence of the 5' end of the non-coding lacZ gene (Arndt et al., 1995) was then PCR-amplified using the forward primer 5LACZ-NOTI and reverse primer 3LACZ-NOTI to produce NotI ends (Section 2.7). This product was then subcloned into the NotI site of pL121-14 in the antisense orientation. The full-length non-coding lacZ 117
Chapter 5
dsRNA-mediated gene silencing in fission yeast
fragment was then introduced into the BamHI site of this vector in the sense orientation upstream of the 2.5 kb antisense fragment to generate pM30-8. The integrating vector, pM30-8, was introduced into the target strain SP41 (h+, ade6-704, ura4-D18) and a stable transformant containing a single copy of the panhandle gene was isolated. The resulting strain was then crossed with RB3-2 to introduce the target lacZ gene. To generate a higher steady-state level of panhandle RNA the episomal plasmid pM53-1 was constructed by removing the PstI sup3-5 fragment from pM30-8 and introducing the autonomous replicating sequence as an EcoRI fragment (Maundrell, 1993). This plasmid was then introduced into the target strain RB3-2 by electroporation.
5.2.3
C onstruction ofc-m yc-expressing strains
The strain containing the target c-myc-lacZ fusion sequence has previously been described (Fig. 5.4A; Arndt et al., 2000). The fusion gene encodes a protein with β-galactosidase activity, and as the target sequence is fused to the 5’ end of the lacZ gene, gene silencing of the c-myc sequence will also result in down-regulation of lacZ expression. A 792bp antisense c-myc fragment from exon 2 of the human c-myc gene (named CM-17) was previously found to suppress β−galactosidase activity within the c-myc-lacZ fusion target strain (AML1) by 47% (Arndt et al., 2000). The region of the c-myc-lacZ target to which this fragment is homologous is shown in Figure 5.4B. The CM-17 fragment was subcloned into the BamHI site of pREP4 in the sense orientation to generate pN12-1. The antisense cmyc vector (pCM-17) and the sense c-myc vector were then transformed into AML1, both independently and together.
5.2.4
C onstruction ofthe ded1 plasm id
The ded1 ORF (accession number AJ237697) was amplified from fission yeast genomic DNA (strain 1913). The forward primer 5DED1-BAMHI and the reverse primer 3DED1BAMHI were used to produce BamHI ends. The PCR amplicon was then subcloned, in the sense orientation, into the BamHI site of pREP4 and pREP2 (Maundrell, 1993). pREP4 is identical to pREP2 except that the S. cerevisiae LEU2 gene has been replaced with the S. pombe ura4 selectable marker. 118
Chapter 5
dsRNA-mediated gene silencing in fission yeast
5.3
Results
5.3.1
Expression of additional sense R N A enhances antisense R N A -
m ediated targetgene suppression It has been demonstrated that co-expression of antisense RNA with additional sense RNA can enhance gene silencing (Waterhouse et al., 1998). This is thought to be due to the potential formation of additional dsRNA which may induce an RNAi-like mechanism (Bruening, 1998). To determine whether gene suppression in fission yeast is due to formation of an antisense RNA:target mRNA hybrid or an antisense RNA:sense RNA hybrid, a version of lacZ which is unable to be translated into functional β−galactosidase (described here as non-coding lacZ) was co-expressed in strains expressing the target and antisense lacZ genes. If antisense RNA is required to hybridise to target mRNA for inhibition of the gene expression pathway, then over-expression of the sense RNA would compete with the target mRNA for the available antisense molecules producing a decrease in lacZ gene suppression. Initially, both the antisense lacZ gene and the non-coding lacZ gene were integrated in single-copy into separate target strains and then these strains were crossed. In the strain containing the antisense gene alone, β−galactosidase activity was reduced by approximately 35% while there was no reduction in the strain expressing sense lacZ alone (Fig. 5.1A). Surprisingly, in the strain expressing both complementary transcripts (antisense + sense), the level of gene silencing was not only maintained but moderately enhanced (Fig. 5.1A). To further increase the potential formation of intracellular dsRNA, an episomal sense lacZ plasmid (pM54-3) was co-transformed with the episomal antisense lacZ plasmid (pGT2) into the target strain RB3-2. When both RNAs were co-expressed in RB3-2, the target lacZ gene was suppressed by 70% compared to 55% in the strain expressing the antisense plasmid alone (Fig. 5.1B). Northern analysis demonstrated that the total relative level of episomally expressed nmt1-driven RNA in the strain transformed with both sense 119
Chapter 5
dsRNA-mediated gene silencing in fission yeast
and antisense genes was approximately equal to the sum of that seen when either plasmid was expressed alone. Additionally, there was a concomitant reduction in the steady-state level of target mRNA with a lower signal present in the strain containing both sense and antisense genes compared with the strain containing antisense alone (Fig. 5.1C). These results demonstrate that the presence of additional sense RNA does not titrate the antisense RNA from the target mRNA and therefore suggests that dsRNA is a central component in antisense RNA-mediated gene silencing (Waterhouse et al., 1998). Overall, these data indicate that increasing the potential formation of dsRNA, but not necessarily an antisense RNA:target mRNA hybrid, is required for efficient interference of target gene expression in S. pombe.
120
Chapter 5
dsRNA-mediated gene silencing in fission yeast
Fig. 5.1 Effect of increasing target RNA in antisense-expressing strains. (A) Strains containing the target lacZ gene alone (control), the target and the antisense lacZ genes (antisense), the target and the non-coding lacZ genes (sense), and the target and both the antisense and non-coding lacZ genes (antisense + sense) were assayed for β−galactosidase activity in the absence of thiamine. (B) β−galactosidase activity was determined in the strain RB3-2 transformed with the antisense lacZ episomal plasmid (antisense), the non-coding lacZ episomal plasmid (sense), or both antisense and non-coding lacZ plasmids (antisense + sense). For each strain three independent colonies were assayed in triplicate. (C) RNA from episomally-transformed RB3-2 strains was probed with the nm t1 fragment (top panel), then stripped, and re-probed with the ura4 3’ fragment (lower panel). The relative levels of target and episomally-expressed lacZ RNA was quantitated by phosphorimage analysis. 121
Chapter 5
5.3.2
dsRNA-mediated gene silencing in fission yeast
A lacZ panhandle R N A inhibits lacZ gene expression
To confirm that dsRNA is central to efficient antisense RNA-mediated gene silencing in fission yeast a lacZ panhandle construct, which is predicted to form a strong intramolecular RNA duplex, was expressed in the target strain RB3-2 (Fig. 5.2A). A single-copy of the lacZ panhandle-encoding gene was initially integrated into the target strain and lacZ gene activity was analysed. A β−galactosidase assay showed no reduction in target enzyme activity when transcription of the lacZ panhandle was activated (data not shown). However, RNA analysis indicated that the 6.2 kb panhandle transcript was being generated in this strain (Fig. 5.2B). Initially, this indicated that the panhandle RNA did not inhibit target gene activity in this system. Since the effect of antisense RNA was previously shown to be dose-dependent efforts were made to elevate the steady-state level of the panhandle RNA. As episomal plamids are maintained in multicopy a higher steady-state level of panhandle RNA can be generated. When expressed in RB3-2, the episomal plasmid pM531 inhibited β−galactosidase activity by approximately 40% (Fig. 5.2C), while addition of thiamine to the culture medium returned β−galactosidase activity to control levels indicating that lacZ inhibition was dependent on expression of the panhandle gene. Interestingly, the variation in β-galactosidase activity was greater in strains containing the inverted repeat structure as can be seen from the error bars shown in Figure 5.2C. Northern analysis was then performed to show that the episomally-based panhandle gene was expressed at a similar level to the antisense lacZ gene and ten-fold higher than in the integrant containing a single-copy of the panhandle gene (Fig. 5.2B). To investigate whether expression of the panhandle RNA was impacting on the cellular phenotype of these transformants, cultures were grown to mid-logarithmic phase and then viewed under the light microscope. It was observed that there was no difference in the growth rate of the panhandle-containing strain compared to control cells lacking this construct. Furthermore, there was no difference in the general morphology of the cells (Fig. 5.2D). These data indicated that a construct capable of forming an intramolecular RNA duplex could inhibit target gene activity in a dose-dependent manner.
122
Chapter 5
dsRNA-mediated gene silencing in fission yeast
Fig. 5.2 lacZ panhandle-mediated gene silencing. (A) The lacZ panhandle construct contains the full-length lacZ gene (with an internal frameshift mutation) followed by the inverted 5’ 2.5 kb lacZ fragment. Intramolecular hybridisation generates an RNA with 2.5 kb RNA duplex and a 1 kb loop. The nm t1 promoter and terminator sequences are indicated by P and T, respectively. (B) The relative steady-state level of the panhandle lacZ RNA (6.2 kb) expressed from single- and multi-copy genes is shown in comparison to episomally-expressed antisense lacZ RNA (3.7 kb). The lacZ signals were normalised to the endogenous nm t1 transcript (1.3 kb) and quantitated by phosphorimage analysis. (C) The target strain was transformed with the episomally-expressed lacZ panhandle gene and analysed for β−galactosidase activity. The appropriate plasmids were co-introduced to complement auxotrophy. The panhandle strain was assayed in the presence of thiamine (grey). At least three independent colonies were assayed in triplicate for each strain. (D) Cells were grown to mid-logarithmic phase and visualised for cell morphology under the light microscope. 123
Chapter 5
5.3.3
dsRNA-mediated gene silencing in fission yeast
In vivo analysis ofdsR N A form ation
Although in silico analysis predicts that the panhandle construct would form a strong intramolecular RNA duplex we wished to establish that this occurred in vivo. To test the ability of the panhandle construct to form dsRNA in vivo, the frameshifted lacZ fragment was replaced with a functional BamHI lacZ fragment in the vectors pM54-3 and pM53-1, to generate the vectors pM85-1 and pM81-2, respectively (Fig. 5.3A). The vector pM91-1, which is unable to form a lacZ panhandle transcript, was generated by removing the 2.5 kb NotI lacZ fragment from pM81-2 and re-introducing it in the sense orientation (Fig. 5.3A). These vectors were then transformed into the strain 2037 (h+, ura4-D18) which does not contain the integrated lacZ target cassette. The resulting transformants were then overlaid with X-gal-containing agarose and assayed for generation of the blue-colour colony phenotype. Both strains containing control vectors (pM85-1 and pM91-1) generated high levels of β−galactosidase while the strain expressing the lacZ inverted repeat did not (Fig. 5.3B). Northern analysis confirmed that the strain containing pM81-2 was expressing the transgene (Fig. 5.3C). These results indicated that the panhandle RNA could not be efficiently translated to produce β−galactosidase, most probably due to the formation of a strong intramolecular hairpin structure. It should be noted that the 5' UTR and 3' UTR regions of the panhandle cassette are not complementary. Therefore, inefficient translation would not be due to inability of the mRNA to associate with the ribosomal machinery unless the 5’ UTR also underwent strong intramolecular hybridisation. Taken together, these results indicated that a construct encoding a panhandle RNA has the ability to form dsRNA in vivo by intramolecular hybridisation.
124
Chapter 5
dsRNA-mediated gene silencing in fission yeast
Fig. 5.3 In vivo dsRNA assay. (A) The constructs employed for assaying the ability of the lacZ inverted repeat to form an intramolecular RNA duplex are shown. Each vector contains a functional lacZ fragment which gives the transformed strain a blue color phenotype when grown in the presence of X-gal. (B) The strain 2037 was transformed with the vectors pM85-1, pM91-1 and pM81-2 in the absence of thiamine. Single colonies were streaked onto minimal media plates and overlayed with 0.5% agarose medium containing 500 µg/ml X-gal and 0.01% SDS. (C) Northern blot of 2037/pM81-2 RNA probed with the nm t1 fragment. The panhandle transcript (6.2 kb) and the endogenous nm t1 transcript (1.3 kb) are shown.
125
Chapter 5
5.3.4
dsRNA-mediated gene silencing in fission yeast
C o-expression of antisense and sense R N A enhances inhibition
ofa c-myc target To test the ability of dsRNA to specifically interfere with other target sequences in fission yeast, complementary c-myc sequences were co-expressed in a strain containing an integrated c-myc-lacZ fusion cassette (Fig. 5.4A) (Arndt et al., 2000). β−galactosidase assays demonstrated that co-expression of the antisense and sense c-myc constructs enhanced c-myc suppression by an additional 13% compared with the antisense c-myc vector alone, while expression of pN12-1 alone showed no inhibition of enzyme activity (Fig. 5.4C). Transformation of RB3-2 (the strain expressing only the lacZ target) with the antisense and sense c-myc constructs resulted in no down-regulation of β−galactosidase activity indicating that the action of dsRNA is sequence-specific (Fig. 5.4C). Northern analysis demonstrated that the c-myc constructs were being expressed in all strains analysed (Fig. 5.4D). The RNA was probed with the nmt1 fragment (Section 2.9.2) which hybridises to both the endogenous nmt1 sequence (1.3 kb) and the episomally-expressed c-myc sequences (1.1 kb). Normalisation of the c-myc RNA to the endogenous nmt1 transcript indicated that both antisense and sense constructs were being expressed in the cotransformed strains as the steady-state level was approximately equivalent to the sum of that seen in the strains transformed with the sense or antisense constructs only (Fig. 5.4D).
126
Chapter 5
dsRNA-mediated gene silencing in fission yeast
Fig. 5.4 dsRNA-mediated suppression of a c-m yc target. (A) The AML1 strain contains a c-m yc-lacZ fusion cassette integrated at the ura4 locus. Exons 2 and 3 of the human c-m yc gene were employed as a target. The transcription initiation site is indicated by the bent arrow. The straight arrow represents the normal direction of transcription for a particular DNA fragment. (B) The region of the c-m yc target from which the antisense fragment was derived is shown. The fragments are aligned to the illustration in (A). (C) The target strains AML1 and RB3-2 were transformed with the sense construct pN12-1 (sense), the antisense construct pCM-17(antisense), or both (antisense + sense). Transformants were grown in the absence of thiamine and assayed for β−galactosidase activity. Strains were transformed with appropriate control plasmids to complement auxotrophy. (D) RNA was probed with the nm t1 fragment. The control strain did not contain the episomally-expressed c-m yc sequence (1.1 kb) but shows the endogenous nm t1 transcript at 1.3 kb.
127
Chapter 5
dsRNA-mediated gene silencing in fission yeast
C o-expression ofthe ded1 helicase w ith antisense genes
5.3.5
Data has been presented which indicates that antisense RNA inhibits target gene expression through a dsRNA intermediate. This is similar to PTGS in plants and RNAi in animals. It has recently been hypothesised that an RNA helicase is involved in dsRNA-mediated gene silencing (Bass, 2000). If antisense RNA acted by hybridising to target mRNA and directly inhibiting translation, it would be expected that over-expression of an RNA helicase would decrease the effectiveness of the antisense molecule by unwinding the RNA duplex. We therefore tested the ability of the S. pombe ATP-dependent RNA helicase gene, ded1 (Grallert et al., 2000), in enhancing PTGS by co-expressing it with various antisense genes in fission yeast (Fig. 5.5A). This protein is involved in translation initiation in S. pombe (Grallert et al., 2000). This particular DEAD-box protein was chosen for two main reasons. First, translation initiation factors have previously been shown to be involved in PTGS in other organisms (Tabara et al., 1999; Catalanotto et al., 2000; Fagard et al., 2000). Secondly, according to current models of dsRNA-mediated gene regulation, an ATPdependent RNA helicase may act in conjunction with a dsRNA-dependent RNA polymerase for the formation of cRNA antisense fragments which specifically degrade target mRNA (Bass, 2000; Zamore et al., 2000). Co-expression of ded1 from the pREP4 plasmid and the antisense lacZ from the pREP2 plasmid significantly enhanced PTGS of lacZ by a further 50% compared to the control strain (Fig. 5.5B). When ded1 was over-expressed in the absence of the antisense lacZ vector, β-galactosidase activity was comparable to control strains indicating that the ded1 effect was dependent on the presence of antisense RNA. The ded1 vector was also coexpressed with a short 5' antisense lacZ plasmid (pGT59) which has previously been shown to be less effective than the full-length antisense gene (Arndt et al., 1995). Again, the overexpression of ded1 stimulated dsRNA-mediated lacZ inhibition. When the ded1 gene was co-expressed with a short 3' antisense lacZ plasmid (pGT61), which demonstrates negligible suppression (Arndt et al., 1995), no enhancement of gene silencing was observed.
128
Chapter 5
dsRNA-mediated gene silencing in fission yeast
Fig. 5.5 Co-expression of antisense lacZ genes and ded1. (A) The long (pGT2), short 5' (pGT59), and short 3' (pGT61) lacZ antisense constructs are shown in relation to the target lacZ cassette. (B) β-galactosidase assay of antisense lacZ and ded1 co-transformants. Three colonies were assayed in triplicate for each strain. (C) Light microscopic analysis of ded1 transformants. The strain RB3-2 was co-transformed with the plasmids indicated.
129
Chapter 5
dsRNA-mediated gene silencing in fission yeast
When ded1 was expressed from a ura4-based plasmid (pREP4) there was no impact on the phenotype of the transformed strain (Fig. 5.5C). However, in agreement with the previous observation of Forbes et al. (1998), ded1 expression from the weakly complementing LEU2-based plasmid (pREP2) caused aberrant morphology of transformed cells (Fig. 5.5C). This is most likely due to differences in copy number of ura4 and LEU2-based plasmids (Heyer et al., 1986; Brun et al., 1995). As LEU2-based plasmids are usually maintained in a higher copy than ura4-based plasmids there would be a consequent increase in the steady-state level of ded1 which would produce a threshold of the protein that impacts on the cell cycle. The increased steady-state level of the RNA expressed from the LEU2-based plasmids can clearly be seen in Figure 5.4D (antisense lanes). Following normalisation to the endogenous nmt1 signal, the antisense c-myc transcript from pREP2 (antisense lanes) was found to be approximately two-fold higher than the sense c-myc transcript generated from pREP4 (sense lane) (Fig. 5.4D). The above observations confirmed that the amplified ORF was generating functional ded1 protein. In conclusion, these data indicate that the host-encoded ATP-dependent RNA helicase, ded1, can enhance PTGS efficacy when co-expressed with effective antisense RNA molecules.
130
Chapter 5
dsRNA-mediated gene silencing in fission yeast
5.4
Discussion
5.4.1
Sum m ary
PTGS encompasses a variety of phenomena which are implicated in the cellular control of gene expression and defense against viral infection (Fire, 1999). PTGS includes antisensemediated gene suppression, co-suppression and dsRNA-mediated gene interference (RNAi in animals). Recent evidence suggests that all of these gene-silencing categories may operate through similar mechanisms with the generation of dsRNA being the key factor (Montgomery and Fire, 1998). This chapter investigated whether dsRNA is the central component of antisense RNA-mediated gene silencing in fission yeast. The findings presented here showed that increasing the intracellular concentration of sense lacZ RNA results in an enhancement of antisense RNA-mediated lacZ inhibition. This was achieved by expressing a version of the lacZ gene which did not generate functional β-galactosidase enzyme. When this gene was expressed in multi-copy compared to single-copy, gene silencing was further increased suggesting that this effect was dependent on the dose of dsRNA. A concomitant reduction in the steady-state level of target mRNA was also observed which is consistent with PTGS. The specificity of this phenomenon was demonstrated by targeting a c-myc-lacZ fusion gene with c-myc antisense and sense constructs. When present at a high intracellular concentration a panhandle lacZ RNA transcript, which was capable of forming 2.5 kb dsRNA in vivo, was also shown to inhibit β-galactosidase activity. Additionally, we investigated the role of the fission yeast ATPdependent RNA helicase, ded1. It was observed that co-expression of ded1 with antisense lacZ constructs dramatically increased target gene silencing, consistent with its hypothesised role in RNAi. This was further evidence for antisense RNA operating through an RNAi-like mechanism in S. pombe.
131
Chapter 5
5.4.2
dsRNA-mediated gene silencing in fission yeast
C o-expression ofantisense and sense R N A
If antisense RNA was acting by hybridising to its target mRNA and directly inhibiting translation, it would follow that excess non-coding sense RNA would act as a competitor of the antisense RNA:target mRNA interaction. This competitive reaction would titrate the available antisense RNA allowing for coding sense mRNA to be translated with a consequent reduction in target inhibition. However, additional expression of both genomic and episomal non-encoding lacZ sense RNA failed to increase the level of β-galactosidase activity, but instead stimulated gene suppression. Experiments presented earlier in this thesis had focused on the common observation that antisense RNA-mediated suppression functions in a dose-dependent manner. As shown in Chapter 3, the level of suppression within a given yeast strain was dependent upon the intracellular concentration of antisense RNA. Similarly, results from this chapter suggested that gene silencing was also dependent on the concentration of sense RNA. The steady-state level of sense RNA was increased by first expressing this RNA from a single copy (stably-integrated) and then from multiple copies (episomally maintained) in lacZ-expressing strains. Episomal co-expression of the complementary lacZ RNAs resulted in moderately enhanced gene silencing compared with their co-expression in single copy. This suggested that dsRNA was functioning in a dosedependent manner. Consistent with PTGS in other organisms, the increase in gene silencing was associated with a concomitant reduction in lacZ mRNA. The specificity of dsRNAmediated gene interference was also demonstrated by targeting a c-myc-lacZ fusion gene with co-expressed sense and antisense c-myc constructs. In this case, enhanced gene silencing was observed when additional c-myc RNA was generated while there was no effect of c-myc dsRNA on the lacZ target gene alone. These results agree with those of Waterhouse and co-workers (1998) who used plant systems to genetically manipulate the levels of complementary RNAs. They demonstrated inhibition of reporter and viral genes in plants using gene constructs encoding both sense and antisense RNAs. Transformation of either sense or antisense constructs alone was much less effective at silencing the target genes than when both were co-expressed. These results are consistent with those obtained using target lacZ genes under control of both weak and strong constitutive promoters (G.M. Arndt and D. Atkins, 132
Chapter 5
dsRNA-mediated gene silencing in fission yeast
unpublished data). In that study, a low-level expressing strain containing the lacZ gene driven by the SV40 early promoter integrated at the ura4 locus in chomosome III (Arndt et al., 1995) was transformed with the lacZ antisense plasmid, pGT2. The low expressing lacZ strain expressed 20-fold less lacZ mRNA than RB3-2, while an approximate 40-fold decrease in β−galactosidase was also detected (G.M. Arndt and D. Atkins, unpublished data). β−galactosidase assays indicated that the antisense RNA suppressed β−galactosidase activity by 45% in the low-expressing lacZ strain while the same steady-state level of antisense RNA reduced β−galactosidase activity by 55% in RB3-2 (G.M. Arndt and D. Atkins, unpublished data). Those results indicated that despite a 20-fold increase in the steady-state level of the lacZ target mRNA in RB3-2 the efficacy of antisense-mediated down-regulation was not only maintained, but enhanced. These data suggested that an increase in target mRNA can also result in enhanced target gene suppression which is consistent with the results presented in this chapter. Including the results from that study, a range of lacZ gene silencing (45% to 70%) has been observed when the same pool of antisense RNA has been expressed in the presence of varying levels of sense RNA. This may have implications on targeting endogenous genes with antisense RNA. For example, if the target gene is expressed at very low levels the resulting level of dsRNA will also be low even if the antisense gene is under control of a strong promoter. This may be one reason why previous attempts to silence fission yeast genes have been unsuccessful (Atkins et al., 1995). The question arises as to why complete gene silencing has not been observed in this system. First, it must be noted that genes have been expressed from episomal plasmids. It is well known that S. pombe undergoes asymmetric segregation, with the result that mitosis produces a daughter cell which lacks the segregating plasmid (Heyer et al., 1986). Therefore, only a sub-population of cells will actually contain a particular plasmid. Previous studies have shown that ura4-based plasmids are contained in approximately 73% of the total cell population (G.M. Arndt and D. Atkins, unpublished data; Brun et al., 1995) while LEU2-based plasmids have a mitotic stability of 62% to 95% (G.M. Arndt and D. Atkins, unpublished data; Heyer et al., 1986; Brun et al., 1995). Therefore, the level of inhibition of β-galactosidase activity has been under-estimated in the present study due to segregation of both the antisense- and ded1-encoding plasmids. Secondly, the lack of PTGS 133
Chapter 5
dsRNA-mediated gene silencing in fission yeast
potency may be due to the evolutionary divergence of this organism or the possibility that PTGS is not critical for gene regulation in fission yeast. Additionally, S. pombe is a rapidly dividing unicellular organism which may result in a robust dilution of any small processed dsRNAs required for effective RNAi. It has also been shown that, even in organisms in which RNAi acts in sub-stoichiometric amounts, the gene-silencing effect is more robust when higher doses of dsRNA are introduced (Bass, 2000).
Expression ofpanhandle lacZ R N A
5.4.3
Expression of a lacZ panhandle construct also inhibited target gene expression consistent with the prediction that dsRNA was the integral factor in antisense RNA-mediated gene silencing. A construct which generated a transcript with a 1 kb loop and 2.5 kb of intramolecular complementarity inhibited the lacZ gene by approximately 40%. A novel in vivo assay suggested that a similar construct, which contained functional lacZ sequences, was indeed forming an intramolecular RNA duplex since β-galactosidase activity was largely inhibited. This concurs with the previous demonstrations that large inverted repeats can form intramolecular duplexes both in vitro and in vivo (Liley, 1981; Zheng and Sinden, 1988). The ability of a sequence with the potential to form an intramolecular RNA duplex to inhibit target gene expression is consistent with the use of similar constructs in plants (Waterhouse et al., 1998), nematodes (Tavernarakis et al., 2000) and trypanosomes (Shi et al., 2000). It has been suggested in these previous studies that genes capable of forming intramolecular RNA duplexes are more efficient at inhibiting target genes than antisense RNA alone. In contrast, results presented here showed little difference between gene inhibition by panhandle and antisense RNA. This may be due to the following reasons. First, it has recently been demonstrated that panhandle constructs are less effective at inhibiting target genes than hairpin RNA produced from direct inverted repeats (Smith et al., 2000). Secondly, homologous recombination occurs with high frequency in fission yeast which may cause instability of the panhandle construct. It is also well known that long inverted repeats can lead to genomic instability in prokaryotes and lower eukaryotes (Gordenin and Resnick, 1998). For example, inverted repeats in E. coli are rapidly deleted 134
Chapter 5
dsRNA-mediated gene silencing in fission yeast
and may lead to cell necrosis in some cases (Warren and Green, 1985). Artificially generated inverted repeats are approximately three orders of magnitude more unstable than direct repeats in budding yeast (Lobachev et al., 1998). It was also observed in this thesis that there was a greater variation between the blue-colour colony phenotype of primary fission yeast transformants which contained the panhandle construct compared to control transformants (data not shown). This suggested that there was either a greater variation in the suppressive effect of the panhandle or a moderate level of plasmid instability.
5.4.4
Expression ofan A TP-dependentR N A helicase
The dose-dependency of dsRNA-mediated gene silencing in fission yeast described in both Chapter 3 and the present chapter has allowed for the use an over-expression strategy to test genes involved in PTGS. In comparison to mutagenesis strategies, over-expression can enable the identification of genes which are otherwise essential for cell viability. Also, cellular factors that quantitatively enhance or reduce PTGS activity can be determined. The first gene that was tested in mediating antisense RNA-mediated gene regulation in the present model was the S. pombe ATP-dependent RNA helicase gene, ded1 (Grallert et al., 2000). Ded1 is an essential gene which has previously been characterised as a suppressor of sterility (Forbes et al., 1998), a suppressor of checkpoint and stress response (Kawamukai, 1999), and a general translation initiation factor (Grallert et al., 2000). According to current models of dsRNA-mediated gene regulation, an ATP-dependent RNA helicase may be required in conjunction with a dsRNA-dependent RNA polymerase for the formation of short single-stranded RNA fragments which target specific mRNAs for degradation (Zamore et al., 2000; Bosher and LaBouesse, 2000; Bass, 2000). It was therefore reasoned that over-expression of this gene in fission yeast might enhance the efficiency of dsRNAmediated gene silencing by stimulating the unwinding of dsRNA. Co-expression of the ded1 gene with the long antisense lacZ gene significantly enhanced dsRNA-mediated lacZ inhibition by a further 50% compared to control strains. When ded1 was over-expressed in the absence of the antisense lacZ vector, β-galactosidase activity was comparable to control strains indicating that the observed effect of ded1 over-expression was dependent on the presence of dsRNA. When the ded1 vector was co-expressed with a short antisense lacZ 135
Chapter 5
dsRNA-mediated gene silencing in fission yeast
vector, which has previously been shown to be less effective than the full-length antisense gene (Arndt et al., 1995), antisense RNA-mediated lacZ inhibition was also enhanced. In contrast, when ded1 was co-expressed with an ineffective antisense plasmid no enhancement was observed. These results suggested that ded1-mediated augmentation of gene silencing was dependent on an antisense RNA that was capable of some partial gene inhibition. This could be due to the absence of RNA duplex formation with the ineffective antisense RNA and the consequent lack of a substrate for the RNA helicase. This would be consistent with the role of an RNA helicase in dsRNA-mediated gene silencing. The ded1 gene was expressed from ura4-based plasmids in this study. It has previously been shown that over-expression of ded1 from a LEU2-based plasmid generates an elongated cellular phenotype which is linked to disruption of cell-cycle progression (Forbes et al., 1998). In agreement with this, we also demonstrated an elongated cellular phenotype when expressing the helicase gene from a similar plasmid. The S. cerevisiae LEU2 gene weakly complements the fission yeast leu1-32 mutation, while the ura4 marker originates from S. pombe and shows stronger complementation (Moreno et al., 1991). This leads to a higher copy number of LEU2-based plasmids. It is therefore proposed that a window of additional ded1 expression is required for the antisense-enhancing phenotype. If an excessive amount of ded1 is expressed then the mutant cell-cycle phenotype is observed. Although an ATP-dependent RNA helicase has recently been suggested to be a key component in dsRNA-mediated gene silencing (Bass, 2000), this is the first clear demonstration of its involvement. Further, ded1 may be rate-limiting, since the overexpression leads to increased PTGS activity in this system. This ability of the ded1encoded RNA helicase is consistent with its activities as a member of the DEAD box family of helicases, with their three core domains of ATPase, RNA helicase, and RNAbinding activities (de la Cruz et al., 1999). These could allow the enzyme to enhance gene suppression as follows: (i) in a dissociative mechanism it could mediate either the unwinding of dsRNA to generate a cRNA in conjunction with an RNA-dependent RNA polymerase (Bosher and LaBouesse, 2000) or strand separation of fragmented dsRNA to enhance binding to homologous transcripts (Zamore et al., 2000), and/or (ii) in an associative mechanism it could catalyse the ATP-dependent exchange of the sense strand of the short dsRNA with the target mRNA (Bass, 2000). The presence of ded1 homologues in 136
Chapter 5
dsRNA-mediated gene silencing in fission yeast
other organisms displaying PTGS further supports the general involvement of this component in the PTGS machinery.
5.4.5
PTG S in fission yeast
The data presented in this chapter has indicated that dsRNA is central to antisense RNAmediated gene silencing in S. pombe. Recent evidence has indicated that PTGS in plants, RNAi in nematodes, and cosuppression in both Neurospora and C. elegans share similar mechanisms (Cogoni and Macino, 1999a; Ketting et al., 1999; Tabara et al., 1999; Ketting and Plasterk, 2000; Dernburg et al., 2000; Smardon et al. , 2000). There is also evidence to suggest that fission yeast shares an analogous mechanism and that gene silencing is probably occurring at the post-transcriptional level. First, homologues of several proteins that have been shown to be involved in these different forms of PTGS also exist in fission yeast, including the dsRNA-dependent RNA polymerase (Cogoni and Macino, 1999a), the RecQ DNA helicase (Cogoni and Macino, 1999b), and the putative translation initiation factor, rde-1 (Tabara et al., 1999). Secondly, antisense RNA-mediated gene silencing in fission yeast has all the hallmarks of PTGS including a reduction in the steady-state level of the target mRNA, sequence-specific gene silencing, and enhanced gene inhibition with expression of additional sense RNA. Thirdly, it has been shown that over-expression of the translation factor ded1, enhances antisense RNA–mediated gene regulation. While transcriptional gene silencing could be possible though triplex formation with the primary DNA sequence it is not clear how expression of additional sense RNA or how an RNA helicase could facilitate gene silencing if this was the mechanism of antisense RNA action. Clearly, the primary function of an RNA helicase is to remove RNA secondary structures and this is a post-transcriptional event. However, although genetic interference at the posttranscriptional level in S. pombe is favoured, transcriptional gene silencing cannot be completely ruled out. To further clarify this issue the rate of target gene transcription in antisense RNA-expressing fission yeast strains could be investigated. While dsRNA has been shown to be central to antisense RNA-mediated gene silencing in fission yeast, it is not as robust as that seen in other organisms. It has been suggested that this may be due to the rapid cell metabolism of S. pombe and a possible 137
Chapter 5
dsRNA-mediated gene silencing in fission yeast
dilution effect of processed dsRNA fragments. Clearly, it would be of interest to investigate the presence of small dsRNA species in this system. However, an alternative model exists to explain the observed dose effect (Chapter 7). This might involve a process in which cRNA is generated but is not fragmented into small dsRNA molecules and does not facilitate the catalytic degradation of the target mRNA. In this case one or more “PTGS factors” are either absent or being inhibited in fission yeast. This system is now ideal for screening for such host-encoded factors which both have a role in PTGS and that can enhance antisense RNA- and dsRNA-mediated gene silencing in S. pombe. For these reasons the focus of Chapter 6 will be to characterise novel host factors that enhance the efficacy of PTGS in fission yeast.
138
Chapter 6
Identification of antisense enhancing sequences
CHAPTER 6 IDENTIFICATION OF HOST CELL FACTORS THAT ENHANCE ANTISENSE RNA EFFICACY Parts of this chapter have been submitted for publication
6.1
Introduction
PTGS has been demonstrated in a number of organisms by the introduction of antisense RNA, sense RNA, or dsRNA (Murray and Crockett, 1992; Gura, 2000; Bosher and LaBouesse, 2000; Bass, 2000). There is recent evidence that all of these gene-silencing strategies share similar mechanisms, with dsRNA being the central component (Montgomery and Fire, 1998; Bosher and LaBouesse, 2000). The application of these strategies often results in only partial suppression depending upon the gene being targeted or the organism in which it is employed (Sczakiel, 1997; Fire et al., 1998). Mutagenesis of host-encoded factors has begun to unravel the mechanism of PTGS and has suggested that it may have been conserved through evolution (Cogoni and Macino, 1999a; Ketting et al., 1999; Tabara et al., 1999; Ketting and Plasterk, 2000; Smardon et al., 2000). This has led to the identification of certain non-essential factors, which, when down-regulated, affect PTGS efficiency (Section 1.5.2). These genes include ones encoding an RNA-dependent RNA polymerase [qde-1; (Cogoni and Macino, 1999a), sde1; (Dalmay et al., 2000), ego-1; (Smardon et al., 2000)], a RecQ DNA helicase [qde-3; (Cogoni and Macino, 1999b)], an RNase D homologue [mut-7; (Ketting et al., 1999)], and a putative translation initiation factor [rde-1; (Tabara et al., 1999), qde-2; (Catalanotto et al., 2000) ago1; (Fagard et al., 2000)]. In nematodes, factors have been identified that are involved in two distinct aspects of RNAi: those that are essential for RNAi initiation, and those that suppress germ-line transposon mobilisation (Grishok et al., 2000). In Drosophila, cell-free assays have also shown that RNAi is mediated by nuclease degradation of the targeted mRNA (Tuschl et al., 139
Chapter 6
Identification of antisense enhancing sequences
1999; Hammond et al., 2000) while a 25 nt RNA species appears to be integral to specific post-transcriptional genetic interference (Hamilton and Baulcombe, 1999; Hammond et al., 2000). RNAi has also been shown to be dependent on ATP which may be required for strand dissociation of dsRNA (Zamore et al., 2000; Bass, 2000). This processing of dsRNA and specific degradation of homologous mRNA indicates that there may be several additional factors that are involved in PTGS that, as yet, have not been identified. In addition to proteins involved in RNAi, it has been shown that other host-encoded factors exist which can affect antisense RNA-based gene silencing (Section 1.6.2). These include RNA-binding proteins such as ADAR , and others which promote the annealing of RNA duplexes such as hnRNP A1 (Portman and Dreyfuss, 1994), or degrade dsRNA such as RNase III (Fierro-Monti and Mathews, 2000). Furthermore, RNA helicases, which have many varied roles in RNA biology, may also be involved in PTGS as suggested by the work presented in Chapter 5. In comparison with mutagenesis strategies, the identification of other factors which, when over-expressed, can enhance PTGS is equally important for both elucidating the gene silencing pathway and for enhancing gene silencing in recalcitrant systems. In this chapter a genetic screening approach was employed to identify several host-encoded factors which dramatically enhance target gene silencing when co-expressed with antisense RNA in fission yeast. These factors were named antisense enhancing sequences (to be referred to as aes factors). It is also shown that one of the aes factors enhances gene silencing mediated by a lacZ panhandle construct, providing a further link between these forms of PTGS.
140
Chapter 6
Identification of antisense enhancing sequences
6.2
Methods
6.2.1
C onstruction ofthi1 plasm id
The thi1 ORF (accession number 6523770) was initially PCR-amplified from genomic DNA (strain 1913) using the primers 5THI1-BGLII and 3THI1-BGLII (Section 2.7) to generate an amplicon with BglII ends. This was then subcloned into the BamHI site of pREP4 in the sense orientation. pREP4 is identical to pREP2 except that the S. cerevisiae LEU2 gene has been replaced with the S. pombe ura4 selectable marker (Maundrell, 1993).
6.2.2
Screening strategy for novelantisense enhancing sequences
While host-encoded factors can be systematically tested for their ability to affect PTGS, the current system was also amenable for genetically screening unknown genes that may also be involved in PTGS. To this end, a screening strategy was developed using the current lacZ fission yeast system (Fig. 6.1). The key component of this strategy was the ability to semi-quantitatively screen large numbers of fission yeast transformants based on the bluecolour colony phenotype (Arndt et al., 2000). Over-expression of a fission yeast cDNA library in this system was initially examined. The S. pombe cDNA library, REP/S.p., was a generous gift from Chis Norbury (ICRF Cell Cycle Group, Oxford) and was originally constructed in the plasmid pREP3Xho (Moreno and Nurse, 1994). pREP3Xho is derived from pREP3 which contains the LEU2 marker and the conditional nmt1 promoter (Maundrell, 1993). Hemi-C-methylated cDNA was generated from polyA+ RNA using a BamHI/NotI-polyT linker primer, and SalI adaptors containing a PacI site were blunt-end ligated to it. The cDNA was then cleaved with BamHI, size-selected, and directionally cloned into SalI/BamHI-prepared REP3Xho.
141
Chapter 6
Identification of antisense enhancing sequences
Fig. 6.1 Over-expression screening strategy for PTGS modulating factors. A target strain containing the integrated lacZ gene under control of the adh1 promoter and the episomal vector containing the nm t1-driven lacZ antisense gene was transformed with an S.pom be cDNA library. Library fragments were driven by the nm t1 promoter. Transformants were individually screened for a change in the lacZencoded blue-colour colony phenotype and then transformants of interest were further characterised.
142
Chapter 6
Identification of antisense enhancing sequences
A total of 5 µg of library DNA was transformed into the strain RB3-2 containing the episomal antisense lacZ plasmid, pREP4-lacZAS, and grown in EMM liquid media to midlogarithmic phase. The plasmid pREP4-lacZAS was generated by sub-cloning the BamHI lacZ fragment from pGT2 into the plasmid pREP4 (Maundrell, 1993). Transformants were plated on EMM solid media and grown at 30ºC for 3 days. Colonies were overlaid with medium containing 0.5 M sodium phosphate, 0.5% agarose, 2% dimethylformamide, 0.01 % SDS, and 500 µg/ml X-gal (Arndt et al., 2000). Plates were then incubated at 37ºC for 3 h, and colonies which demonstrated a change in phenotype (light blue compared to background) were recovered from the agarose bed and streaked on selective medium for further analysis. To determine whether the enhanced gene suppression was mediated through antisense RNA, the antisense plasmid was segregated from these transformants. Strains were plated on EMM containing limiting uracil and 1 mg/ml 5-fluoroorotic acid (Moreno et al., 1991) and then replica-plated on both selective and non-selective media. Those colonies that did not grow on selective media were identified as having lost the ura4-containing antisense plasmid. The segregants containing only the host factor plasmid were then assayed for β-galactosidase activity.
143
Chapter 6
Identification of antisense enhancing sequences
6.3
Results
6.3.1
O ver-expression
of a
transcriptional activator enhances
antisense R N A efficacy It was demonstrated in the previous chapter that over-expression of the fission yeast ATPdependent RNA helicase, encoded by the ded1 gene (Grallert et al., 2000), could dramatically enhance antisense RNA-mediated gene silencing. The over-expression strategy was now further utilised for identifying additional factors that can enhance PTGS in fission yeast. As a test to demonstrate that other host-encoded factors could be used to modulate antisense RNA-mediated gene silencing, the transcription factor, thi1, was coexpressed with the long antisense lacZ gene in the target strain RB3-2. Thi1 has previously been demonstrated to up-regulate transcription of several thiamine-repressible genes, including nmt1, when over-expressed in S. pombe (Frankhauser and Schweingruber, 1994; Tang et al., 1994). As the effectiveness of antisense RNA was previously shown to be dose-dependent in fission yeast (Chapter 3), it was hypothesised that up-regulation of the nmt1-driven antisense gene would enhance lacZ inhibition. The plasmid pREP4-thi1 was transformed into the strain RB3-2 containing the antisense lacZ plasmid, pGT2, and β-galactosidase assays performed. As predicted, lacZ suppression in the thi1-expressing strain was enhanced when compared to a strain expressing antisense RNA alone (Fig. 6.2A). When pREP4-thi1 was introduced into RB3-2 in the absence of the antisense plasmid no down-regulation of β-galactosidase activity was observed. As expected, Northern analysis demonstrated that over-expression of thi1 resulted in an increased level of steady-state nmt1 RNA (Fig. 6.2B). These results indicated that the transcriptional activator, thi1, could specifically enhance PTGS in fission yeast by increasing the intracellular dose of the antisense RNA. Furthermore, it suggested that additional host-encoded factors are present which affect the robustness of PTGS in fission yeast.
144
Chapter 6
Identification of antisense enhancing sequences
Fig. 6.2 Over-expression of the transcriptional activator thi1. (A) Thi1 was coexpressed with the long lacZ antisense gene in the strain RB3-2 (long antisense + thi1) and co-transformants assayed for β-galactosidase activity. RB3-2 expressing the antisense (long antisense) or thi1 (thi1) genes only were also analysed. The control strain was RB3-2 transformed with pREP2 and pREP4 (control). Three independent colonies were assayed in triplicate for each strain. (B) Northern blot analysis of RB3-2 containing the pREP2 and pREP4 (-) or pREP2 and pREP4-thi1 (+) plasmids. RNA was probed with the nm t1 fragment. The ethidium bromidestained gel indicates RNA loading.
145
Chapter 6
6.3.2
Identification of antisense enhancing sequences
Library screen for antisense enhancing plasm ids
A S. pombe cDNA library was over-expressed in an antisense lacZ expressing fission yeast strain to screen for novel host-encoded factors that would enhance gene silencing in the current system. From 12,000 transformants screened, 48 were initially identified as having a reduced blue phenotype compared with background transformants (Fig. 6.3A). Transformants also displaying an increased blue phenotype were identified but these were not analysed further. Clearly, this system also can be employed to screen for host-encoded factors that, when over-expressed, inhibit PTGS. Quantitative analysis using the liquid βgalactosidase assay showed that 25 of the 48 transformants displayed a reproducible reduction in β-galactosidase activity compared with the antisense strain alone (Fig. 6.3B). The control strain, RB3-2 transformed with pREP4-lacZAS, consistently demonstrated approximately 45% inhibition of β-galactosidase activity. The antisense lacZ gene and the host factor cDNA were both driven by the conditional nmt1 promoter. Repression of the nmt1 promoter by addition of thiamine to the culture medium resulted in a reversion to control levels of β-galactosidase activity. This indicated that the observed enhancement of suppression in these transformants was dependent on expression of the antisense RNA and/or the host factor cDNA, and that this effect was not due to other events such as lacZ target gene mutations or modification of protein stability. Following segregation of the antisense lacZ plasmid from these strains nine of the 25 transformants returned to the level of β-galactosidase activity observed in the control strain (Fig. 6.3B). Together with the above data this indicated that the enhanced gene silencing observed in these nine strains was dependent on expression of antisense lacZ RNA. The cDNAs expressed in these transformants were therefore named antisense enhancing sequences (aes factors). The remaining 16 transformants retained a suppressed level of β-galactosidase activity indicating that the reduced blue phenotype of these transformants was not dependent on the presence of lacZ antisense RNA and that the cDNA-encoded proteins in these strains were modulating lacZ gene expression by an alternative mechanism. Although these were not further characterised it would be of interest to determine their nature and mode of action of lacZ gene suppression.
146
Chapter 6
Identification of antisense enhancing sequences
Fig. 6.3 Over-expression screen of a S. pom be cDNA library. (A) Transformants were grown on minimal media plates and overlaid with X-gal-containing medium. Those that showed a reduced blue colour-phenotype (white arrow), were analysed further. Transformants demonstrating an enhanced blue-colour phenotype were also identified (black arrow). (B) Transformants which showed a visual reduction in the blue phenotype were assayed for β-galactosidase activity in liquid culture in the absence of thiamine (black histograms). Thiamine was added to the medium to repress expression of the antisense and cDNA cassettes (white histograms). Transformants were again assayed for β-galactosidase activity following antisense vector segregation (grey histograms). Asterisks indicate transformants showing an antisense-dependent enhancement of gene silencing. One colony was assayed in triplicate for each transformant. (C) Over-expression of unique aes factors in RB32/pREP4-lacZAS. Three colonies were assayed in triplicate for each transformant. 147
Chapter 6
6.3.3
Identification of antisense enhancing sequences
C haracterisation ofantisense enhancing sequences
The library plasmids were recovered from the aes-containing strains and their cDNA inserts sequenced using the upstream primer 5NMT1A and downstream primer 3NMT3C (Section 2.6.5). BLASTN and BLASTP analyses (Altschul et al., 1990) were performed on the sequenced cDNA inserts using the NCBI GenBank facility (Benson et al., 1999). Four unique aes factors were characterised. The extent of homology for each of these is shown in Figure 6.4. BLASTN analysis identified the cDNA in transformants W18, W20, and W30 (named aes2) as part of the mitochondrial elongation factor EF Tu (accession number AL049769). This corresponded to 181 amino acids (aa) of the central portion of the encoded protein (Fig. 6.4A). Approximately 50% of the cDNA sequence in transformants W21, W23, and W32 (named aes3) had complete identity to the 3' end of a putative protein (accession number D89239) that was previously identified in a screen for fission yeast ORFs (Yoshioka et al., 1997). Interestingly, this portion of aes3 also had complete homology to the antisense strand of the 3' UTR of the fission yeast gene sna41 (accession number AB001379) which has been shown to be involved in DNA replication (Miyake and Yamashita, 1998). In addition, the 5’ end of the aes3 factor was made up of an ORF that has the potential to code for an 84 aa protein containing 36 arginine-glutamic acid repeats. Such reiterations are frequently found in yeast transcription factors (Alba et al., 1999). It is thus possible that aes3 may operate through more than one mechanism in enhancing antisense RNA activity. The cDNA in transformant W47 (named aes4) was completely homologous to the antisense strand of the S. pombe ribosomal protein L7a (accession number AJ001133), a component of the 60S ribosomal subunit. Aes4 also contained a small ORF (105 aa) of unknown biological function. This protein sequence shared 52% identity with a hypothetical protein in S. cerevisiae (accession number Z73150).
148
Chapter 6
Identification of antisense enhancing sequences
Fig. 6.4 Schematic alignment of aes factors with known nucleotide and protein sequences. Regions of identity are shaded black. The length of protein sequences is followed by aa (amino acids). (A) Protein alignment of aes1 with C . albicans hypothetical protein and S.cerevisiae thymidylate synthase protein. (B) Region of S.pom be EF Tu that aligns with aes2-encoded protein. (C) Nucleotide sequence of aes3 aligns to antisense strand of S.pom be sna41 (indicated by arrow) and sense strand of S.pom be hypothetical protein (partial 3’ sequence shown). The putative aes3-encoded protein is indicated. (D) Nucleotide alignment of aes4 with antisense strand of S.pom be L7a (arrow). Possible aes4-encoded protein alignment with S. cerevisiae hypothetical protein. Accession numbers are shown in brackets. 149
Chapter 6
Identification of antisense enhancing sequences
BLASTP analysis showed that the inserts in transformants W27 and W28 (named aes1) shared 43% identity with amino acids 4 to 202 of a C. albicans hypothetical protein (accession number AJ390519) which was identified in a screen for genes essential for cell growth (Marianne De Backer, personal communication). It also shared weak homology (39% identity) with the S. cerevisiae thymidylate synthase protein (accession number NP_011894.1). The lack of identity with an S. pombe gene suggests that this sequence has not yet been entered into the fission yeast databases. The degree of homology between the S. pombe aes1 protein and the S. cerevisiae and C. albicans proteins is illustrated in Figure 6.5.
Fig. 6.5 Sequence alignment of the aes1 protein with related proteins. Sequences displayed are S. pom be (aes1), C . albicans (AJ390519), and S. cerevisiae (NP_011894.1). Identical residues are shown in black and conservative substitutions are indicated in grey. The Clusta1W algorithm (Thompson et al., 1994) was used for the alignment and the PrettyBox program (Wisconsin Package Version 10.0, Genetics Computer Group, Madison, WI, USA) was used for display. 150
Chapter 6
Identification of antisense enhancing sequences
A quantitative β-galactosidase assay showed that these co-factors enhanced antisense suppression by up to 50% when co-expressed with antisense RNA in the lacZ strain (Fig. 6.3C). In this assay three individual colonies of transformants W27 (aes1), W30 (aes2), W21 (aes3), and W47 (aes4) were assayed in triplicate. All of the aes-expressing strains displayed normal growth rates and cellular morphologies indicating that over-expression of the exogenous cDNAs did not affect general metabolism (Fig. 6.6A). Northern analysis confirmed RNA expression of selected aes factors in these strains, while transcripts of predicted sizes were observed (Fig. 6.6B). These results demonstrated that over-expression of a cDNA library was an effective way of identifying novel co-factors that magnify the suppressive effect mediated by antisense RNA.
Fig. 6.6 Expression of aes factors. (A) Microscopic analysis of transformants expressing aes factors. (B) Northern analysis of aes-containing strains. RNA was fractionated on a 1% MOPS/formaldehyde agarose gel and transferred to a nylon membrane. RNA was then probed with the nm t1 fragment. The endogenous nm t1 fragment fractionates at 1.3 kb. W30 contains aes2 (~1.2 kb), W21 contains aes3 (~0.8 kb), and W27 contains aes1 (~1.4 kb).
151
Chapter 6
6.3.4
Identification of antisense enhancing sequences
A es2 factor enhances dsR N A -m ediated gene silencing
Recent studies on PTGS suggest that antisense RNA, co-suppression, and dsRNA-mediated interference may share similar mechanisms (Fire, 1999). We therefore explored whether over-expression of an aes factor could also enhance dsRNA-mediated regulation. Having demonstrated that dsRNA could mediate gene suppression in this fission yeast model (Chapter 5), the effect of co-expressing the aes2 factor with the lacZ panhandle construct (pM53-1) in a yeast strain containing the lacZ target gene was tested. To this end, pM53-1 was either co-transformed with the control plasmid pREP2 or with the aes2 plasmid into the target strain RB3-2. Under these conditions, the aes2 transformant displayed an additional 30% suppression of β-galactosidase activity when compared to the transformant expressing only the panhandle lacZ RNA (Fig. 6.7). This result indicated that the aes2 gene, encoding part of the mitochondrial elongation factor EF Tu, could enhance both antisense RNA- and dsRNA-mediated gene inhibition.
Fig. 6.7 Co-expression of lacZ panhandle construct and aes2 factor. β-galactosidase activity was determined in co-transformants. The control strain was RB3-2 co-transformed with pREP2 and pREP4. Five independent colonies were assayed in triplicate for each strain.
152
Chapter 6
Identification of antisense enhancing sequences
6.4
Discussion
6.4.1
Sum m ary
Several proteins involved in PTGS have recently been identified though mutagenesis strategies (Bosher and LaBouesse, 2000). Some of these factors have homologues in several organisms, including fission yeast, suggesting that different categories of PTGS may share similar mechanisms as well as being conserved through evolution. This chapter has described the development of a novel over-expression strategy for the identification of additional factors that modulate PTGS in S. pombe. The systematic testing of the RNA helicase ded1 (Chapter 5), and the transcriptional activator, thi1, initially demonstrated the utility of the over-expression method. This was developed further to screen for unknown factors that might impact on PTGS. The genetic screen was based on a semi-quantitative lacZ reporter assay previously used for identifying effective antisense RNA molecules in vivo (Arndt et al., 2000). A fission yeast cDNA library was co-expressed in an antisense lacZ strain and colonies demonstrating a reduced blue-colour colony phenotype were characterised. Specifically, four unique host factors that significantly enhanced antisense RNA-mediated gene silencing were identified. These unique factors were named antisense enhancing sequences (aes). Importantly, all the identified aes factors with known functions, have natural roles in nucleic acid biology. Their parts as modulators in PTGS may be varied and could include recognition and amplification of the dsRNA, delivery of dsRNAs to the target mRNA, association between the antisense and target mRNA strands, and dsRNA complex formation. Alternatively, these modulators may control the rate of gene silencing or the formation of different complexes within cell types or for different forms of PTGS. Two of these genes (aes1 and aes2) are also known to be essential for cell viability. This novel over-expression screen therefore provides a unique approach for identifying cofactors for PTGS, especially factors essential for cell viability, and complements the more traditional mutagenesis strategies. It is also the first description of such a screen for identifying factors that impact on PTGS.
153
Chapter 6
6.4.2
Identification of antisense enhancing sequences
The over-expression strategy
A common genetic strategy for analysing the cellular function of a gene is to examine phenotypes associated with reduced gene expression levels. Previous studies have used mutagenesis approaches for identifying proteins involved in different catergories of PTGS. For example, a screen of Neurospora mutants which were defective in quelling of an endogenous gene (Cogoni and Macino, 1997b) identified several proteins involved in PTGS, including an RNA-dependent RNA polymerase (Cogoni and Macino, 1999a) and a RecQ DNA helicase (Cogoni and Macino, 1999b). A similar screen in Arabidopsis also identified mutants impaired in co-suppression (Elmayan et al., 1998), while mutagenesis of C. elegans strains have idenitified genes that are involved in RNAi (Ketting et al., 1999; Tabara et al., 1999). A common outcome of these approaches was that all of the genes identified were non-essential for cell viability (Bosher and LaBouesse, 2000). Clearly, a reason for this is that genes essential for cell growth will be selected against if their expression is perturbed. “Dominant genetics” is an alternative approach for elucidating gene function based on increasing the intracellular concentration of an endogenous gene’s encoded product and examining the resulting phenotype (Ramer et al., 1992). This may result in either supplementation of the protein or in its inhibition via a transdominant negative effect. In this chapter, a unique over-expression strategy was developed for the identification of novel host-encoded factors that enhance PTGS in fission yeast. It overcomes the major limitation of the mutagenesis approaches enabling genes which are both essential and non-essential for cell growth to be selected. It must be considered however, that over-expression of certain genes can also be deleterious to the cell, and as a result, this screening strategy may also fail to identify a subset of host genes involved in PTGS. It is therefore suggested that this approach should be used to complement mutagenesis strategies. Arndt et al. (2000) previously described an in vivo screening strategy for identifying the most effective antisense constructs against any gene of interest using the lacZ fission yeast model. In that study, conditions were identified that established a link between the blue-colour colony phenotype and the degree of lacZ-encoded β-galactosidase activity within fission yeast transformants. In this chapter similar conditions were utilised for screening the impact of a fission yeast cDNA library on the degree of antisense RNA154
Chapter 6
Identification of antisense enhancing sequences
mediated lacZ gene silencing. From 12,000 transformants 48 were initially found to have a reduced blue phenotype compared with background colonies. Approximately half of these showed a reproducible phenotype when analysed in a secondary assay. Two classes of gene silencing modulators were observed. The first acted independently of antisense RNA and may function either at the transcriptional level or by modifying the stability of the lacZencoded protein. The second class only functioned in the presence of antisense RNA and were therefore named antisense enhancing sequences (aes factors). Theoretically, the number of transformants screened was four-fold the number of genes present in the S. pombe genome (approximately 3000), however, because transformants were grown in liquid culture to mid-logarithmic phase prior to plating, it is possible that several sister colonies were screened for each transformant. This may be reflected in the identification of a number of independent transformants which contained the same cDNA sequence. For example, three individual transformants were identified as aes2, three were identified as aes3, and two were identified as aes1. Notably, isolation of transformants which contained the same cDNA sequence verified the power of this screening strategy in that it demonstrated the reproducible nature of the visual screen.
6.4.3
aes hom ologies and possible roles in PTGS
Co-expression of the aes1 factor enhanced antisense RNA-mediated lacZ gene silencing from 45% to 75%. Surprisingly, BLASTN analysis of the aes1 sequence did not find significant homology with any organism. Failure to identify the homologous sequence in fission yeast was likely due to incomplete sequencing of the genome of this organism. At the time of writing this thesis approximately 90% of the S. pombe genome had been sequenced. Therefore, it is probable that the aes1 sequence is present in the 10% of unknown genomic DNA. However, BLASTP analysis of the aes-encoded protein found significant homology (43% identity) with a C. albicans protein of unknown function. This protein was identified in a screen of genes essential for cell viability and therefore may also be essential in S. pombe. The aes1 protein also shared 39% identity with the S. cerevisiae thymidylate synthase (TS) protein. TS is required for the de novo synthesis of thymidine5’-monophosphate (dTMP). Over-expression of this protein in mammals has been 155
Chapter 6
Identification of antisense enhancing sequences
correlated with certain cancers, and given that its suppression results in inhibition of cell growth, TS has become an important target for cancer chemotherapy (Danenberg, 1977). TS also has RNA-binding properties (Chu and Allegra, 1996) and can bind to its own mRNA to inhibit translation (Johnson, 1994) and to c-myc (Steitz, 1989) and p53 mRNA (Chu et al., 1995). Its natural interactions with RNA lends credence to its possible involvement in PTGS. The aes2 factor was identified as part of the mitochondrial elongation factor EF Tu. Importantly, the absence of the 5’ end of this protein may allow aes2 to act within the cytoplasm as the mitchondrial signal peptides, which allow for transportation from the cytosol to the mitochondria, are found in the amino-terminus of mitochondrial proteins (Glick and Schatz, 1991). EF Tu is the mitochondrial analagoue of the eukaryotic EF1α which acts in the cytoplasm transporting tRNA to the A site in the ribosome for peptide elongation (Condeelis, 1995). EF1α is an essential protein which has also been implicated in a large array of cellular activities including actin binding (Yang et al., 1990), microtubule severing (Shiina et al., 1994), cellular transformation (Tatsuka et al., 1992), cell senescence (Shepard et al., 1989), protein ubiquitination (Gonen et al., 1994), and protein folding (Caldas et al., 1998). It has been proposed that dsRNA is fragmented into 21-25 nt species by dsRNAspecific nucleases, amplified by RNA-dependent RNA polymerase, and dissociated by an ATP-dependent RNA helicase (Bass, 2000; Zamore et al., 2000). The small antisense fragments are then free to attack homologous mRNA by RNA nuclease-mediated degradation (Zamore et al., 2000). More recently it was suggested that an associative mechanism could catalyse the ATP-dependent exchange of the sense strand of the short dsRNA with the target mRNA (Bass, 2000). This may involve the transport of fragmented dsRNA to the ribosome where, in a competitive reaction with tRNA complexes, the complementary antisense strand binds to the mRNA. This would permit the association of the antisense strand of the dsRNA with the target mRNA when the latter is in a structurallyexposed state and both inhibit translation and target the mRNA for ribonuclease degradation. The aes2-encoded protein might therefore act by binding to PTGS-dependent dsRNA species and transporting them to the site of action, possibly the ribosomal machinery. 156
Chapter 6
Identification of antisense enhancing sequences
Analysis of aes3 showed that its 5’ end was comprised of an ORF which could be translated into an 84 aa protein containing a string of 36 arginine-glutamic acid repeats. These types of amino acid repeats are often found in transcription factors and therefore it is possible that aes3, if translated, acts in PTGS to generate more dsRNA. The 3’ end of the nucleotide sequence was homologous to 32% of a putative protein previously identified in a screen of fission yeast ORFs (Yoshioka et al., 1997). In addition, it was homologous to the antisense strand of the 3’ UTR of the fission yeast gene sna41 (Miyake and Yamashita, 1998). The protein encoded by sna41 was previously shown to be involved in DNA replication and has low homology (31% identity) with the S. cerevisiae protein CDC45 (Miyake and Yamashita, 1998). CDC45 has DNA helicase properties and has been shown to be involved in plasmid segregation (Zou et al., 1997). A homologue of the RecQ DNA helicase protein which is also involved in DNA replication was recently identified as being involved in PTGS in Neurospora (Cogoni and Macino, 1999b). In this respect, it is not clear how aes3 could impact on PTGS if it is inhibiting proteins with DNA helicase activity. Given this latter hypothesis, it is possible that aes3 may be acting through an alternative mechanism involving the putative protein encoded by the small ORF. The aes4 factor was identified as having complete homology to the antisense strand of the gene encoding the L7a ribosomal sub-unit. In addition, aes4 also contained a small ORF which has no known biological function. Interestingly, several antisense transcripts have been identified in ribosomal loci (Williams and Fried, 1986; Williams et al., 1988; Belhumeur et al., 1988). Additionally, a genome-wide screen has found complementarity between many mRNAs and rRNA (Mauro and Edelman, 1997), and more recently, it has been shown that such RNA duplex formation may function as a mechanism of translational control (Tranque et al., 1998). In the mouse, L7a protein is encoded by the Surf-3 gene (Giallongo et al., 1989). This gene is present in a tight cluster of at least five genes (Surf-1 to Surf-5) (Lennard et al., 1994), of which two have been shown to overlap (Williams and Fried, 1986; Williams et al., 1988). Although the precise role of these antisense RNAs is not known, it has been speculated that they may be involved in regulation of ribosomal proteins via post-transcriptional regulation of their mRNAs (Belhumeur et al., 1988; Tranque et al., 1998). In this chapter over-expression of the aes4 factor was shown to enhance the down-regulation of β-galactosidase activity in an antisense-dependent manner. 157
Chapter 6
Identification of antisense enhancing sequences
As such it is unlikely that the observed decrease in β-galactosidase activity was due to a general decrease in translational activity, since this effect would be expected to occur even in the absence of the antisense lacZ RNA. No significant impact on cell metabolism was observed in the aes4-expressing transformants. The above observations indicate that aes4 has a specific role in the PTGS mechanism(s). Interestingly, the L7 protein is part of a functionally important domain in the ribosome and has been shown to interact with the elongation factor EF Tu during biosynthesis in E. coli (Gudkov, 1997). It might therefore be possible that down-regulation of the L7a protein allows additional EF Tu-like molecules (aes2) to interact with dsRNA in the PTGS pathway. It will be intriguing to further investigate this potential mechanism. Several proteins which facilitate RNA annealing have previously been reported (Section 1.6.2). For example, the heterogenous nuclear ribonuceloprotein, hnRNP A1, has been shown to strongly enhance RNA:RNA duplex formation (Pontius and Berg, 1990; Portman and Dreyfuss, 1994), and has thus been a candidate for modulating antisense RNA efficacy. However, over-expression of this human protein in the present fission yeast model failed to enhance antisense RNA-mediated gene regulation (D. Atkins, M. Patrikakis and B. Pontius, unpublished data). Nevertheless, it is reasonable to expect that alternative proteins would exist in fission yeast that act in a similar fashion to hnRNPs. It has been hypothesised that hnRNPs either act as matchmakers by bringing together complementary RNA strands by protein-protein interactions or by acting as RNA chaperones thereby modifying RNA conformation and increasing the accessibility of the RNA for interactions in trans (Portman and Dreyfuss, 1994). Several of the aes factors described here have nucleic acid binding activities and it is therefore possible that they may facilitate RNA duplex formation. Overall, by expressing a cDNA library in a lacZ fission yeast model, four novel genes with potential roles in the PTGS pathway(s) have been identified. These factors may have varied roles in PTGS and are further discussed in Chapter 7. The over-expression strategy described herein overcomes some limitations associated with mutagenesis by identifying several genes that are essential for cell viability and with a potential role in PTGS. In addition, this strategy complements other systems by allowing the isolation of cellular factors that modify the efficacy of PTGS in vivo. Furthermore, the co-expression of 158
Chapter 6
Identification of antisense enhancing sequences
these factors with different forms of PTGS including co-suppression, quelling, and antisense RNA could be one way of enhancing the efficacy of these methods. This may be especially important for application of antisense RNA and dsRNA to mammalian cells and tissues or to genes which have been recalcitrant to this form of regulation.
159
Chapter 7
Conclusions
CHAPTER 7 CONCLUSIONS
7.1
Synthesis
Many factors are known to influence the ability of an antisense RNA molecule to inhibit the translation of target mRNAs. These include co-localisation of complementary RNAs, RNA secondary structure and hybridisation kinetics, the availability of specific RNA binding proteins, and the intracellular concentration of antisense RNA. The major aim of this thesis was to identify additional components that might be involved in efficient antisense RNA-mediated gene silencing in vivo. Specifically, three main parameters were studied using a well-characterised lacZ fission yeast model. These were i) the influence of antisense gene location relative to the target gene locus (“location effect”; Chapters 3 and 4), ii) the effect of dsRNA formation (Chapter 5), and iii) the identification and overexpression of certain host-encoded factors (Chapters 5 and 6). Some of these parameters were hypothesised to account for the variations in target gene silencing which have been observed in different clonal lines expressing the same antisense gene. To test the location effect hypothesis, strains were generated which contained the target lacZ gene at a fixed location and the antisense lacZ gene at various genomic locations. The high frequency of homologous recombination in fission yeast allowed the random integration of a library of antisense lacZ plasmids containing random genomic DNA fragments (Chapter 3). A LI-PCR protocol was then developed to rapidly identify the precise site of antisense gene integration in the fission yeast strains. This strategy circumvented problems inherent in plasmid rescue methods and alternative forms of inverse-PCR. Genomic regions flanking the integrated plasmid were then sequenced and their location identified using the S. pombe DNA sequence database. A set of 13 strains were generated in which the antisense gene had integrated at a variety of genomic sites, including all arms of the three fission yeast chomosomes, with sites proximal to telomeres, centromeres, and the target gene locus being represented. 160
Chapter 7
Conclusions
Further analysis of these strains demonstrated that there was no correlation between antisense gene location and lacZ gene silencing. In contrast, the effect of genomic position on the steady-state level of transgene RNA (classical position effect) was found to be a major factor in post-trancriptional lacZ gene silencing. The level of target gene inhibition was directly related to the intracellular concentration of antisense RNA. The location effect hypothesis was further investigated by positioning the complementary genes in close proximity to each other in an attempt to enhance co-localisation of their respective RNAs (Chapter 4). This was achieved by positioning the antisense gene either at the opposite allele to the target gene in a diploid strain, within the same genomic locus as the target gene, or from the same (overlapping) DNA sequence as the target gene. The first two strategies also failed to enhance target gene suppression suggesting that the role of antisense gene location relative to the target gene locus was not important for PTGS in this system. However, convergent transcription of the overlapping antisense gene was found to be very effective at inhibiting lacZ gene expression. Molecular analysis indicated that the mechanism of this form of gene inactivation was probably due to cis-mediated transcriptional silencing. The use of dsRNA for effective gene silencing has recently been described in a variety of organisms. In addition to being an attractive alternative to antisense RNA techniques, the observation that substoichiometric amounts of dsRNA are capabale of generating null phenotypes may explain the variation seen between independent clones expressing the same antisense gene in some systems. The role of dsRNA in fission yeast PTGS was therefore investigated (Chapter 5). It was found that gene suppression could be enhanced by increasing the intracellular concentration of non-coding lacZ RNA. This observation, along with the ability of a lacZ panhandle RNA to inhibit β-galactosidase activity, suggested that dsRNA was a central component in fission yeast PTGS. In addition, the over-expression of an ATP-dependent RNA helicase, encoded by the ded1 gene, was found to specifically enhance antisense RNA-mediated gene silencing. This was consistent with the antisense RNA entering an RNAi-like mechanism, further arguing for a role of dsRNA. Enhancing the efficacy of gene silencing by expressing additional sense RNA was also demonstrated with a second target gene (c-myc-lacZ), while the effect was also shown to be sequence-specific. Increased target gene silencing correlated with a reduction in the 161
Chapter 7
Conclusions
steady-state level of lacZ mRNA. These results were consistent with observations in other organisms although the action of dsRNA in fission yeast seemed to be dose-dependent. The properties of the present lacZ fission yeast model, including partial gene inhibition and the quantitative nature of the target gene, allowed the development of an over-expression screen to identify host-encoded factors that affect the degree of PTGS. Five unique factors were identified which specifically enhanced antisense RNA-mediated gene silencing by up to an additional 50%. These included an ATP-dependent RNA helicase, a portion of the translation elongation factor EF Tu, a homologue of the thymidylate synthase protein, and two small ORFs of unknown function. The two latter factors were also homologous to the antisense strand of the 3’ UTR of a DNA replication factor, and the antisense strand of the 3’ UTR of the ribosomal protein L7a. These antisense enhancing sequences (aes factors) all have natural associations with nucleic acids which is consistent with other proteins which have previously been identified to be involved in PTGS. Furthermore, one of these factors (aes2) was also shown to enhance panhandle RNA-mediated gene silencing thereby providing a link between antisense RNA- and dsRNA-mediated PTGS pathways in S. pombe.
7.2
A working model for PTGS in fission yeast
Several models have been proposed to explain dsRNA-mediated gene silencing in other organisms (Section 1.5.2). The two primary hypotheses maintain that the dsRNA has catalytic or amplification properties, however, this is due to different processes in each model. For example, dsRNA could conjugate with co-factors that allow it to go through multiple rounds of target mRNA degradation. Waterhouse and colleagues (1998) suggested that the dsRNA might conjugate to an RNase L-like factor which would facilitate this process. Alternatively, there is strong evidence that dsRNA is the template for an RNAdependent RNA polymerase which, in conjunction with an RNA helicase, would generate cRNA thereby amplifying the intracellular concentration of dsRNA (Bass, 2000; Zamore et al., 2000). As in the first model, the dsRNA would then form a complex with host proteins, specifically degrade the target mRNA, and then mediate further rounds of degradation. Additionally, the identification and investigation of small 21-25 nt RNAs in systems 162
Chapter 7
Conclusions
displaying PTGS has indicated that the dsRNA may be fragmented into small dsRNA species prior to degrading the target mRNA (Hamilton and Baulcombe, 1999; Hammond et al., 2000). Although these small dsRNA fragments have not been investigated in the present fission yeast model, it is possible that they are being generated (Section 5.4.5). However, since the degree of dsRNA-mediated gene silencing is dose-dependent in fission yeast, a model that does not include dsRNA fragmentation is favoured (Fig. 7.1). Based on the identification of the novel aes factors in fission yeast and elements of studies from other organisms a model is supported as indicated in Figure 7.1. In this model the aes factors may be enlisted for a role in dsRNA-mediated gene suppression in addition to the previously identified core proteins (RDE, MUT, QDE factors; Section 1.5) in the PTGS multiprotein complex(es). All of the known genes shown to be involved in PTGS, including those in this thesis, have natural associations with DNA, RNA or nucleic acid binding proteins, which is consistent with the expected roles of PTGS cellular factors (referred to as “PTGS factors”). Two of the identified genes (ago-1/qde-1/rde-1; Fagard et al., 2000, aes2; this thesis) encode proteins that are homologous to translation initiation factors. In conjunction with the investigation of an ATP-dependent RNA helicase (Chapter 5), identification of an RNA helicase in RNAi in nematodes (Plasterk and Ketting, 2000) and the co-purification of ribonuclease activity with ribosomal fractions (Hammond et al., 2000), these observations lead us to suggest that the translational apparatus may be one site at which PTGS functions. This does not imply that mRNA needs to be actively translated for the PTGS machinery to function. Alternatively, the identification of such varied proteins as DNA helicases and translational components as part of the PTGS complex implies that particular cellular proteins may be recruited into more than one multiprotein complex. Under such conditions, over-expression of these specific proteins may result in the generation of a PTGS complex that recognises dsRNA and mediates target gene suppression. Some of these proteins may be rate-limiting or rate-determining in PTGS and only through supplementation of these factors are their roles in PTGS uncovered. This contrasts with mutagenesis strategies which have been successful in identifying other factors involved in gene silencing. Inhibition of gene expression may also be mediated through modification of target mRNA by an ADAR-like protein. Strictly, this is not dsRNA-mediated gene silencing as 163
Chapter 7
Conclusions
defined in this thesis since expression of additional non-coding sense RNA would not affect this pathway. Nor would this mechanism have a catalytic component. Although the RNAilike mechanism could occur in either of the two major cellular compartments, it is suggested that it occurs primarily in the cytoplasm of fission yeast.
Fig. 7.1 A working model for PTGS in fission yeast. This working model incorporates protein activities identified in this and previous studies. dsRNA may be generated naturally or by experimentally induced methods. Formation of dsRNA in the nucleus by antisense RNA (red) and target mRNA hybridisation may induce action of dsRNA modifying proteins such as ADAR. This would inhibit transport of mRNA to the cytoplasm and is independent of an RNAi-like mechanism. Alternatively, dsRNA in the cytoplasm may act as a substrate for a dsRNAdependent RNA polymerase (QDE1/SGS1/EGO1) and RNA helicase (ded1) complex to generate cRNA. The antisense strand of the cRNA may then form a complex with PTGS factors (eg. aes1, aes2) and be transported to the translational machinery where it hybridises to the target mRNA and through the action of additional factors (eg. aes3, aes4, MUT7, QDE1/AGO1/RDE1) degrades it. DsRNA might then be released and be free to generate further cRNA species for additional rounds of mRNA degradation.
164
Chapter 7
Conclusions
7.3
Future Prospects
7.3.1
Position effectand transgene dose – an application
Although 13 strains were characterised in this thesis which showed a range of target gene inhibition, no genomic locations were identified which exhibited complete antisense RNAmediated lacZ inhibition. One reason for this was the limited expression of the antisense gene at the selected loci. It would be of interest to identify chromosomal locations which exhibit high levels of transgene expression. In addition to facilitating further antisense RNA studies, this may also be useful for other purposes. For example, fission yeast has been employed for synthesising industrial amounts of certain proteins (Lu et al., 1997). The prerequisite of this is to generate stable strains which express high levels of the transgene RNA. Clearly, knowledge of genomic locations that exhibit high steady-state RNA levels could be exploited for protein synthesis. An alternative strategy that could be used for identifying genomic locations in which the integrated antisense gene is highly-expressed involves antisense RNA-mediated inhibition of the ura4 gene which encodes for orotidyl monophosphate (OMP) decarboxylase. Null alleles of ura4 result in resistance to the toxic analogue 5-fluoro-orotic acid (FOA) (Grimm et al., 1988). If the endogenous ura4 gene is active, cells will not survive when grown in FOA-containing medium. Following integration of an antisense ura4 gene into various genomic locations, and growth on FOA-containing medium, strains which are inhibiting ura4 at high levels would be positively selected. These transformants, which may represent a small population of integrants, may exhibit high steady-state levels of the antisense ura4 RNA. The genomic flanks could be analysed by the LI-PCR strategy and this information used to generate targeted integration vectors specific for that site. Any gene of interest could then be introduced into that locus to achieve elevated protein expression levels.
165
Chapter 7
7.3.2
Conclusions
C onvergenttranscription as a form ofgene regulation
LacZ gene expression was effectively inhibited by the transcription of a convergent DNA sequence in the present fission yeast model. While this form of gene silencing was probably not mediated by a post-transcriptional mechanism, its superior efficacy over trans-acting antisense RNA may warrant further investigation as a novel means of conditionally silencing genes. This might involve replacing endogenous genes with a convergent transcription cassette similar to the type described in this thesis. The inclusion of a conditional promoter in the antisense orientation in the 3’ UTR of the target gene would have to avoid interfering with its normal transcription while the optimal distance between the two transcriptional units would have to be optimised for each individual gene. A similar approach has been used to identify inhibitors of HIV-1 transcription (Rosario et al., 1996). In this example, a “collision construct” was generated containing a CMV-driven reporter gene and the HIV-target promoter oriented in a convergent direction. The reporter gene was only active when the HIV promoter was repressed via trans-acting proteins. Alternatively, a strong conditional promoter could be integrated in the opposite orientation immediately down-stream of the gene of interest. In both scenarios target gene expression would be silenced only when the conditional promoter is activated. If synthesised, antisense RNA may also act in trans to inhibit expression from the opposite allele in diploid organisms. The caveat of these strategies would be that they would only work in organisms where homologous integration was facile or for which efficient targeted integration tools were available (Yanez and Porter, 1998). Furthermore, to be a useful application, most loci would have to be susceptible to this form of transcriptional gene inhibiton.
166
Chapter 7
7.3.3
Conclusions
PTG S and antisense enhancing sequences
The utility of S. pombe in identifying proteins which are involved in PTGS has been described in this thesis. The fission yeast model system can now be used for dissecting the precise roles of these factors. Also, this is an ideal system to investigate the roles of homologues of proteins previously identified to be involved in PTGS. For example, it would be of interest to generate null alleles of the dsRNA-dependent RNA polymerase homologue and test the ability of that mutant to undergo antisense RNA-mediated gene silencing. Additionally, over-expression of the aes factors could be attempted in such mutants with the aim of elucidating the precise pathway of PTGS. For instance, PTGS factors could be characterised as acting up-stream or down-stream in the gene silencing pathway using this approach. Over-expression of different cDNA libraries might also be attempted. It would be of interest to screen mammalian cDNA libraries, including human, to identify proteins which, when over-expressed, enhance PTGS. Similarly, libraries from other organisms which demonstrate robust PTGS, such as Drosophila or C. elegans, could be tested. Further, a similar over-expression approach could be used to identify PTGS modulators in other organisms. The results of this thesis have shown that gene silencing may be enhanced by concomitant expression of such aes factors. This may be especially important for application of antisense RNA to mammalian cells and tissues or to genes that are less sensitive to this form of regulation. As a start, the homologues of the five co-factors identified in this study should be tested, since it can be expected that they would act similarly in PTGS in other systems. It is also of immense interest to attempt dsRNA-mediated gene silencing in mammalian cells. To avoid the common immune response which is illicited against dsRNA in mammalian systems it may be useful to remove some of the components of this pathway (Section 1.3.3). For example, certain immune factors could be down-regulated in cell lines prior to introduction of dsRNA. Alternatively, testing dsRNA in cell lines which exhibit early differentiation phenotypes may be a way to evade dsRNA-mediated immune responses. Although such strategies may not be ideal for gene therapeutic approaches it may be very useful for functional genomic studies. In the latter case, dsRNA-mediated silencing of orphan genes could greatly facilitate elucidation of their cellular function. A 167
Chapter 7
Conclusions
second strategy for testing dsRNA in mammalian cells might involve expressing dsRNA in different sub-cellular compartments. For example, sequestering dsRNA in the nucleus may avoid the potent immune response illicited from dsRNA in the cytoplasm and yet maintain PTGS. Finally, the genetic tractability of fission yeast, including the ease of targeted integration, amenability to antisense RNA and dsRNA-mediated gene silencing, and knowledge of its genomic sequence, should allow for its continued use as an experimental model for PTGS. In addition to genetic studies, it will be important for providing biochemical data such as investigating the presence of the 21-25 nt species which have been identified in other PTGS systems. Indeed, the information gathered from this simple, unicellular organism should greatly complement that which is learnt from other models including higher eukaryotes.
168
Chapter 8
References
CHAPTER 8 REFERENCES Adelman, J., Bond, C., Douglass, J. and Herbert, E. (1987) Two mammalian genes transcribed from opposite strands of the same DNA locus. Science, 235, 1514-1517. Agrawal, S. (1996) Antisense oligonucleotides: toward clinical trials. Trends Biotech., 14, 376-387. Ahmad, S., Mineta, T., Martuza, R. and Glazer, R. (1994) Antisense expression of protein kinase C alpha inhibits the growth and tumorigenicity of human glioblastoma cells. Neurosurgery, 35, 904-909. Aiba, H., Matsuyama, S.-I., Mizuno, T. and Mizushima, S. (1987) Function of micF as an antisense RNA in osmoregulatory expression of the ompF gene in Escherichia coli. J. Bacteriol., 169, 3007-3012. Ainscough, J.-X. and Surani, M. (1996) Organization and control of imprinted genes: the common features. In Epigenetic Mechanisms of Gene Regulation (Eds, Russo, V., Martienssen, R. and Riggs, A.) Cold Spring Harbor Laboratory Press, New York. Alba, M., Santibanez-Koref, M., and Hancock, J. (1999) Amino acid reiterations in yeast are overrepresented in particular classes of proteins and show evidence of a slippagelike mutational process. J. Mol. Evol. 49, 789-797. Allen, N., Cran, D., Barton, S., Hettle, S., Reik, W. and Surani, M. (1988) Transgenes as probes for active chomosomal domains in mouse development. Nature, 333, 852-855. Allshire, R., Javerzat, J., Redhead, N. and Cranston, G. (1994) Position effect variegation at fission yeast centromeres. Cell, 76, 157-169. Altmann, M., Wittmer, B., Methot, N., Sonenberg, N. and Trachsel, H. (1995) The Saccharomyces cerevisiae translation initiation factor Tif3 and its mammalian homologue, elF-4B, have RNA annealing activity. EMBO J., 14, 3820-3827. Altschul, S., Gish, W., Miller, W., Myers, E. and Lipman, D. (1990) Basic local alignment search tool. J. Mol. Biol., 215, 403-410.
169
Chapter 8
References
Anandalakshmi, R., Pruss, G., Ge, X., Marathe, R., Mallory, A., Smith, T. and Vance, V. (1998) A viral suppressor of gene silencing in plants. Proc. Natl Acad. Sci., 95, 1307913084. Angell, S. and Baulcombe, D. (1999) Potato virus X amplicon-mediated silencing of nuclear genes. Plant J., 20, 357-362. Aramayo, R. and Metzenberg, R. (1996) Meiotic transvection in fungi. Cell, 86, 103113. Arndt, G. (1993) Antisense RNA expression in yeast. PhD Thesis, University of Saskatchewan, Canada. Arndt, G., Atkins, D., Patrikakis, M. and Izant, J. (1995) Gene regulation by antisense RNA in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet., 248, 293-300. Arndt, G., Patrikakis, M. and Atkins, D. (2000) A rapid genetic screening system for identifying gene-specific suppression constructs for use in human cells. Nucleic Acids Res., 28, e15. Arndt, G. and Rank, G. (1997) Colocalization of antisense RNAs and ribozymes with their target mRNAs. Genome, 40, 785-797. Arndt, G., Xiao, W. and Rank, G. (1994) Antisense RNA regulation of the ILV2 gene in yeast: a correction. Curr. Genet., 25, 289. Atkins, D., Arndt, G. M. and Izant, J. G. (1994) Antisense gene expression in yeast. Biol. Chem. Hoppe Seyler, 375, 721-729. Atkins, D. and Gerlach, W. (1994) Artificial ribozyme and antisense gene expression in Saccharomyces cerevisiae. Antisense Res. Devel., 4, 109-117. Atkins, D., Patrikakis, M. and Izant, J. (1995) The ade6 gene of the fission yeast as a target for antisense and ribozyme RNA-mediated suppression. Antisense Res. Devel., 5, 295-305. Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidmen, J., Smith, J. and Struhl, K. (1987) Current Protocols in Molecular Biology., Wiley-Interscience, New York. Ayub, R., Guis, M., Amor, M., Gillot, L., Roustan, J.-P., Latche, A., Bouzayen, M. and Pech, J.-C. (1996) Expression of ACC oxidase antisense gene inhibits ripening of cantaloupe melon fruits. Nat. Biotech., 14, 862-866.
170
Chapter 8
References
Bahler, J., Wyler, T., Loidl, J. and Kohli, J. (1993) Unusual nuclear structures in meiotic prophase of fission yeast: a cytological analysis. J. Cell Biol, 121, 241-256. Bahamian, M. and Zarbl, H. (1999) Transcriptional and posttranscriptional silencing of rodent α1(I) collagen by a homologous trancriptionally self-silenced transgene. Mol. Cell. Biol., 19, 274-283. Barbet, N., Muriel, W. and Carr, A. (1992) Versatile shuttle vectors and genomic libraries for use with Schizosaccharomyces pombe. Gene, 114, 59-66. Bashirullah, A., Cooperstock, R. and Lipshitz, H. (1998) RNA localization in development. Annu. Rev. Biochem., 67, 335-394. Basi, G., Schmid, E. and Maundrell, K. (1993) TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene, 123, 131-136. Bass, B. (2000) Double-stranded RNA as a template for gene silencing. Cell, 101, 235-238. Bass, B., Nishikura, K., Keller, W., Seeburg, P., Emeson, R., O'Connell, M., Samuel, C. and Herbert, A. (1997) A standardized nomenclature for adenosine deaminases that act on RNA. RNA, 3, 947-949. Bass, B. and Weintraub, H. (1988) An unwinding activity that covalently modifies its double-stranded RNA substrate. Cell, 55, 1089-1098. Baulcombe, D. (1996) RNA as a target and an initiator of post-transcriptional gene silencing in transgenic plants. Plant Mol. Biol., 32, 79-88. Bedford, M., Arman, E., Orr, U. and Lonai, P. (1995) Analysis of Hoxd-3 gene: structure and localization of its sense and natural antisense transcripts. DNA Cell Biol., 14, 295-304. Belhumeur, P., Lussier, M. and Skup, D. (1988) Expression of naturally occurring RNA molecules complementary to the murine L27' ribosomal protein mRNA. Gene, 72, 277-285. Bender, T. and Thompson, K., WM (1987) Differential expression of c-myb mRNA in murine B lymphomas by a block to transcription elongation. Science, 237, 1473-1476. Bennett, C. F. (1998) Antisense oligonucleotides: Is the glass half full or half empty? Biochem. Pharmacol., 55, 9-19. 171
Chapter 8
References
Benson, D., Boguski, M., Lipman, D., Ostell, J., Ouellette, B., Rapp, B. and Wheeler, D. (1999) GenBank. Nucleic Acids Res., 27, 12-17. Bertrand, E., Castanotto, D., Zhou, C., Carbonnelle, C., Lee, N., Good, P., Chatterjee, S., Grange, T., Pictet, R., Kohn, D., Engelke, D. and Rossi, J. (1997) The expression cassette determines the functional activity of ribozymes in mammalian cells by controlling their intracellular localization. RNA, 3, 75-88. Bertrand, E. and Rossi, J. (1994) Facilitation of hammerhead ribozyme catalysis by the nucleocapsid protein of HIV-1 and the heterogeneous nuclear ribonucleoprotein A1. EMBO J., 13, 2904-2912. Bevec, D., Volc-Platzer, B., Zimmermann, K., Dobrovnik, M., Hauber, J., Veres, G. and Bohnlein, E. (1994) Constitutive expression of chimeric Neo-Rev response element transcripts suppresses HIV-1 replication in human CD4+ T lymphocytes. Hum. Gene Ther., 5, 193-201. Bingham, P. (1997) Cosuppression comes to the animals. Cell, 90, 385-387. Bird, C. and Ray, J. (1991) Manipulation of plant gene expression by antisense RNA. Biotech. Genet. Eng. Rev., 9, 207-227. Birse, C., Lee, B., Hansen, K. and Proudfoot, N. (1997) Transcriptional termination signals for RNA II in fission yeast. EMBO J., 16, 3633-3643. Black, T., Safer, B., Hovanessian, A. and Katze, M. (1989) The cellular 68,000 Mr protein kinase is highly autophosphorylated and activated yet significantly degraded during poliovirus infection: implications for translational regulation. J. Virol., 63, 2244-2251. Blobel, G. (1985) Gene gating: a hypothesis. Proc. Natl Acad. Sci., 82, 8527-8529. Bosher, J., Dufourcq, P., Sookhareea, S. and Labouesse, M. (1999) RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon. Genetics, 153, 1245-1256. Bosher, J. and LaBouesse, M. (2000) RNA interference: genetic wand and genetic watchdog. Nat. Cell Biol., 2, e31-e36. Bouche, F. and Bouche, J. (1989) Genetic evidence that DicF, a second division inhibitor encoded by the Escherichia coli dicB operon, is probably RNA. Mol. Microbiol., 3, 991-994.
172
Chapter 8
References
Bovre, K. and Szybalski, W. (1969) Patterns of convergent and overlapping transcription within the b2 region of coliphage lambda. Virology, 38, 614-626. Bramlage, B., Luzi, E. and Eckstein, F. (1998) Designing ribozymes for the inhibition of gene expression. Trends Biotech., 16, 434-438. Breaker, R. (1997) DNA enzymes. Nat. Biotech., 15, 427-431. Bridger, J. and Bickmore, W. (1998) Putting the genome on the map. Trends Genet., 14, 403-409. Brigneti, G., Voinnet, O., Li, W.-X., Ji, L.-H., Ding, S.-W. and Baulcombe, D. (1998) Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO J., 17, 6739-6746. Bruening, G. (1998) Plant gene silencing regularized. Proc. Natl Acad. Sci., 95, 13349-13351. Brun, C., Dubey, D. and Huberman, J. (1995) pDblet, a stable autonomously repliating shuttle vector for Schizosaccharomyces pombe. Gene, 164, 173-177. Bunch, T. and Goldstein, L. (1989) The conditional inhibition of gene expression in cultured Drosophila cells by antisense RNA. Nucleic Acids Res., 17, 9761-9782. Burgess, S. and Kleckner, N. (1999) Collisions between yeast chomosomal loci are governed by thee layers of organization. Genes Devel., 13, 1871-1883. Burgess, S., Kleckner, N. and Weiner, B. (1999) Somatic pairing of homologs in budding yeast: existence and modulation. Genes Devel., 13, 1627-1641. Burns, C., Chu, H., Rueter, S., Hutchinson, L., Canton, H., Sanders-Bush, E. and Emeson, R. (1997) Regulation of serotonin-2C-receptor G-protein coupling by RNA editing. Nature, 387, 303-308. Caldas, T., Yaagoubi, A. and Richarme, G. (1998) Chaperone proerties of bacterial elongation factor EF-Tu. J. Biol Chem, 273, 11478-11482. Cameron, F. and Jennings, P. (1991) Inhibition of gene expression by a short sense fragment. Nucleic Acids Res., 19, 469-474. Cannon, M., Platz, J., O'Leary, M., Sookdeo, C. and Cannon, F. (1990) Organspecific modulation of gene expression in transgenic plants using antisense RNA. Plant Mol. Biol., 15, 39-47.
173
Chapter 8
References
Capaccioli, S., Quattrone, A., Schiavone, N., Calastretti, A., Copreni, E., Bevilacqua, A., Canti, G., Gong, L., Morelli, S. and Nicolin, A. (1996) A bcl-2/IgH antisense transcript deregulates bcl-2 gene expression in human follicular lymphoma t(14; 18) cell lines. Oncogene, 13, 105-115. Carr, A., MacNeill, S., Hayles, J. and Nurse, P. (1989) Molecular cloning and sequence analysis of mutant alleles of the fission yeast cdc2 protein kinase gene: Implications for cdc2+ protein structure and function. Mol. Gen. Genet., 218, 41-49. Case, C., Roesl, S., Jensen, P., Lee, J., Kleckner, N. and Simons, R. (1989) The unusual stability of the IS10 antisense RNA is critical for its function and is determined by the structure of its stem-domain. EMBO J., 8, 4297-4305. Castanotto, D., Li, H., Chow, W., Rossi, J. and Deshler, J. (1998) Structural similarities between hammerhead ribozymes and the spliceosomal RNAs could be responsible for lack of ribozyme cleavage in yeast. Antisense Nucleic Acid Drug Devel., 8, 1-13. Catalanotto, C., Azzalin, G., Macino, G. and Cogoni, C. (2000) Gene silencing in worms and fungi. Nature, 404, 245. Cavazzana-Calvo, M., Hacein-Bey, S., Saint Basile, G., Gross, F., Yvon, E., Nusbaum, P., Selz, F., Hue, C., Certain, S., Casanova, J.-L., Bousso, P., Le Deist, F. and Fischer, A. (2000) Gene Therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science, 288, 669-672. Cech, T. (1987) The chemistry of self-splicing RNA and RNA enzymes. Science, 236, 1532-1539. Celano, P., Berchtold, C., Kizer, D., Weerartna, A., Nelkin, B., Baylin, S. and Casero, R. (1992) Characterization of an endogenous RNA transcript with homology to the antisense strand of the human c-myc gene. J. Biol. Chem., 267, 15092-15096. Ch'ng, J., Mulligan, R., Schimmel, P. and Holmes, E. (1989) Antisense RNA complementary to 3' coding and noncoding sequences of creatine kinase is a potent inhibitor of translation in vivo. Proc. Natl Acad. Sci., 86, 10006-10010. Chang, H., Watson, J. and Jacobs, B. (1992) The E3L gene of vaccinia virus encodes an inhibitor of the interferon-induced double-stranded RNA-dependent protein kinase. Proc. Natl Acad. Sci., 89, 4825-4829. 174
Chapter 8
References
Chen, H., Ferbeyre, G. and Cedergren, R. (1997) Efficient hammerhead ribozyme and antisense RNA targeting in a slow ribosome Escherichia coli mutant. Nat. Biotech., 15, 432-435. Chu, E. and Allegra, C. (1996) The role of thymidylate synthase as an RNA binding protein. Bioessays, 18, 191-198. Chu, E., Takechi, T., Jones, K., Voeller, D., Copur, S., Maley, G., Maley, F., Segal, S. and Allegra, C. (1995) Thymidylate synthase binds to c-myc RNA in human colon cancer cells and in vitro. Mol. Cell. Biol., 15, 179-185. Chuang, C.-F. and Meyerowitz, E. (2000) Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. Proc. Natl Acad. Sci., 97, 4985-4990. Chuat, J.-C. and Galibert, F. (1989) Can ribozymes be used to regulate procaryote gene expression? Biochem. Biophys. Res. Com., 162, 1025-1029. Clarke, M., Patrikakis, M. and Atkins, D. (2000) Comparative analysis of artificial antisense RNA regulation in fission yeast and human cells. Biochem. Biophys. Res. Com., 268, 8-13. Clemens, J., Worby, C., Simonson-Leff, N., Muda, M., Maehama, T., Hemmings, B. and Dixon, J. (2000) Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc. Natl Acad. Sci., 97, 6499-6503. Clemson, C., McNeil, J., Willard, H. and Lawrence, J. (1996) XIST RNA paints the inactive X chomosome at interphase: evidence for a novel RNA involved in nuclear/chomosome structure. Cell Biol., 132, 259-275. Coen, E. and Carpenter, R. (1988) A semi-dominant allele, niv-525, acts in trans to inhibit expression of its wild-type homologue in Antirrhinum majus. EMBO J., 7, 877-883. Cogoni, C. and Macino, G. (1997a) Conservation of transgene-induced posttranscriptional gene silencing in plants and fungi. Trends Plant Sci., 2, 438443. Cogoni, C. and Macino, G. (1997b) Isolation of quelling-defective (qde) mutants impaired in posttranscriptional transgene-induced gene silencing in Neurospora crassa. Proc. Natl Acad. Sci., 94, 10233-10238. Cogoni, C. and Macino, G. (1999a) Gene silencing in Neurospora crassa requires a protein homologous to RNA-dependent RNA polymerase. Nature, 399, 166-169.
175
Chapter 8
References
Cogoni, C. and Macino, G. (1999b) Posttranscriptional gene silencing in Neurospora by a RecQ DNA helicase. Science, 286, 2342-2344. Collins, F., Patrinos, A., Jordan, E., Chakravarti, A., Gesteland, R., Walters, L. et al. (1998) New goals for the U.S. human genome project: 1998-2003. Science, 282, 682-689. Condeelis, J. (1995) Elongation factor 1α, translation and the cytoskeleton. Trends Biochem. Sci., 20, 169-170. Cornelissen, M. (1989) Nuclear and cytoplasmic sites for anti-sense control. Nucleic Acids Res., 17, 7203-7209. Cornelissen, M. and Vandewiele, M. (1989) Both RNA level and translation efficiency are reduced by anti-sense RNA in transgenic tobacco. Nucleic Acids Res., 17, 833-843. Crystal, R. (1995) Transfer of genes to humans: early lessons and obstacles to success. Science, 270, 404-410. Dalmay, T., Hamilton, A., Rudd, S., Angell, S. and Baulcombe, D. (2000) An RNAdependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell, 101, 543-553. Danenberg, P. (1977) Thymidylate synthase: a target enzyme in cancer chemotherapy. Biochim. Biophys. Acta, 473, 73-79. Davidkova, G., Zhang, S.-P., Nichols, R. and Weiss, B. (1996) Reduced levels of calmodulin in PC12 cells induced by stable expression of calmodulin antisense RNA inhibits cell growth and induces neurite outgrowth. Neuroscience, 75, 1003-1019. Day, A. and Rochaix, J. (1991) Structure and inheritance of sense and anti-sense transcripts from a transposon in the green alga Chlamydomonas reinhardtii. J. Mol. Biol., 218, 273-291. de la Cruz, J., Kressler, D. and Linder, P. (1999) Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci., 24, 192-198. Decker, C. and Parker, R. (1995) Diversity of cytoplasmic functions for the 3' untranslated region of eukaryotic transcripts. Curr. Opin. Cell Biol., 7, 386-392. Delihas, N. (1995) Regulation of gene expression by trans-encoded antisense RNAs. Mol. Microbiol., 15, 411-414.
176
Chapter 8
References
Denhardt, D. (1992) Mechanism of action of antisense RNA. Ann. N. Y. Acad. Sci., 662, 70-76. Denman, R. (1993) Using RNA FOLD to predict the activity of small catalytic RNAs. Biotechniques, 15, 1090-1095. Depicker, A. and Van Montagu, M. (1997) Post-transcriptional silencing in plants. Curr. Opin. Cell Biol., 9, 373-382. Dernburg, A., Zalevsky, J., Colaiacovo, M. and Villeneuve, A. (2000) Transgenemediated cosuppression in the C. elegans germ line. Genes Devel., 14, 1578-1583. Ding, S. (2000) RNA silencing. Curr. Opin. Biotech., 11, 152-156. Dolnick, B. (1993) Cloning and characterization of a naturally occurring antisense RNA to human thymidilate synthase mRNA. Nucleic Acids Res., 21, 1747-1752. Dolnick, B. J. (1997) Naturally occurring antisense RNA. Pharmacol. Ther., 75, 179184. Dougherty, W. and Parks, T. (1995) Transgenes and gene suppression: telling us something new? Curr. Opin. Cell Biol., 7, 399-405. Dropulic, B. and Jeang, K.-T. (1994) Intracellular susceptibility to ribozymes in a tethered substrate-ribozyme provirus model is not predicted by secondary structures of human immunodeficiency virus type 1 RNAs in vitro. Antisense Res. Devel., 4, 217-221. Dunn, S., Park, S., Sharma, V., Raghu, G., Simone, J., Tavassoli, R., Young, L., Ortega, M., Pan, C.-H., Alegre, G., Roninson, I., Lipkina, G., Dayn, A. and Holzmayer, T. (1999) Isolation of efficient antivirals: genetic suppressor elements against HIV-1. Gene Ther., 6, 130-137. Dvorin, J. (1999) Validated target discovery: letting nature do the work. Start-Up, June, 34-41. Eccles, M., Grubb, G., Ogawa, O., Szeto, J. and Reeve, A. (1994) Cloning of novel Wilms Tumor gene (WT1) cDNAs; evidence for antisense transcription of WT1. Oncogene, 9, 2059-2063. Egli, C. and Braus, G. (1994) Uncoupling of mRNA 3' cleavage and polyadenylation by expression of a hammerhead ribozyme in yeast. J. Biol. Chem., 44, 27378-27383.
177
Chapter 8
References
Elia, A., Laing, K., Schofield, A., Tilleray, V. and Clemens, M. (1996) Regulation of the double-stranded RNA-dependent protein kinase PKR by RNAs encoded by a repeated sequence in the Epstein-Barr virus genome. Nucleic Acids Res., 24, 4471-4478. Elmayan, T., Balzergue, S., Beon, F., Bourdon, V., Daubremet, J., Guenet, Y., Mourrain, P., Palauqui, J., Vernhettes, S., Vialle, T., Wostrikoff, K. and Vaucheret, H. (1998) Arabidopsis mutants impaired in cosuppression. Plant Cell, 10, 1747-1758. Elomaa, P. and Holton, T. (1994) Modification of flower colour using genetic engineering. Biotech. Genet. Eng. Rev., 12, 63-88. Fagard, M., Boutet, S., Morel, J., Bellini, C. and Vaucheret, H. (2000) AGO1, QDE2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals. Proc. Natl Acad. Sci. 97, 11650-11654. Farrell, C. and Lukens, L. (1995) Naturally occurring antisense transcripts are present in chick embryo chondrocytes simultaneously with the down-regulation of the alpha 1 (I) collagen gene. J. Biol. Chem., 270, 3400-3408. Feinberg, A. and Vogelstein, B. (1983) A technique for radiolabelling DNA restriction endonuclease fragments with high specific activity. Anal. Biochem., 132, 6-13. Femino, A., Fay, F., Fogarty, K. and Singer, R. (1998) Visualization of single RNA transcripts in situ. Science, 280, 585-590. Ferbeyre, G., Bratty, J., Chen, H. and Cedergren, R. (1995) A hammerhead ribozyme inhibitis ADE1 gene expression in yeast. Gene, 155, 45-50. Ferbeyre, G., Bratty, J., Chen, H. and Cedergren, R. (1996) Cell cycle arrest promotes trans-hammerhead ribozyme action in yeast. J. Biol. Chem., 271, 19318-19323. Fierro-Monti, I. and Mathews, M. (2000) Proteins binding to duplexed RNA: one motif, multiple functions. Trends Biochem. Sci., 25, 241-246. Fire, A. (1999) RNA-triggered gene silencing. Trends Genet., 15, 358-363. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S. and Mello, C. (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 391, 806-811. Forbes, K., Humphey, T. and Enoch, T. (1998) Suppressors of Cdc25p overexpression identify two pathways that influence the G2/M checkpoint in fission yeast. Genetics, 150, 1361-1375. 178
Chapter 8
References
Forster, A. and Symons, R. (1987) Self-cleavage of plus and minus RNAs of a virusoid and a structural model for the active sites. Cell, 49, 211-220. Frankhauser, H. and Schweingruber, M. (1994) Thiamine-repressible genes in Schizosaccharomyces pombe are regulated by a Cys6 zinc-finger motif-containing protein. Gene, 147, 141-144. Freeman, S., Abboud, C., Whartenby, K., Packman, C., Koeplin, D., Moolten, F. and Abraham, G. (1993) The “bystander effect”: Tumor regression when a fraction of the tumor mass is genetically modified. Cancer Res., 53, 5274-5283. Fu, X. and Maniatis, T. (1992) Isolation of a complementary DNA that encodes the mammalian splicing factor SC35. Science, 256, 535-538. Fung, J., Marshall, W., Dernburg, A., Agard, D. and Sedat, J. (1998) Homologous chomosome pairing in Drosophila melanogaster proceeds though multiple independent initiations. J. Cell Biol., 141, 5-20. Garrick, D., Fiering, S., Martin, D. and Whitelaw, E. (1998) Repeat-induced silencing in mammals. Nat. Genet., 18, 56-59. Giallongo, A., Yon, J. and Fried, M. (1989) Ribosomal protein L7a is encoded by a gene (Surf-3) within the tightly clustered mouse surfeit locus. Mol. Cell. Biol., 9, 224-231. Gibbs, P., McGregor, W., Maher, V., Nisson, P. and Lawrence, C. (1998) A human homolog of Saccharomyces cerevisiae REV3 gene, whcih encodes the catalytic subunit of DNA polymerase ζ. Proc. Natl Acad. Sci., 95, 6876-6880. Giebelhaus, D., Eib, D. and Moon, R. (1988) Antisense RNA inhibits expression of membrane skeleton protein 4.1 during embryonic development of Xenopus. Cell, 53, 601615. Glick, B., and Schatz, G. (1991) Import of proteins into mitochondria. Annu. Rev. Genet., 25, 21-44. Gonen, H., Smith, C., Siegel, N., Kahana, C., Merrick, W., Chakraburtty, K., Schwartz, A. and Ciechanover, A. (1994) Protein synthesis elongation factor EF-1α is essential for ubiquitin-dependent degradation of certain N alpha-acetylated proteins and may be substituted for by the bacterial elongation factor EF-Tu. Proc. Natl Acad. Sci., 91, 7648-7652.
179
Chapter 8
References
Good, P., Krikos, A., Li, S., Bertrand, E., Lee, N., Giver, L., Ellington, A., Zaia, J., Rossi, J. and Engelke, D. (1997) Expression of small, therapeutic RNAs in human cell nuclei. Gene Ther., 4, 45-54. Gordenin, D. and Resnick, M. (1998) Yeast ARMS (DNA at-risk motifs) can reveal sources of genome instability. Mutat. Res., 400, 45-58. Grallert, B., Kearsey, S., Lenhard, M., Carlson, C., Nurse, P., Boye, E. and Labib, K. (2000) A fission yeast general translation factor reveals links between protein synthesis and cell cycle control. J. Cell Sci., 113, 1447-1458. Grallert, B., Nurse, P. and Patterson, T. (1993) A study of integrative transformation in Schizosaccharomyces pombe. Mol. Gen. Genetics, 238, 26-32. Green, S. and Mathews, M. (1992) Two RNA-binding motifs in the double-stranded RNA-activated protein kinase, DAI. Genes Devel., 6, 2478-2490. Grimm, C. and Kohli, J. (1988) Observations on integrative transformation in Schizosaccharomyces pombe. Mol. Gen. Genetics, 215, 87-93. Grimm, C., Kohli, J., Murray, J. and maundrell, K. (1988) Genetic engineering of Schizosaccharomyces pombe: a system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol. Gen. Genetics, 215, 81-86. Grishok, A., Tabara, H. and Mello, C. (2000) Genetic requirements for inheritence of RNAi in C. elegans. Science, , 2494-2497. Gudkov, A. (1997) The L7/L12 ribosomal domain of the ribosome: structural and functional studies. FEBS Lett., 407, 253-256. Guerrier-Takada, C., Gardiner, K., Marsh, R., Pace, N. and Altman, S. (1983) Activity of an RNA molecule prepared by transcription in vitro. Cell, 35, 849-857. Gunnery, S., Rice, A., Robertson, H. and Mathews, M. (1990) Tat-responsive region RNA of human immunodeficiency virus 1 can prevent activation of the double-stranded RNA-activated protein kinase. Proc. Natl Acad. Sci., 87, 8687-8691. Gura, T. (2000) A silence that speaks volumes. Nature, 404, 804-808. Gussoni, E., Wang, Y., Fraefel, C., Miller, R., Blau, H., Geller, A. and Kunkel, L. (1996) A method to codetect introduced genes and their products in Gene Therapy protocols. Nat. Biotech., 14, 1012-1016.
180
Chapter 8
References
Hamada, K., Sakaue, M., Alemany, R., Zhang, W., Horio, Y., Roth, J. and Mitchell, M (1996) Adenovirus-mediated transfer of HPV 16 E6/E7 antisense RNA to human cervical cancer cells. Gynecol. Oncol., 63, 219-227. Hamilton, A. and Baulcombe, D. (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286, 950-952. Hammond, S., Bernstein, E., Beach, D. and Hannon, G. (2000) An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature, 404, 293296. Hampel, A. and Tritz, R. (1989) Catalytic properties of the minimum (-) sTRSV sequence. Biochemistry, 28, 4929-4933. Harland, R. and Weintraub, H. (1985) Translation of mRNA injected into Xenopus oocytes is specifically inhibited by antisense RNA. J. Cell Biol., 101, 1094-1099. Hasan, N., Somasekhar, G. and Szybalski, W. (1988) Antisense RNA does not significantly affect expression of the galK gene of Escherichia coli or the N gene of coliphage lambda. Gene, 72, 247-252. Haseloff, J. and Gerlach, W. (1988) Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature, 334, 585-591. Hastie, N. and Held, W. (1978) Analysis of mRNA populations by cDNA.mRNA hybrid-mediated inhibition of cell-free protein synthesis. Proc. Natl Acad. Sci., 75, 12171221. Hawthorne, D. and Leupold, U. (1974) Suppressor mutations in yeast. Curr. Top. Microbiol. Immunol., 64, 1-47. Hazelrigg, T. (1998) The destinies and destinations of RNAs. Cell, 95, 451-460. Heard, E., Lovell-Badge, R. and Avner, P. (1999) Anti-Xistentialism. Nat. Genet., 21, 343-344. Heinrich, J.-C., Tabler, M. and Louis, C. (1995) Influence of chomosomal position and copy number of a white-directed ribozyme gene on the suppression of eye pigmentation in Drosophila melanogaster. Antisense Res. Devel., 5, 155-160. Henikoff, S. (1992) Position effect and related phenomena. Curr. Opin. Genet. Devel., 2, 907-912.
181
Chapter 8
References
Henikoff, S. (1997) Nuclear organization and gene expression: homologous pairing and long-range interactions. Curr. Opin. Cell Biol., 9, 388-395. Henikoff, S. and Comai, L. (1998) Trans-sensing effects: the ups and downs of being together. Cell, 93, 329-332. Henikoff, S., Keene, M., Fechttel, K. and Fristrom, J. (1986) Gene within a gene: nested Drosophila genes encode unrelated proteoins on opposite DNA strands. Cell, 44, 3342. Herschlag, D., Khosla, M., Tsuchihashi, Z. and Karpel, R. (1994) An RNA chaperone activity of non-specific RNA binding proteins in hammerhead ribozyme catalysis. EMBO J., 13, 2913-2924. Hervieu, G. and Nahon, J. (1995) Pro-melanin concentrating hormone messenger ribonucleic
acid
and
peptides
expression
in
peripheral
tissues
of
the
rat.
Neuroendocrinology, 61, 348-364. Heyer, A., Lloyd, J. and Kossmann, J. (1999) Production of modified polymeric carbohydrates. Curr. Opin. Biotech., 10, 169-174. Heyer, W.-D., Sipiczki, M. and Kohli, J. (1986) Replicating plasmids in Scizosaccharomyces pombe: improvement of symmetric segregation by a new genetic element. Mol. Cell. Biol., 6, 80-89. Hida, K., Shindoh, M., Yasuda, M., Hanzawa, M., Funaoka, K., Kohgo, T. and al., e. (1998) Antisesne E1AF transfection restrains oral cancer invasion by reducing matrix metallo-proteinase activities. Am. J. Pathol., 150, 2125-2132. Higgins, G., Uzelin, D., Phillips, G. and Burrell, C. (1991) Presence and distribution of human papillomavirus sense and antisense RNA transcripts in genital cancers. J. Gen. Virol., 72, 885-895. Hildebrandt, M. and Nellen, W. (1992) Differential antisense transcription from the Dictyostelium EB4 gene locus: Implications on antisense-mediated regulation of mRNA stability. Cell, 69, 197-204. Hjalt, T. and Wagner, E. (1995) Bulged-out nucleotides in an antisense RNA are required for rapid target RNA binding in vitro and inhibition in vivo. Nucleic Acids Res., 23, 580-587.
182
Chapter 8
References
Ho, S., Bao, Y., Lesher, T., Malhotra, R., Ma, L., Fluharty, S. and Sakai, R. (1998) Mapping of RNA accessible sites for antisense experiments with oligonucleotide libraries. Nat. Biotech., 16, 59-63. Ho, S., Britton, D., Stone, B., Behens, D., Leffet, L., Hobbs, F., Miller, J. and Trainor, G. (1996) Potent antisense oligonucleotides to the human multidrug resistance-1 mRNA are rationally selected by mapping RNA-accessible sites with oligonucleotide libraries. Nucleic Acids Res., 24, 1901-1907. Hoffman, C. and Winston, F. (1987) A ten-minute DNA preparation from yeast efficiently releases autnomous plasmids for transformation of Escherichia coli. Gene, 57, 267-272. Hollick, J., Dorweiller, J. and Chandler, V. (1997) Paramutation and related allelic interactions. Trends Genet., 13, 302-308. Holzmayer, T., Pestov, D. and Roninson, I. (1992) Isolation of dominant negative mutants and inhibitory antisense RNA sequences by expression selection of random DNA fragments. Nucleic Acids Res., 25, 711-717. Homann, M., Nedbal, W. and Sczakiel, G. (1996) Dissociation of long-chain duplex RNA can occur via strand displacement in vitro: biological implications. Nucleic Acids Res., 24, 4395-4400. Hormes, R., Homann, M., Oelze, I., Marschall, P., Tabler, M., Ecstein, F. and Sczakiel, G. (1997) The subcellular localization and length of hammerhead ribozymes determine efficacy in human cells. Nucleic Acids Res., 25, 769-775. Hottinger, H., Pearson, D., Yamao, F., Gamulin, V., Cooley, L., Cooper, T. and Soll, D. (1982) Nonsense suppression in Schizosaccharomyces pombe: The S. pombe Sup3-e tRNASerUGA gene is active in S. cerevisiae. Mol. Gen. Genet., 188, 219-224. Imani, F. and Jacobs, B. (1988) Inhibitory activity for the interferon-induced protein kinase is associated with the reovirus serotype 1 sigma 3 protein. Proc. Natl Acad. Sci., 85, 7887-7891. Ingelbrecht, I., Breyne, P., Vancompernolle, K., Jacobs, A., Van Montagu, M. and Depicker, A. (1991) Transcriptional interference in transgenic plants. Gene, 109, 239-242.
183
Chapter 8
References
Ingelbrecht, I., Van Houdt, H., Van Montagu, M. and Depicker, A. (1994) Posttranscriptional silencing of reporter transgenes in tobacco correlates with DNA methylation. Proc. Natl Acad. Sci., 91, 10502-10506. Itoh, T. and Tomizawa, J. (1980) Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. Proc. Natl Acad. Sci., 77, 2450-2454. Izant, J. (1992) Chimeric antisense RNA. In Gene regulation: biology of antisense RNA and DNA.(Eds, Erickson, R. and Izant, J.) Raven Press, New York. Izant, J. and Weintraub, H. (1984) Inhibition of thymidine kinase gene expression by anti-sense RNA: a molecular approach to genetic analysis. Cell, 36, 1007-1015. James, W. and Al-Shamkhani, A. (1995) RNA enzymes as tools for gene ablation. Curr. Opin. Biotech., 6, 44-49. Jeha, S., Luo, X., Beran, M., Kantarjan, H. and Atweh, G. (1998) Antisense RNA inhibition of phosphoprotein p18 expression abrogates the transformed phenotype of leukemic cells. Cancer Res., 56, 1445-1450. Johnson, L. (1994) Posttranscriptional regulation of thymidylate synthase gene expression. J. Cell. Biochem., 54, 387-392. Jones, D. and Winistorfer, S. (1992) Sequence specific generation of a DNA panhandle permits PCR amplification of unknown flanking DNA. Nucleic Acids Res., 20, 595-600. Jones, D. and Winistorfer, S. (1997) Amplification of 4-9kb human genomic DNA flanking a known site using a panhandle PCR variant. Biotechniques, 23, 132-138. Jorgensen, R. (1995) Cosupression, flower color patterns, and metastable gene expression states. Science, 268, 686-691. Kalvakolanu, D. and Borden, E. (1996) An overview of the interferon system: signal transduction and mechanisms of action. Cancer Invest., 14, 25-53. Kasschau, K. and Carrington, J. (1998) A counterdefensive strategy of plant viruses: suppression of posttranscriptional gene silencing. Cell, 95, 461-470. Katze, M., Tomita, J., Black, T., Krug, R., Safer, B. and Hovanessian, A. (1988) Influenza
virus
regulates
protein
synthesis
during
infection
by
repressing
autophosphorylation and activity of the cellular 68,000-Mr prtotein kinase. J. Virol., 62, 3710-3717. 184
Chapter 8
References
Kaufer, N., Simanis, V. and Nurse, P. (1985) Fission yeast Schizosaccharomyces pombe correctly excises a mammalian RNA transcript intervening sequence. Nature, 318, 78-80. Kaufer, N. and Potashkin, J. (2000) Analysis of the splicing machinery in fission yeast: a comparison with budding yeast and mammals. Nucleic Acids Res., 28, 3003-3010. Kawamukai, M. (1999) Isolation of a novel gene, moc2, encoding a putative RNA helicase as a suppressor of sterile strains in Schizosaccharomyces pombe. Biochim. Biophys. Acta, 1446, 93-101. Kennerdell, J. and Carthew, R. (1998) Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell, 95, 1017-1026. Keon, J., Owen, J. and Hargreaves, J. (1999) Lack of evidence for antisense suppression in the fungal plant pathogen Ustilago maydis. Antisense Nucleic Acid Drug Devel., 9, 101-104. Kerr, S., Stark, G. and Kerr, I. (1988) Excess antisense RNA from infectious recombinant SV40 fails to inhibit expression of a transfected, interferon-inducible gene. Eur. J. Biochem, 175, 65-73. Ketting, R., Haverkamp, T., van Luenen, H. and Plasterk, R. (1999) mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner Syndrome helicase and RNaseD. Cell, 99, 133-141. Ketting, R. and Plasterk, R. (2000) A genetic link between co-suppression and RNA interference in C. elegans. Nature, 404, 296-298. Khochbin, S. and Lawrence, J.-J. (1989) An antisense RNA involved in p53 mRNA maturation in murine erytholeukemia cells induced to differentiate. EMBO J., 8, 41074114. Kidd, S. and Young, M. (1986) Transposon-dependent mutant phenotypes at the Notch locus of Drosophila. Nature, 323, 89-91. Kim, S. and Wold, B. (1985) Stable reduction of thymidine kinase activity in cells expressing high levels of anti-sense RNA. Cell, 42, 129-138. Kippert, F. (1995) A rapid permeabilization procedure for accurate quantitative determination of β-galactosidase activity in yeast cells. FEMS Micro. Lett., 128, 201-206.
185
Chapter 8
References
Kislauskis, E., Zhu, X. and Singer, R. (1994) Sequences responsible for intracellular localization of β-actin messenger RNA also affect cell phentoype. J. Cell Biol, 127, 441451. Knect, D. and Loomis, W. (1987) Antisense RNA inactivation of myosin gene expression in Dictyostellium discoideum. Science, 236, 1081-1086. Knee, R. and Murphy, P. (1997) Regulation of gene expression by natural antisense RNA transcripts. Neurochem. Int., 31, 379-392. Kooter, J., Matzke, M. and Meyer, P. (1999) Listening to the silent genes: transgene silencing, gene regulation and pathogen control. Trends Plant Sci., 4, 340-347. Krinke, L. and Wulff, D. (1987) OOP RNA, produced from multicopy plasmids, inhibits λ cII gene expression though an RNAse III-dependent mechanism. Genes Devel., 1, 1005-1013. Krinke, L. and Wulff, D. (1990) RNase III-dependent hydrolysis of lambda cII-O gene mRNA mediated by lambda OOP antisense RNA. Genes Devel., 4, 2223-2233. Kronenwett, R., Haas, R. and Sczakiel, G. (1996) Kinetic selectivity of complementary nucleic acids: bcr-abl-directed antisense RNA and ribozymes. J. Mol. Biol., 259, 632-644. Krystal, G., Armstrong, B. and Battey, J. (1990) N-myc mRNA forms an RNA-RNA duplex with endogenous antisense transcripts. Mol. Cell. Biol., 10, 1480-1491. Kumar, M. and Carmichael, G. (1997) Nuclear antisense RNA induces extensive adenosine modifications and nuclear retention of target transcripts. Proc. Natl Acad. Sci., 94, 3542-3547. Kumar, M. and Carmichael, G. (1998) Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes. Microbiol. Mol. Biol. Rev., 62, 1415-1434. Kurz, A., Lampel, S., Nickolenko, J., Bradl, J., Benner, A., Zirbel, R., Cremer, T. and Lichter, P. (1996) Active and inactive genes localize preferentially in the periphery of chomosome territories. J. Cell Biol., 135, 1195-1205. Kuspa, A., Dingermann, T. and Nellen, W. (1995) Analysis of gene function in Dictyostelium. Experientia, 51, 1116-1123.
186
Chapter 8
References
Laabi, Y., Gras, M., Brouet, J., Berger, R., Larsen, C. and Tsapis, A. (1994) The BCMA gene, preferentially expressed during B lymphoid maturation, is bidirectionally transcribed. Nucleic Acids Res., 22, 1147-1154. Lamond, A. and Earnshaw, W. (1998) Structure and function in the nucleus. Science, 280, 547-553. Lankenau, S., Corces, V. and Lankenau, D. (1994) The Drosophila micropia retrotransposon encodes a testis-specific antisense RNA complementary to reverse transcriptase. Mol. Cell. Biol., 14, 1764-1775. LaSalle, J. and Lalande, M. (1996) Homologous association of oppositely imprinted chomosomal domains. Science, 272, 725-728. Laso, M., Zhu, D., Sagliocco, F., Brown, A., Tuite, M. and McCarthy, J. (1993) Inhibition of translational initiation in the yeast Saccharomyces cerevisiae as a function of the stability and position of hairpin structures in the mRNA leader. J. Biol. Chem., 268, 6453-6462. Law, R. and Devenish, R. (1988) Expression in yeast of antisense RNA to ADE1 mRNA. Biochem. Int., 17, 673-679. Lawrence, J., Singer, R. and Marselle, L. (1989) Highly localized tracks of specific transcripts within interphase nuclei visualized by in situ hybridization. Cell, 57, 493-502. Ledda, M., Adris, S., Bravo, A., Kairiyama, C., Bover, L., Chernajovsky, Y. and al., e. (1997) Suppression of SPARC expression by antisense RNA abrogates the tumorigenicity of human melanoma cells. Nat. Med., 3, 171-176. Lee, J. and Lu, N. (1999) Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell, 99, 47-57. Lee, N., Bertrand, E. and Rossi, J. (1999) mRNA localization signals can enhance the intracellular effectiveness of hammerhead ribozymes. RNA, 5, 1200-1209. Lee, R., Feinbaum, R. and Ambros, V. (1993) The C. elegans heterochonic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 75, 843-854. Lee, S., Frost, L. and Paranchych, W. (1992) FinOP repression of the F plasmid involves extension of the half-life of FinP antisense RNA by FinO. Mol. Gen. Genet., 235, 131-139.
187
Chapter 8
References
Lehmann, M., Patzel, V. and Sczakiel, G. (2000) Theoretical design of antisense genes with statistically increased efficacy. Nucleic Acids Res., 28, 2597-2604. Lehman, S. (1999) Virus treatment questioned after Gene Therapy death. Nature, 401, 517-518. Lennard, A., Gaston, K. and Fried, M. (1994) The Surf-1 and Surf-2 genes and their essential bidirectional promoter elements are conserved between mouse and human. DNA Cell Biol., 13, 1117-1126. Lerner, A., D-Adamio, L., Diener, A., Clayton, L. and Reinherz, E. (1993) CD3ε/η/θ locus is colinear with and transcribed antisense to the gene encoding the transcription factor Oct-1. J. Immunol., 151, 3152-3162. Li, Y. and Wang, Y. (1997) Inhibition of multidrug resistant KBV200 cells by MDR1 antisense RNA. Biochem. Biophys. Res. Com., 239, 345-348. Li, Y.-X., Farrell, M., Liu, R., Moharty, N. and Kirby, M. (2000) Double-stranded RNA injection produces null phenotypes in Zebrafish. Devel. Biol., 217, 394-405. Lichten, M. and Haber, J. (1989) Position effects in ectopic and allelic mitotic recombination in Saccharomyces cerevisiae. Genetics, 123, 261-268. Liley, D. (1981) In vivo consequences of plasmid topology. Nature, 292, 380-382. Lipman, D. (1997) Making (anti)sense of non-coding sequence conservation. Nucleic Acids Res., 25, 3580-3583. Lobachev, K., Shor, B., Tran, H., Taylor, W., Keen, J., Resnick, M. and Gordenin, D. (1998) Factors affecting inverted repeat stimulation of recombination and deletion in Saccharomyces cerevisiae. Genetics, 148, 1507-1524. Lohmann, J., Endl, I. and Bosch, T. (1999) Silencing of developmental genes in Hydra. Devel. Biol., 214, 211-214. Long, L., Rubin, R., Baserga, R. and Brodt, P. (1998) Loss of metastatic phenotype in murine carcinoma cells expressing an antisense RNA to the insulin-like growth factor receptor. Cancer Res., 55, 1006-1009. Lowenstein, P. and Symonds, G. (1997) Inhibition of Moloney murine leukemia virus by a retroviral vector, LNL6, carrying ribozymes targeted to the 5' non-coding sequence. J. Gen. Virol., 78, 2587-2590.
188
Chapter 8
References
Lu, Q., Bauer, J. C. and Greener, A. (1997) Using Schizosaccharomyces pombe as a host for expression and purification of eukaryotic proteins. Gene, 200, 135-144. Lucy, A., Guo, H.-S., Li, W.-X. and Ding, S.-W. (2000) Suppression of posttranscriptional gene silencing by a plant viral protein localized in the nucleus. EMBO J., 19, 1672-1680. Malik, K., Wallace, J., Ivins, S. and Brown, K. (1995) Identification of an antisense WT1 promoter in intron 1: implications for WT1 gene regulation. Oncogene, 11, 15891595. Marcus, P. (1981) The interferon inducer moiety of viruses: a single molecule of dsRNA. Tex. Rep. Biol. Med., 41, 70-75. Marie, B., Bacon, J. and Blagburn, J. (2000) Double-stranded RNA interference shows that Engrailed controls the synaptic specificity of identified sensory neurons. Curr. Biol., 10, 289-292. Marshall, W., Dernburg, A., Harmon, B., Agard, D. and Sedat, J. (1996) Specific interactions of chomatin with the nuclear envelope: positional determination within the nucleus in Drosophila melanogaster. Mol. Biol. Cell, 7, 825-842. Martiat, P., Lewalle, A., Taj, A., Phillipe, M., Larondelle, Y., Vaerman, J. and al., e. (1993) Retrovirally transduced antisense sequences stably suppress P210 bcr-abl expression and inhibit the proliferation of bcr/abl conatining cell lines. Blood, 81, 502-509. Maundrell, K. (1990) nmt1 of fission yeast: a highly transcribed gene completely repressed by thiamine. J. Biol. Chem., 265, 10857-10864. Maundrell, K. (1993) Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene, 123, 127-1390. Mauro, V. and Edelman, G. (1997) rRNA-like sequences occur in diverse primary transcripts: implications for the control of gene expression. Proc. Natl Acad. Sci., 94, 422427. McGuinness, T., Porteus, M., Smiga, S., Bulfone, A., Kingsley, C., Qiu, M., Liu, J., Long, J., Xu, D. and Rubenstein, J. (1996) Sequence, organization, and transcription of the Dlx-1 and Dlx-2 locus. Genomics, 35, 473-485. Melton, D. (1985) Injected anti-sense RNAs specifically block messenger RNA translation in vivo. Proc. Natl Acad. Sci., 82, 144-148. 189
Chapter 8
References
Mercols, D. and Cohen, J. (1995) Antisense approaches to cancer Gene Therapy. Cancer Gene Ther., 2, 47-59. Merino, E., Balbas, P., Puente, J. and Bolivar, F. (1994) Antisense overlapping open reading frames in genes from bacteria to humans. Nucleic Acids Res., 22, 1903-1908. Michienzi, A., Prislei, S. and Bozzoni, I. (1996) U1 small nuclear RNA chimeric ribozymes with substrate specificity for the Rev pre-mRNA of human immunodeficiency virus. Proc. Natl Acad. Sci., 93, 7219-7224. Milner, N., Mir, K. and Southern, E. (1997) Selecting effective antisense reagents on combinatorial oligonucleotide arrays. Nat. Biotech., 15, 537-541. Milot, E., Strouboulis, J., Trimborn, T., Wijgerede, M., Boer, E., langeveld, A., TanUn, K., Vergeer, W., Yannoutsos, N., Grosveld, F. and Fraser, P. (1996) Heterchomatin effects on the frequency and duration of LCR-mediated gene transcription. Cell, 87, 105114. Misquitta, L. and Paterson, B. (1999) Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): A role for nautilus in embryonic somatic muscle formation. Proc. Natl Acad. Sci., 96, 1451-1456. Misteli, T. and Spector, D. (1998) The cellular organization of gene expression. Curr. Opin. Cell Biol., 10, 323-331. Miyajima, N., Horiuchi, R., Shibuya, Y., Fukushige, S., Matsubara, K., Toyoshima, K. and Yamamoto, T. (1989) Two erbA homologs encoding proteins with different T3 binding capacities are transcribed from opposite DNA strands of the same genetic locus. Cell, 57, 31-39. Miyake, S. and Yamashita, S. (1998) Identification of sna41 gene, which is the suppressor of nda4 mutation and is involved in DNA replication in Schizosaccharomyces pombe. Genes Cells, 3, 157-166. Mol, J., Cornish, E., Mason, J. and Koes, R. (1999) Novel coloured flowers. Curr. Opin. Biotech., 10, 198-201. Mol, J., Holton, T. and Koes, R. (1995) Floriculture: genetic engineering of commerical traits. Trends Biotech., 13, 350-355.
190
Chapter 8
References
Mol, J., van der Krol, A., van Tunen, A., van Bokland, R., de Lange, P. and Stuitje, A. (1990) Regulation of plant gene expression by antisense RNA. FEBS Lett., 268, 427430. Montgomery, M. and Fire, A. (1998) Double-stranded RNA as a mediator in sequence-specific genetic silencing and co-suppression. Trends Genet., 14, 255-258. Montgomery, M., Xu, S. and Fire, A. (1998) RNA as a target of double-stranded RNA-mediated genetic interference in Caenorhabditis elegans. Proc. Natl Acad. Sci., 95, 15502-15507. Moreno, S., Klar, A. and Nurse, P. (1991) Molecular and genetic analysis of the fission yeast Schizosaccharomyces pombe. Methods Enzymol., 194, 795-823. Moreno, S. and Nurse, P. (1994) Regulation of progression though the G1 phase of the cell cycle by the rum1+ gene. Nature, 367, 236-242. Munroe, S. (1988) Antisense RNA inhibits splicing of pre-mRNA in vitro. EMBO J., 7, 2523-2532. Munroe, S. and Dong, X. (1992) Heterogeneous nuclear ribonucleoprotein A1 catalyzes RNA.RNA annealing. Proc. Natl Acad. Sci., 89, 895-899. Munroe, S. and Lazar, M. (1991) Inhibition of c-erbA mRNA splicing by a naturally occurring antisense RNA. J. Biol. Chem., 266, 22083-22086. Munz, P., Wolf, K., Kohli, J. and Leupold, U. (1989) Genetics Overview. In Molecular Biology of the Fission Yeast (Eds, Nasim, A., Young, P. and Johnson, B.) Academic Press, Inc., San Diego. Murashov, A. and Wolgemuth, D. (1996) Sense and antisense transcripts of the developmentally regulated murine hsp70.2 gene are expressed in distinct and only partially overlapping areas in the adult brain. Brain Res. Mol. Brain Res., 37, 85-95. Murphy, P. and Knee, R. (1994) Identification and characterization of an antisense RNA transcript (gfg) from the human basic fibroblast growth factor gene. Mol. Endocrinol., 8, 852-859. Murray, J. and Crockett, N. (1992) Antisense techniques: an overview. In Antisense RNA and DNA (Ed, Murray, J.) Wiley-Liss, Inc, New York, pp. 1-49. Nagane, M., Asai, A., Shibui, S., Nomura, K. and Kuchino, Y. (1997) Application of antisense ribonucleic acid complementary to O6-methylguanine-deoxyribonucleic acid 191
Chapter 8
References
methyl-transferase messenger ribonucleic acid for therapy of malignant gliomas. Neurosurgery, 41, 434-441. Nakano, H., Amemiya, S., Shiokawa, K. and Taira, M. (2000) RNA interference for the organizer-specific gene Xlim-1 in Xenopus embryos. Napoli, C., Lemieux, C. and Jorgensen, R. (1990) Introduction of a chalcone synthase gene into Petunia results in reversible co-suppression of homologous genes in trans. Plant Cell, 2, 279-289. Nedbal, W., Frey, M., Willemann, B., Zentgraf, H. and Sczakiel, G. (1997) Mechanistic insights into p53-promoted RNA-RNA annealing. J. Mol. Biol., 266, 677-687. Neff, T., Shotkoski, F. and Stamatoyannopoulos, G. (1997) Stem cell Gene Therapy, position effects and chomatin insulators. Stem Cells, 15(suppl 1), 265-271. Nellen, W. and Lichtenstein, C. (1993) What makes an mRNA anti-sensitive? Trends Biochem. Sci., 18, 419-423. Nepveu, A. and Marcu, K. (1986) Intragenic pausing and anti-sense transcription within the murine c-myc locus. EMBO J., 5, 2859-2865. Ngo, H., Tschudi, C., Gull, K. and Ullu, E. (1998) Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proc. Natl Acad. Sci., 95, 14687-14692. Nimmo, E., Cranston, G. and Allshire, R. (1994) Telomere-associated chomosome breakage in fission yeast results in variegated expression of adjacent genes. EMBO J., 13, 3801-3811. Nishikura, K. and Murray, J. (1987) Antisense RNA of proto-oncogene c-fos blocks renewed growth of quiescent 3T3 cells. Mol. Cell. Biol., 7, 639-649. Nishikura, K., Yoo, C., Kim, U., Murray, J., Estes, P., Cash, F. and Liebhaber, S. (1991) Substrate specificity of the dsRNA unwinding/modifying activity. EMBO J., 10, 3523-3532. Ochman, H., Ayala, F. and Hartl, D. (1993) Use of polymerase chain reaction to amplify segments outside boundaries of known sequences. Methods Enzymol., 218, 309321. Okano, H., Aruga, J., Nakagawa, T., Shiota, C. and Mikoshiba, K. (1991) Myelin basic protein gene and the function of antisense RNA in its repression in myelin-deficient mutant mouse. J. Neurochem., 56, 560-567. 192
Chapter 8
References
Olsson, L., Larsen, M., Ronnow, B., Mikkelsen, J. and Nielsen, J. (1997) Silencing MIG1 in Saccharomyces cerevisiae: Effects of antisense MIG1 expression and MIG1 gene disruption. Appl. Environ. Micro., 63, 2366-2371. Pal, B., Scherer, L., Zelby, L., Bertrand, E. and Rossi, J. (1998) Monitoring retroviral DNA dimerization in vivo via hammerhead ribozyme cleavage. J. Virol., 72, 8349-8353. Pal-Bhadra, M., Bhadra, U. and Birchler, J. (1997) Cosuppression in Drosophila: gene silencing of alcohol dehydrogenase by white-adh transgenes is polycomb dependent. Cell, 90, 479-490. Pang, K. and Knecht, D. (1997) Partial inverse PCR: a technique for cloning flanking sequences. Biotechniques, 22, 1046-1048. Paterson, B., Roberts, B. and Kuff, E. (1977) Structural gene identification and mapping by DNA.mRNA hybrid-arrested cell-free translation. Proc. Natl Acad. Sci., 74, 4370-4374. Patrikakis, M., Izant, J. and Atkins, D. (1996) Comparison of the 3' non-coding regions in Schizosaccharomyces pombe expression vectors: efficiencies of transcription termination and mRNA 3'-end formation. Curr. Genet., 30, 151-158. Patzel, V. and Sczakiel, G. (1998) Theoretical design of antisense RNA structures substantially improves annealing kinetics and efficacy in human cells. Nat. Biotech., 16, 64-68. Paul, M. and Bass, B. (1998) Inosine exists in mRNA at tissue-specific levels and is most abundant in brain mRNA. EMBO J., 17, 1120-1127. Pecorino, L., Rickles, R. and Strickland, S. (1988) Anti-sense inhibition of tissue plasminogen activator production in differentiated F9 teretocarcinoma cells. Dev. Biol., 129, 408-416. Pestka, S., Daugherty, B., Jung, V., Hotta, K. and Pastka, R. (1984) Anti-mRNA: specific inhibition of translation of single mRNA molecules. Proc. Natl Acad. Sci., 81, 7525-7528. Peterson, J. and Myers, A. (1993) Functional analysis of mRNA 3' end formation signals in the convergent and overlapping transcription untis of the S. cerevisiae genes RHO1 and MRP2. Nucleic Acids Res., 21, 5500-5508.
193
Chapter 8
References
Petschek, J., Mermer, M., Schechelhoff, M., Simone, A. and Vaughn, J. (1996) RNA editing in Drosophila 4f-rnp gene nuclear transcripts by multiple A-to-G conversions. J. Mol. Biol., 259, 885-890. Pierce, M. and Ruffner, D. (1998) Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition. Nucleic Acids Res., 26, 5093-5101. Plasterk, R. & Ketting, R. (2000) The silence of the genes. Curr. Opin. Genet. Devel. 10, 562-567. Politz, J., Taneja, K. and Singer, R. (1995) Characterization of hybridization between synthetic oligodeoxynucleotides and RNA in living cells. Nucleic Acids Res., 23, 49464953. Polson, A. and Bass, B. (1994) Preferntial selection of adenosines for modification by double-stranded RNA adenosine deaminase. EMBO J., 13, 5701-5711. Pontius, B. (1993) Close encounters: why unstructured, polymeric domains can increase rates of specific macromolecular association. Trends Biochem. Sci., 18, 181-186. Pontius, B. and Berg, P. (1990) Renaturation of complementary DNA strands mediated by purified mammalian heterogeneous nuclear ribonucleoprotein A1 protein: implications for a mechanism for rapid molecular assembly. Proc. Natl. Acad. Sci .U S A., 87, 8403-8407. Portman, D. and Dreyfuss, G. (1994) RNA annealing activities in HeLa nuclei. EMBO J., 13, 213-221. Prang, N., Wolf, H. and Schwarzmann, F. (1995) Epstein-Barr virus lytic replication is controlled by posttrancriptional negative regulation of BZLF1. J. Virol., 69, 2644-2648. Prentice, H. (1992) High efficiency transformation of Schizosaccharomyces pombe by electroporation. Nucleic Acids Res., 20, 621. Prochownik, E., Kukowska, J. and Rodgers, C. (1988) c-myc antisense transcripts accelerate differentiation and inhibit G1 progression in murine erytholeukemia cells. Mol. Cell. Biol., 8, 3683-3695. Proudfoot, N. (1986) Transcriptional interference and termination between duplicated α-globin gene constructs suggests a novel mechanism for gene regulation. Nature, 322, 562-565. 194
Chapter 8
References
Qian, S., Hongo, S. and Jacobs-Lorena, M. (1988) Antisense ribosomal protein gene expression specifically disrupts oogenesis in Drosophila melanogaster. Proc. Natl Acad. Sci., 85, 9601-9605. Ramer, S., Elledge, S. and Davis, R. (1992) Dominant genetics using a yeast genomic library under the conrol of a strong inducible promoter. Proc. Natl Acad. Sci., 89, 1158911593. Raponi, M., Atkins, D., Dawes, I. and Arndt, G. (2000a) The influence of antisense gene location on target gene regulation in the fission yeast Schizosaccharomyces pombe. Antisense Nucleic Acid Drug Devel., 10, 29-34. Raponi, M., Dawes, I. and Arndt, G. (2000b) Characterization of flanking DNA using long inverse PCR. BioTechniques, 28, 838-844. Raponi, M. and Symonds, G. (1999) Gene delivery technology: non-viral and viral vector systems. In Ex Vivo Cell Therapy (Eds, Schindhelm, K. and Nordon, R.) Academic Press, Sydney, pp. 293-321. Ratcliff, F., Harrison, B. and Baulcombe, D. (1997) A similarity between viral defense and gene silencing in plants. Science, 276, 1558-1560. Rebagliati, M. and Melton, D. (1987) Antisense RNA injections in fertilized frog eggs reveal an RNA duplex unwinding activity. Cell, 48, 599-605. Reik, W. and Constancia, M. (1997) Making sense or antisense? Nature, 389, 669671. Rittner, K., Burmester, C. and Sczakiel, G. (1993) In vitro selection of fasthybridizing and effective antisense RNAs directed against the human immunodeficiency virus type 1. Nucleic Acids Res., 21, 1381-1387. Rittner, K. and Sczakiel, G. (1991) Identification and analysis of antisense RNA target regions of the human immunodeficiency virus type 1. Nucleic Acids Res., 19, 14211426. Romano, G., Micheli, P., Pacilio, C. and Giordano, A. (2000) Latest developments in gene transfer technology: achievements, perspectives, and controversies over therapeutic applications. Stem Cells, 18, 19-39.
195
Chapter 8
References
Romano, N. and Macino, G. (1992) Quelling: transient inactivation of gene expression in Neurospora crassa by transformation with homologous sequences. Mol. Microbiol., 6, 3343-3353. Roninson, I., Gudkov, A., Holzmayer, T., Kirschling, D., Kazarov, A., Zelnick, C., Mazo, I., Axenovich, S. and Thimmapaya, R. (1995) Genetic suppressor elements: new tools for molecular oncology--thirteenth Cornelius P. Rhoads Memorial Award Lecture. Cancer Res., 55, 4023-4028. Rosario, M., Stephans, J., Zakel, J., Escobedo, J. and Giese, K. (1996) Positive selection system to screen for inhibitors of human immunodefiency virus-1 transcription. Nat. Biotech., 14, 1592-1596. Rosbash, M. and Singer, R. (1993) RNA travel: Tracks from DNA to cytoplasm. Cell, 5, 399-401. Ross, J. (1996) Control of messenger RNA stability in higher eukaryotes. Trends Genet., 12, 171-175. Rossi, J. (1992) Ribozymes. Curr. Opin. Biotech., 3, 3-7. Rougelle, C., Cardoso, C., Fontes, M., Colleaux, L. and Lalande, M. (1998) An imprinted antisense RNA overlaps UBE3A and a second maternally expressed transcript. Nat. Genet., 19, 15-16. Ruiz, F., Vayssie, L., Klotz, C., Sperling, L. and Madaddu, L. (1998) Homologydependent gene silencing in Paramecium. Mol. Biol. Cell., 9, 931-943. Russell, P. (1989) Gene cloning and expression in fission yeast. In Molecular Biology of the Fission Yeast. (Eds, Nasim, A., Young, P. and Johnson, B.) Academic Press, San Diego, pp. 243-271. Sadiq, M., Hildebrandt, M., Maniak, M. and Nellen, W. (1994) Developmental regulation of antisense-mediated gene silencing in Dictyostelium. Antisense Res. Devel., 4, 263-267. Sagliocco, F., Laso, M., Zhu, D., Tuite, M., McCarthy, J. and Brown, A. (1993) The influence of 5'-secondary structures upon ribosome binding to mRNA during translation in yeast. J. Biol. Chem., 268, 26522-26530.
196
Chapter 8
References
Saiki, R., Gelfand, D., Stoffel, S., Scharf, S., Higuchi, R., Horn, G., Mullis, K. and Erlich, H. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science, 239, 487-491. Saleh, M., Stacker, S. and Wilks, A. (1996) Inhibition of growth of C6 glioma cells in vivo by expression af antisense vascular endothelial growth factor sequence. Cancer Res., 56, 393-401. Salmons, B., Groner, B., Friis, R., Muellener, D. and Jaggi, R. (1986) Expression of anti-sense mRNA in H-ras transfected NIH/3T3 cells does not suppress the transformed phenotype. Gene, 45, 215-220. Samarsky, D., Ferbeyre, G., Bertrand, E., Singer, R., Cedegren, R. and Fournier, M. (1999) A small nucleolar RNA:ribozyme hybrid cleaves a nucleolar RNA target in vivo with near-perfect efficiency. Proc. Natl Acad. Sci., 96, 6609-6614. Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sanchez-Alvarado, A. and Newmark, P. (1999) Double-stranded RNA specifically disrupts gene expression during planarian regeneration. Proc. Natl Acad. Sci., 96, 50495054. Sanford, J. and Johnston, S. (1985) The concept of parasite-derived resistance deriving resistance genes from the parasite's own genome. J. Theor. Biol., 113, 395-405. Sanger, F., Nicklen, S. and Coulson, A. (1977) DNA sequencing with chainterminating inhibitors. Proc. Natl Acad. Sci., 74, 5463-5467. Santoro, S. and Joyce, G. (1997) A general purpose RNA-cleaving DNA enzyme. Proc. Natl Acad. Sci., 94, 4246-4266. Sarver, N., Cantin, E., Chang, P., Zaia, J., Ladne, P., Stephens, D. and Rossi, J. (1990) Ribozymes as potential anti-HIV-1 therapeutic agents. Science, 247, 1222-1225. Scherczinger, C. and Knecht, D. (1993) Co-suppression of Dictyostelium discoideum myosin II heavy-chain gene expression by a sense orientation transcript. Antisense Res. Devel., 3, 207-217. Scherr, M. and Rossi, J. (1998) Rapid determination and quantitation of the accessibility to native RNAs by antisense oligodeoxynucleotides in murine cell extracts. Nucleic Acids Res., 26, 5079-5085. 197
Chapter 8
References
Scherr, M., Rossi, J., Sczakiel, G. and Patzel, V. (2000) RNA accessibility prediction: a theoretical approach is consistent with experimental studies in cell extracts. Nucleic Acids Res., 28, 2455-2461. Schinke, M., Bohm, M., Bricca, G., Ganten, D. and Bader, M. (1996) Permanent inhibtion of angiotensinogen synthesis by antisense RNA expression. Hypertension, 27, 508-513. Schwall, G., Safford, R., Westcott, R., Jeffcoat, R., Tayal, A., Shi, Y.-C., Gidley, M. and Jobling, S. (2000) Production of very-high-amylose potato starch by inhibition of SBE A and B. Nat. Biotech., 18, 551-554. Sczakiel, G. (1997) The design of antisense RNA. Antisense Nucleic Acid Drug Devel., 7, 439-444. Sczakiel, G. and Pawlita, M. (1991) Inhibition of human immunodeficiency virus type 1 replication in human T cells stably expressing antisense RNA. J. Virol., 65, 468-472. Seeburg, P. (1996) The role of RNA editing in controlling glutamate receptor channel properties. J. Neurochem., 66, 1-5. Sharp, P. (1999) RNAi and double-strand RNA. Genes Dev., 13, 139-141. Sheehy, R., Kramer, M. and Hiatt, W. (1988) Reduction of polygalacturonase activity in tomato fruit by antisense RNA. Proc. Natl Acad. Sci., 85, 8805-8809. Shepard, J., Walldorf, U., Hug, P. and Gehing, W. (1989) Fruit flies with additional expression of the elongation factor EF-1α live longer. Proc. Natl Acad. Sci., 86, 75207521. Shi, H., Djikeng, A., Mark, T., Wirtz, E., Tschudi, C. and Ullu, E. (2000) Genetic interference in Trypanosoma brucei by heritable and inducible double-stranded RNA. RNA, 6, 1069-1076. Shiina, N., Gotoh, Y., Kubomura, N., Iwamatsu, A. and Nishida, E. (1994) Microtubule severing by elongation factor 1α. Science, 266, 282-285. Shuster, E. and Guthie, C. (1990) Human U2 snRNA can function in pre-mRNA splicing in yeast. Nature, 345, 270-273. Shyamala, V. and Ames, G.-L. (1989) Genome walking by single-specific-primer polymerase chain reaction:SSP-PCR. Gene, 84, 1-8.
198
Chapter 8
References
Siegal, M. and Hartl, D. (1998) An experimental test for lineage-specific posiion effects on alcohol dehydrogenase (Adh) genes in Drosophila. Proc. Natl Acad. Sci., 95, 15513-15518. Silverman, T., Noguchi, M. and Safer, B. (1992) Role of sequences within the first intron in the regulation of expression of eukaryotic initiation factor 2α. J. Biol. Chem., 267, 9738-9742. Simons, R. (1988) Naturally occuring antisense RNA control - a brief review. Gene, 72, 35-44. Simons, R. and Kleckner, N. (1983) Translational control of IS10 transposition. Cell, 34, 683-691. Simons, R. and Kleckner, N. (1988) Biological regulation by antisense RNA in prokaryotes. Annu. Rev. Genet., 22, 567-600. Singer, M., Jones, O. and Nirenberg, M. (1963) The effect of secondary structure on the template activity of polyribonucleotides. Proc. Natl Acad. Sci., 49, 392-399. Singer, R. and Green, M. (1997) Compartmentalization of eukaryotic gene expression: causes and effects. Cell, 91, 291-294. Singh, P., Owlia, A., Varro, A., Dai, B., Rajaraman, S. and Wood, T. (1998) Gastrin gene expression is required for the proliferation and tumorigenicity of human colon cancer cells. Cancer Res., 56, 4111-4115. Sioud, M. and Jespersen, L. (1996) Enhancement of hammerhead ribozyme catalysis by glyceraldehyde-3-phosphate dehydrogenase. J. Mol. Biol., 257, 775-789. Skeiky, Y. and Iatrou, K. (1990) Silkmoth chorion antisense RNA. J. Mol. Biol., 213, 53-66. Skotzko, M., Wu, L., French Anderson, W., Gordon, E. and Hall, F. (1995) Retroviral vector-mediated gene transfer of antisense cyclin G1 (CYCG1) inhibits proliferation of human osteogenic sarcoma cells. Cancer Res., 55, 5493-5498. Smardon, A., Spoerke, J., Stacey, S., Klein, M., Mackin, N. and Maine, E. (2000) EGO-1 is related to RNA-directed RNA polymerase and functions in germline development and RNA interference in C. elegans. Curr. Biol., 10, 169-178.
199
Chapter 8
References
Smith, C., Watson, C., Ray, J., Bird, C., Morris, P., Schuch, W. and Grierson, D. (1988) Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes. Nature, 334, 724-726. Smith, N., Singh, S., Wang, M., Stoutjesdijk, P., Green, A. and Waterhouse, P. (2000) Total silencing by intron-spliced hairpin RNAs. Nature, 407, 319-320. Sommer, B., Kohler, M., Sprengel, R. and Seeburg, P. (1991) RNA editing in brain controls a determinant of ion flow in glutamate-gated channels. Cell, 67, 11-19. Southern, E. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol., 98, 503-517. Spann, T., Brock, D., Lindsey, D., Wood, S. and Gomer, R. (1996) Mutagenesis and gene identification in Dicytostelium by shotgun antisense. Proc. Natl Acad. Sci., 93, 50035007. Spencer, C., Gietz, R. and Hodgetts, R. (1986) Overlapping transcription units in the dopa decarboxylase region of Drosophila. Nature, 322, 279-281. St Johnston, D. (1995) The intracellular localization of messenger RNAs. Cell, 81, 161-170. Steitz, J. (1989) Immunoprecipitation of ribonucleoproteins using autoantibodies. Methods Enzymol., 180, 468-481. Stockhaus, J., Hofer, M., Renger, G., Westhoff, P., Wydrzynski, T. and Willmitzer, L. (1990) Anti-sense RNA efficiently inhibits formation of the 10kd polypeptide of photosystem II in transgenic potato plants: analysis of the role of the 10kd protein. EMBO J., 9, 3013-3021. Stoesser, G., Moseley, M., Sleep, J., McGowran, M., Garcia-Pastor, M. and Sterk, P. (1998) The EMBL nucleotide sequence database. Nucleic Acids Res., 26, 8-15. Stout, J. and Caskey, C. (1990) Antisense RNA inhibition of HPRT synthesis. Somat. Cell Mol. Genet., 16, 369-382. Stull, R. and Szoka, F. J. (1995) Antigene, ribozyme and aptamer nucleic acid drugs: progress and prospects. Pharm. Res., 12, 465-483. Sullenger, B. and Cech, T. (1993) Tethering ribozymes to a retroviral packaging signal for destruction of viral RNA. Science, 262, 1566-1569.
200
Chapter 8
References
Sun, L.Q, Cairns, M., Gerlach, W., Witherington, C., Wang, L. and King, A. (1999) Suppression of smooth muscle cell proliferation by a c-myc RNA-cleaving deoxyribozyme. J. Biol. Chem., 274, 17236-17241. Sun, L.Q., Wang, L., Gerlach, W. and Symonds, G. (1995) Target sequence-specific inhibition of HIV-1 replication by ribozymes directed to tat RNA. Nucleic Acids Res., 23, 2902-2913. Sun, L. Q., Warrilow, D., Wang, L., Witherington, C., Macpherson, J. and Symonds, G. (1994) Ribozyme-mediated suppression of Moloney murine leukemia virus and human immunodeficiency virus type I replication in permissive cell lines. Proc. Natl Acad. Sci., 91, 9715-9719. Sunnerhagen, P. (1993) PCR used to determine mating type in S. pombe. BioTechniques, 14, 18. Sweeney, R., Fan, Q. and Yao, M.-C. (1996) Antisense ribosomes: rRNA as a vehicle for antisense RNAs. Proc. Natl Acad. Sci., 93, 8518-8523. Symons, R. (1994) Ribozymes. Curr. Opin. Struct. Biol., 4, 322-330. Tabara, H., Sarkissian, M., Kelly, W., Fleenor, J., Grishok, A., Timmons, L., Fire, A. and Mello, C. (1999) The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell, 99, 123-132. Tabler, M. (1993) Antisense RNA in plants: a tool for analysis and suppression of gene function. In Morphogenesis in Plants (Eds, Roubelakis-Angelakis, K. and Tran Thanh Van, K.) Plenum Press, New York, pp. 237-258. Takayama, K. and Inouye, M. (1990) Antisense RNA. Biochem. Mol. Biol., 22, 155184. Tang, C., Bueno, A. and Russell, P. (1994) nft1+ encodes a 6-cysteine zinc fingercontaining transcription factor that regulates the nmt1 promoter in fission yeast. J. Biol. Chem., 269, 11921-11926. Tatsuka, M., Mitsui, H., Wada, M., Nagata, A., Nojima, H. and Okayama, H. (1992) Elongation factor-1α gene determines susceptibility to transformation. Nature, 359, 333336.
201
Chapter 8
References
Tavernarakis, N., Wang, S., Dorovkov, M., Ryazanov, A. and Driscoll, M. (2000) Heritable and inducible genetic interference by doublestranded RNA encoded by transgenes. Nat. Genet., 24, 180-183. Thompson, J., Higgins, D. and Gibson, T. (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment though sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res., 22, 4673-4680. Tomizawa, J. (1984) Control of ColE1 plasmid replication: the process of binding of RNA I to the primer transcript. Cell, 38, 861-870. Tomizawa, J. (1986) Control of ColE1 replication: binding of RNA I to RNA II and inhibition of primer formation. Cell, 47, 89-97. Tomizawa, J., Itoh, T., Selzer, G. and Som, T. (1981) Inhibition of ColE1 RNA primer formation by a plasmid-specified small RNA. Proc. Natl Acad. Sci., 78, 1421-1425. Tosic, M., Roach, A., Rivaz, J.-D., Dolivo, M. and Matthieu, J.-M. (1990) Posttranscriptional events are responsible for low expression of myelin basic protein in myelin deficient mice: role of natural antisense RNA. EMBO J., 9, 401-406. Tranque, P., Hu, M.-Y., Edelman, G. and Mauro, V. (1998) rRNA complementarity with mRNAs: A possible basis for mRNA-ribosome interactions and translational control. Proc. Natl Acad. Sci., 95, 12238-12243. Triglia, T., Peterson, M. and Kemp, D. (1988) A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res., 16, 8186. Trojan, J., Johnson, T., Rudin, S., Ilan, J. and Tykocinski, M. (1993) Treatment and prevention of rat glioblastoma by immunogenic C6 cells expressing antisense insulin-like growth factor I RNA. Science, 259, 94-97. Tsuchihashi, Z., Khosla, M. and Herschlag, D. (1993) Protein enhancement of hammerhead ribozyme catalysis. Science, 262, 99-102. Tuschl, T., Zamore, P., Lehmann, R., Bartel, D. and Sharp, P. (1999) Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev., 13, 3191-3197. Van der Krol, A., Mol, J. and Stuitje, A. (1988) Modulation of eukaryotic gene expression by complementary RNA or DNA sequences: an overview. Biotechniques, 6, 958-976. 202
Chapter 8
References
Van der Krol, A., Mur, L., Lange, P., Gerats, A., Mol, J. and Stuitje, A. (1990) Antisense chalcone synthase genes in petunia: visualization of variable transgene expression. Mol. Gen. Genet., 220, 204-212. Van Duin, Van den Tol, J., Hoeimakers, H., Bootsma, D., Rupp, I., Reynolds, P., Prakash, L. and Prakash, S. (1989) Conserved pattern of antisense overlapping transcription in the homologous human ERCC-1 and yeast RAD10 DNA repair gene regions. Mol. Cell. Biol., 9, 1794-1798. Vanhee-Brossollet, C., Thoreau, H., Serpente, N., D'Auriol, L., Levy, J. and Vaquero, C. (1995) A natural antisense RNA derived from the HIV-1 env gene encodes a protein which is recognized by circulating antibodies of HIV+ individuals. Virology, 206, 196-202. Vanhee-Brossollet, C. and Vaquero, C. (1998) Do natural antisense transcripts make sense in eukaryotes? Gene, 211, 1-9. Voinnet, O. and Baulcombe, D. (1997) Systemic signalling in gene silencing. Nature, 389, 553. Voinnet, O., Pinto, Y. and Baulcombe, D. (1999) Suppression of gene silencing: A general strategy used by diverse DNA and RNA viruses of plants. Proc. Natl Acad. Sci., 96, 14147-14152. Voinnet, O., Vain, P., Angell, S. and Baulcombe, D. (1998) Systemic spread of sequence-specific transgene RNA degradation in plants is initiated by localized introduction of ectopic promoterless DNA. Cell, 95, 177-187. Volk, R., Koster, M., Poting, A., Hartmann, L. and Knochel, W. (1989) An antisense transcript from the Xenopus laevis bFGF gene coding for an evolutionary conserved 24kd protein. EMBO J., 8, 2983-2988. Wagner, E. and Brantl, S. (1998) Kissing and RNA stability in antisense control of plasmid replication. Trends Biochem. Sci., 23, 451-454. Wagner, E. and Simons, R. (1994) Antisense RNA control in bacteria, phages, and plasmids. Annu. Rev. Microbiol., 48, 713-742. Wagner, R., Smith, J., Cooperman, B. and Nishikura, K. (1989) A double-stranded RNA unwinding activity introduces structural alterations by means of adenosine to inosine conversions in mammalian cells and Xenopus eggs. Proc. Natl Acad. Sci., 86, 2647-2651.
203
Chapter 8
References
Wallenfels, K. and Weil, R. (1972) β-Galactosidase. In The Enzymes, Vol. 7 (Ed, Boyer, P.) Academic Press, New York, pp. 617-663. Wands, J., Geissler, M., JZ, P., Blum, H., Wezsacker, F., Moh, L. and al., e. (1997) Nucleic acid-based antiviral and Gene Therapy of chonic hepatitis B infection. J. Gastro. Hepatol., 12, S354-S369. Ward, D. and Murray, N. (1979) Convergent transcription in bacteriophage λ: interference with gene expression. J. Mol. Biol., 133, 249-266. Wargelius, A., Ellingsen, S. and Fjose, A. (1999) Double-stranded RNA induces specific developmental defects in Zebrafish embryos. Biochem. Biophys. Res. Com., 263, 156-161. Warren, G. and Green, R. (1985) Comparison of physical and genetic properties of palindromic DNA sequences. J. Bacteriol., 161, 1103-1111. Waterhouse, P., Graham, M. and Wang, M. (1998) Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA. Proc. Natl Acad. Sci., 95, 13959-13964. Weiner, B. and Kleckner, N. (1994) Chomosome pairing via multiple interstitial interactions before and during meiosis in yeast. Cell, 77, 977-991. Weiss, B., Davidkova, G. and Zhou, L.-W. (1999) Antisense RNA Gene Therapy for studying and modulating biological processes. Cell. Mol. Life Sci., 55, 334-358. Weiss, B., Davidkova, G., Zhou, L.-W., Zhang, S.-P. and Morabito, M. (1997) Expression of D2 dopamine receptor antisense RNA in brain inhibits D2-mediated behaviours. Neurochem. Int., 31, 571-580. Welch, P., Barber, J. and Wong-Staal, F. (1998) Expression of ribozymes in gene transfer systems to modulate target RNA levels. Curr. Opin. Biotech., 9, 486-496. Wianny, F. and Zernicka-Goetz, M. (2000) Specific interference with gene function by double-stranded RNA in early mouse development. Nat. Cell Biol., 2, 70-75. Wightman, B., Ha, I. and Ruvkun, G. (1993) Posttranscriptional regulation of the heterochonic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell, 75, 855-862. Williams, T. and Fried, M. (1986) A mouse locus at which transcription from both DNA strands produces mRNAs complementary at their 3' ends. Nature, 322, 275-279. 204
Chapter 8
References
Williams, T., Yon, J., Huxley, C. and Fried, M. (1988) The mouse surfeit locus contains a very tight cluster of four "housekeeping" genes that is conserved though evolution. Proc. Natl Acad. Sci., 85, 3527-3530. Willis, T., Jadaayel, D., Coignet, L., Abdul-Rauf, M., Treleaven, J., Catovsky, D. and Dyer, M. (1997) Rapid molecular cloning of rearrangements of the IGHJ locus using longdistance inverse polymerase chain reaction. Blood, 90, 2456-2464. Wormington, W. (1986) Stable repression of ribosomal protein L1 synthesis in Xenopus oocytes by microinjection of antisense RNA. Proc. Natl Acad. Sci., 83, 86398643. Wright, L., Milliken, S., Biggs, J. and Kearney, P. (1998) Ex vivo effects associated with the expression of a bcr-abl-specific ribozyme in a CML cell line. Antisense Nucleic Acid Drug Devel., 8, 15-23. Wu, L., Bayle, J., Elenbaas, B., Pavletich, N. and Levine, A. (1995) Alternatively spliced forms in the carboxy-terminal domain of the p53 protein regulate its ability to promote annealing of complementary single strands of nucleic acids. Mol. Cell. Biol., 15, 497-504. Wutz, A., Smrzka, O., Schweifer, N., Schellander, K., Wagner, E. and Barlow, D. (1997) Imprinted expression of the Igf2r gene depends on an intronic CpG island. Nature, 389, 745-749. Xiao, X., McOwn, T., Li, J., Breese, G., Morrow, A. and Samulski, R. (1997) Adenoassociated virus (AAV) vector antisense gene transfer in vivo decreases GABA(A) alpha 1containing receptors and increases inferior collicular seizure sensitivity. Brain Res., 756, 76-83. Xu, H.-P., Riggs, M., Rodgers, L. and Wigler, M. (1990) A gene from S. pombe with homology to E. coli RNAse III blocks conjugation and sporulation when overexpressed in wild type cells. Nucleic Acids Res., 18, 5304. Yanez, R. and Porter, A. (1998) Therapeutic gene targeting. Gene Ther., 5, 149-159. Yang, F., Demma, M., Warren, V., Dharmawardhane, S. and Condeelis, J. (1990) Identification of an actin-binding protein as elongation factor 1α. Nature, 347, 494-496. Yokoyama, K. and Imamoto, F. (1987) Transcriptional control of the endogenous MYC protooncogene by antisense RNA. Proc. Natl Acad. Sci., 84, 7363-7367. 205
Chapter 8
References
Yoshioka, S., Kato, K., Nakai, K., Okayama, H. and Nojima, H. (1997) Identification of open reading frames in Schizosaccharomyces pombe cDNAs. DNA Res., 31, 363-369. Yu, W., Kim, J. and Ossowski, L. (1997) Reduction in surface urokinase receptor forces malignant cells into a protracted state of dormancy. J. Cell Biol., 137, 767-777. Zamecnik, P. and Stephenson, M. (1978) Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. Proc. Natl Acad. Sci., 75, 280284. Zamore, P., Tuschl, T., Sharp, P. and Bartel, D. (2000) RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell, 101, 25-33. Zaret, K. and Sherman, F. (1982) DNA sequence required for efficient transcription termination in yeast. Cell, 28, 563-573. Zhao, J. and Pick, L. (1993) Generating loss-of-function phenotypes of the fushi tarazu gene with a targeted ribozyme in Drosophila. Nature, 365, 448-451. Zheng, G. and Sinden, R. (1988) Effect of base composition at the center of inverted repeat DNA sequences on cruciform transitions in DNA. J. Biol. Chem., 263, 5356-5361. Zou, L., Mitchell, J. and Stillman, B. (1997) CDC45, a novel yeast gene that functions with the origin recognition complex and Mcm proteins in initiation of DNA replication. Mol. Cell. Biol., 17, 553-563.
206
