Textoris, Hélène Vallin, Alexandre Pachot, Alain Lepape, for the MIP Rea Study ... with an initial denaturation step of 10 min at 95°C, followed by 45 cycles of a.
Association between mRNA expression of CD74 and IL10 and risk of ICU-acquired infections. A multicenter cohort study.
Estelle Peronnet, Fabienne Venet, Delphine Maucort-Boulch, Arnaud Friggeri, Martin Cour, Laurent Argaud, Bernard Allaouchiche, Bernard Floccard, Frédéric Aubrun, Thomas Rimmelé, Fabrice Thiolliere, Vincent Piriou, Julien Bohé, Marie-Angélique Cazalis, Véronique Barbalat, Guillaume Monneret, Stéphane Morisset, Julien Textoris, Hélène Vallin, Alexandre Pachot, Alain Lepape, for the MIP Rea Study Group
Supplementary material
1
Method 1 RNA extraction and RT-qPCR Total RNA was extracted from whole blood using PAXgene TM Blood RNA System Kit (PreAnalytix, Hilden, Germany) following the manufacturer’s guidelines. Before RNA elution, the residual genomic DNA was digested using the Rnase-Free Dnase set (Qiagen, Hilden, Germany). RNA concentration was determined using Quant-iT RNA, BR assay on Qubit (Life Technologies, Chicago, Ilinois, United States). RNA integrity was assessed with the RNA 6000 Nano Kit on a Bioanalyzer (Agilent Technologies, Santa Clara, California, United States). Samples with RNA integrity number ≤6 were excluded due to poor quality RNA. Total RNA was reverse transcribed in complementary DNA (200 ng in a final volume of 20 µL) using SuperScript® VILO™ cDNA Synthesis Kit as recommended by the manufacturer (Life Technologies, Chicago, Illinois, United States). The expression level of CD74 and IL10 was quantified using q-real time polymerase chain reaction (qPCR). qPCR was performed on a LightCycler instrument using the standard Taqman Fast Advanced Master Mix PCR kit (Roche Molecular Biochemicals, Basel, Switzerland), in a final volume of 20 μL containing 0.5 μM of primers and 0.1 μM of probe with an initial denaturation step of 10 min at 95°C, followed by 45 cycles of a touchdown PCR protocol (10 sec at 95°C, 29 sec annealing at 68-58°C, and 1 sec extension at 72°C). The Second Derivative Maximum Method was used with the LightCycler software (Release 1.5.0 SP4) to automatically determine the crossing point for individual samples. Standard curves were generated by using five replicates of cDNA standards and were used to perform efficiency corrected quantification. Gene expression normalization was performed based on the combination of two selected reference genes: PPIB (peptidylprolyl isomerase B) and GLYR1 (glyoxylate reductase 1 homolog (Arabidopsis)). CD74 mRNA expression levels were expressed as Calibrated Normalized Relative Quantity (CNRQ) [1]. For IL10, due to the absence of expression in the calibrator sample (pool of mRNA from healthy volunteers), results were expressed as Normalized Relative Quantity (NRQ).
2
Supplementary Table 1 PCR designs characteristics Gene symbol
CD74
IL10
PPIB
GLYR1
Primers and probe sequences
Forward Reverse Probe Forward Reverse Probe Forward Reverse Probe
Forward Reverse Probe
TTATCTCCAACAATGAGCAACT ACAGGAAGTAGGCGGTGGT CCAGCGAGGAGCAGAGTCAC AGAACCAAGACCCAGACATC CATTCTTCACCTGCTCCAC TCTTCCCTGTGAAAACAAGAGC GGAGATGGCACAGGAGGAAAGA GGGAGCCGTTGGTGTCTTTG GGTGAGCATGGCCAACGCAGG
CCTCAATCAGGGACAGTTGG GATGGTTGACCGCATCACC GAAATACATTCAGAAGGATCTCC
Targeted exons 1 2 2 3 4 4 3 4 4
16 17 17
Targeted transcripts
Product length (pb)
Efficiency
LOQ* (copies/µL)
NM_001025158, NM_001025159, NM_004355
147
1.91
18
NM_000572
138
1.92
17
NM_000942
124
1.94
3
NM_032569, XM_005255637, XM_005255638, XM_011522716, XM_005255640, XM_005255639, XM_011522717
146
1.97
2
* Limit of quantification
3
Supplementary Fig. 1 Patient flow chart. Number of analyzed samples for day 3 and/or day 6 after admission correspond to high quality RNA samples collected in patients still in ICU without any ICU-acquired infection (IAI) at the indicated time point. Highlighted boxes correspond to the event of interest: IAI and the two competing risks (discharge alive without IAI and death without IAI)
4
Supplementary Table 2 Patient characteristics, outcomes and invasive devices exposure according to ICUacquired infection status Total (n=725)
IAI (n=137)
No IAI (n=588)
450 (62) 65 [54-76] 56 [42-69] 9 [6-12] 14 [8-15] 2 [0-3]
91 (66) 64 [52-73] 58 [48-71] 10 [7-12] 11 [6-15] 1 [0-3]
359 (61) 65 [54-77] 55 [42-69] 9 [6-12] 14 [8-15] 2 [0-3]
0 1 ≥2
217 (30) 141 (19) 367 (51)
46 (33) 27 (20) 64 (47)
171 (29) 114 (19) 303 (51)
Heart failure Chronic pulmonary disease Renal disease Leukaemia Lymphoma
114 (16) 158 (22) 73 (10) 10 (1.4) 13 (1.9)
20 (15) 31 (23) 9 (7) 1 (1) 3 (2)
94 (16) 127 (22) 524 (89) 9 (1.5) 10 (1.7)
Non fatal Ultimately fatal Rapidly fatal
90 (65.7) 40 (29.2) 7 (5.1)
90 (66) 40 (29) 7 (5)
335 (57) 188 (32) 65 (11)
Medical Elective surgery Emergency surgery
502 (69) 32 (4.4) 191 (26.4) 67 (9.2) 29 [22-41] 467 (64)
95 (69) 11 (8) 31 (23) 27 (20) 29 [20-38] 96 (70)
407 (69) 21 (3.6) 160 (27) 40 (6.8) 29 [22-41] 371 (63)
303 (42) 379 (52) 20 (2.8) 23 (3.2)
48 (35) 80 (58) 7 (5) 2 (2)
255 (43) 299 (51) 13 (2.2) 21 (3.6)
Infection at admission, n (%) Septic shock, n (%) Site of primary infection, n (%)
506 (70) 255 (50)
81 (59) 40 (49)
425 (72) 215 (51)
Respiratory Abdominal Others Type of acquisition of the primary infection, n (%) Community Hospital acquired Type of detection, n (%) Clinical+imaging Clinical+surgery Microbiology Suspected
260 (52) 113 (22) 133 (26)
55 (67.9) 8 (9.9) 18 (22.2)
205 (48) 105 (25) 115 (27)
323 (64) 183 (36)
52 (65) 29 (35)
271 (46) 154 (26)
124 (24.5) 23 (4.5) 339 (67.0) 20 (4.0)
15 (18.5) 2 (2.5) 62 (76.5) 2 (2.5)
109 (19) 21 (3.6) 277 (47) 18 (3.1)
Adequacy of antimicrobial treatment, n (%)
487 (96)
78 (96)
409 (96)
1.000
Plurimicrobial infection (n=339), n (%)
251 (74)
54 (87)
197 (71)
0.015
632 (87) 553 (76) 523 (72) 2 [1-4] 19 (2.6) 215 (30) 225 (31) 30 (4.1)
131 (96) 98 (72) 119 (87) 4 [2-8] 7 (5.1) 48 (36) 44 (32) 13 (9.5)
501 (85) 455 (77) 404 (69) 2 [1-3] 12 (2.0) 167 (28) 181 (31) 17 (2.9)
0.002 0.181
