lized ATP columns, had no detectable ATPase activity, and were unable to function in vitro as molecular chaperones. Additionally, the inability to bind ATP was ...
Plant Physiol. (1 996) 11O : 41 9-424
ATPase Activity and Molecular Chaperone Function of the ~tress70Proteins' Jan A. Miernyk* and C. Thomas Hayman2 Phytoproducts Research Unit, United States Department of Agriculture, Agricultural Research Service, National Center for Agricultural Utilization Research, 181 5 North University Street, Peoria, lllinois 61 604
ing and hydrolysis (Wild et al., 1992).In contrast, however, remova1 of amino acids 120 to 428 from human Stress70c, nearly one-half of the protein including the proposed ATPbinding site, does not reduce the leve1 of protection of cultured mammalian cells from heat shock (Li et al., 1992). This result clearly requires that, at least in this instance, neither ATP binding nor hydrolysis be necessary for surviva1 of heat shock. Furthermore, there has been a suggestion that ATP-induced dissociation of the target proteinStress70 complex requires K t binding, not ATP hydrolysis (Palleros et al., 1993). Models of chaperone function have been presented that accommodate each school of thought (Hubbard and Sander, 1991). Although the three-dimensional structures of plant Stress70c proteins have not yet been solved, there is a high degree of primary sequence homology with mammalian and microbial Stress70c proteins (Gupta and Golding, 1993). Based on prior results with DnaK (Cegielska and Georgopoulos, 1989), it was proposed that the sequence A,,,EAxLGxTxxNAVVTV makes u p at least part of the ATP-binding site of tomato (Lycopersicon esculentum) Stress7Oc (Lin et al., 1991). Homologous sequences are present in other plant Stress70 proteins (Fontes et al., 1991). Using recombinant DNA methods, we have deleted the proposed ATP-binding sites of maize (Zea mays) Stress70er and tomato Stress70c, expressed the mutant proteins in E. coli, and then evaluated their ability to bind ATP and function as molecular chaperones in vitro.
The codons for the amino acid residues making up the proposed ATP-binding sites of the maize (Zea mays L.) endoplasmic reticulum and tomato (Lycopersicon esculentum) cytoplasmic Stress70 proteins were deleted from their respective cDNAs. The deletions had little effect on the predicted secondary structure characteristics of the encoded proteins. Both wild-type and mutant proteins were expressed in Escherichia coli and purified to electrophoretic homogeneity. The mutant recombinant proteins did not bind to immobilized ATP columns, had no detectable ATPase activity, and were unable to function in vitro as molecular chaperones. Additionally, the inability to bind ATP was associated with changes in the oligomerization state of the Stress70 proteins.
One important class of molecular chaperone proteins is the 70-kD family of heat-shock or stress-related proteins (Craig et al., 1994). The structure of the Stress70 proteins can be divided into three regions: a C-terminal peptide recognition and binding domain, a short linker sequence, and an N-terminal ATPase domain (McKay, 1993; Wang et al., 1993). A stable 44-kD N-terminal ATPase can be prepared from native Stress7O by partial proteolysis (Chappell et al., 1987). The 44-kD fragment has been crystallized and a low resolution three-dimensional structure solved (Flaherty et al., 1990). The roles of ATP binding and hydrolysis in chaperone function remain somewhat controversial, and despite the advances in understanding the structure of the Stress70 proteins, the ATP-binding site has not yet been fully defined (McKay, 1993). It has even been suggested that there could be more than one ATP-binding site per Stress70 protomer (Schmid and Rothman, 1985). Based on the results from many studies using "nonhydrolyzable" ATP analogs, it has been concluded that the release of target proteins from Stress70 requires ATP hydrolysis (Rothman, 1989). Additionally, there is a correlation between partial loss of function of the Escherichia coli DnaK protein, the bacterial Stress70 homolog, and mutations altering amino acid residues implicated in ATP bind-
MATERIALS A N D METHODS
Reagents AI1 buffers were from Research Organics, Inc. (Cleveland, OH). The purified Escherichia coli stress proteins DnaK, DnaJ, and GrpE were from Epicentre Technologies (Madison, WI). DNA-modifying enzymes were from New England BioLabs (Beverly, MA) and were used according to the manufacturer's recommendations. Malachite green carbinol base was from Aldrich. Unless otherwise indicated, other reagents were from Sigma and were of the highest purity available.
Supported in part by U.S. Department of Agriculture Competitive Research Grants Office National Research Initiative Program grant No. 92-37304-7896. Present address: Laboratory of Cell Biology, Winter Research, Sinai Samaritan Medica1 Center, 836 North 12th St., Milwaukee, WI 53233. * Corresponding author; e-mail miernykj8ncaurl.ncaur.gov; fax 1-309 - 681- 6686.
Abbreviations: ds, double stranded; MBP, maltose-binding protein, product of the mnlE gene; Stress70, any member of the M, 70,000 family of stress-related proteins; Stress70c, cytoplasmic Stress70; Stress70er, ER-resident Stress70. 41 9
420
Miernyk and Hayman
Nucleic Acids
The plasmid pLeHsc70-2 consists of a 2.1-kb cDNA encoding tomato (Lycopersicon esculentum) Stress70c cloned into the EcoRI site of pUC19 (Lin et al., 1991). The plasmid p9/25PCR1 consists of a 2.4-kb cDNA encoding maize (Zea mays) pre-Stress70er cloned into the HindIII site of pBluescript KS/+ (Fontes et al., 1991). The E. coli vector pMAL-c2 for expression of heterologous proteins as chimera with the MBP is from New England BioLabs. Oligonucleotides were prepared with an Applied Biosystems model 381A synthesizer, using the phosphoramidite trityl-off method. The oligonucleotides were purified by ethanol precipitation before use.
Plant Physiol. Vol. 1 1 O, 1996
BamHI-HindIII fragment including a11 but six codons of the complete coding region was removed from p9/ 25PCR1 and inserted into pMAL-c2. This plasmid was designated pJAM159. To bring the MBP and Stress70er into frame and to position the factor Xa cleavage site immediately upstream from the mature Stress70er-coding region, pJAM159 was digested with SacI and AccI. The SacI-AccI fragment was replaced with synthetic dsDNA, which had SacI and AccI cohesive termini. This fragment consisted of two annealed oligonucleotides: an 85-mer, 5’-CGATCGAGGGAAGGAAAGAGGAGACCAAGAACCTCGGGACCGTGATCGGTATCGATCTTGGTACCACCTACTCCTGTGTCGGTGT-3’; and a 91-mer, 5’-AGACACCGACACAGGAGTAGGTGGTACCAAGA-
TCGATACCGATCACGGTCCCGAGCTTCTTGGTCTCPlasmid Construction
The coding region for tomato Stress70c was removed from pLeHsc70-2 by digestion with NaeI and EcoRI. The resulting 2023-bp fragment was directionally cloned into XmnI X EcoRI-digested pMal-c2. This plasmid was designated pJAM103 and drives bacterial expression of the chimeric MBP-Stress70c protein. Then, pJAM103 was digested with SacI, and the resulting fragment was inserted into the unique SacI site of pUC19. To delete the region of the DNA sequence encoding the proposed ATP-binding site of the Stress70c protein, the pUC19 construct was digested with BglII and BsmI. The oligonucleotides 5‘-GATCTCATCTATGGTGCTCGCT-3’ and 5’-AGTAGATACCACGAGC-3‘ were annealed, the dsDNA was mixed with BglII X BsmI-digested plasmid, and the mixture was ligated together. Finally, the modified SacI fragment was removed from the pUC19 intermediate construct and re-inserted into pJAMlO3. The amino acid sequence K,,,MKEIAEAFLGTIVKNA (numbered from the N terminus; the part of the proposed ATP-binding site removed is underlined) was deleted from the polypeptide-reading frame. This plasmid was designated pJAM105 and encodes a chimeric protein consisting of the MBP, a factor Xa cleavage site, and the Stress70c-coding region minus the proposed ATP-binding site (Stress70cAATP). To delete the sequence encoding the proposed ATPbinding site of Stress70er, p9/25PCR1 (Fontes et al., 1991) was first digested with SauI and MstI. This resulted in remova1 of a 111-bp fragment. The SauI-MstI fragment was replaced with synthetic dsDNA, which had a SauI cohesive end and an MstI blunt end. This fragment consisted of two annealed oligonucleotides: a 30-mer, 5‘TGAGGAGATCAGTGCCATGATTCTTGGCGC-3’; and a 27-mer, 5’-GCGCCAAGAATCATGGCACTGATCTCC3’. The final construction had 84 bp deleted from the Stress70er-coding region. Thus, the amino acid sequence K,,,DTAEAYLGkKI%DAVVTVPAYFNDA (numbered from M, of the signal sequence; the proposed ATPbinding site is underlined) was deleted from the polypeptide-reading frame. This plasmid was designated pJAM106. A plasmid was constructed for bacterial expression of mature maize Stress70er fused to the MBP. A 2.2-kb
CTCTTTCCTTCCCTCGATCGAGCT-3‘, that abutted the first codon (Val) of processed Stress7Oer to the resected 3’ end of malE and restored the factor Xa cleavage site immediately upstream of this codon. This plasmid was designated pJAM161. pJAM161 was digested with SauI and HindIII, which resulted in remova1 of a fragment of approximately 1.7 kb. Similarly, pJAMlO6 was digested with SauI and HindIII. The SauI-HindIII fragment from pJAM106, which has the proposed ATP-binding site deletion, replaced the corresponding fragment from pJAM161. This plasmid was designated pJAM163. The final construction encodes a chimeric protein consisting of the MBP, a factor >;a cleavage site, and the mature Stress70er-coding region minus the proposed ATP-binding site (Stress70erAATP). Protein Purification
Both wild-type and mutant recombinant proteins were purified to electrophoretic homogeneity by a combination of affinity and anion-exchange chromatography. The recombinant Stress70 proteins were synthesized in E. coli as chimera with the MBP. Overnight cultures of transformed SG1611 cells were diluted into fresh Luria Bertani medium, containing 200 pg mL-’ ampicillin, to an A,,, of 0.05. Flasks were then incubated at 37°C with vigorous shaking until the A,,, was approximately 0.5. At this stage, isopropylthio-P-galactoside was added to a final concentration of 0.3 miv to induce synthesis of the fusion proteins. Cells were grown for an additional 3 h after induction, then harvested by centrifugation, and frozen at -20°C. Frozen cell pellets were thawed by suspension in amylose column buffer (10 mM Tris-HC1, pH 7.4, containing 200 mM NaCl and 1 mM EDTA). The cells were disintegrated by sonication, and the sonicates were clarified by centrifugation and then applied to 10-mL amylose columns (New England BioLabs). After the bound proteins were washed with column buffer, they were eluted with column buffer containing 10 mM maltose. Eluates were concentrated to approximately 1 mg protein mL-’ using Amicon microconcentrators and then treated with the factor Xa protease for 12 h at room temperature. After digestion the proteins were subjected to a second round of amylose column chromatography. The Stress70 proteins, which were present in the flow-through volume of the second passage, were concen-
Molecular Chaperone Activity trated and then dialyzed overnight against 400 volumes of Fast Protein Liquid Chromatography column buffer (20 mM Tes-NaOH, pH 7.0, containing 0.1 mM EDTA). Clarified dialysates were loaded onto 1-mL Pharmacia Mono Q anion-exchange columns that were washed with column buffer and then eluted at 0.5 mL min-' with a linear gradient of O to 0.5 M KCl in equilibration buffer. The Stress70-containing fractions were concentrated to a volume of less than 2 mL by ultrafiltration and then stored at -80°C until used. Immobilized ATP columns (Welch and Feramisco, 1985; Miernyk et al., 1992a) were equilibrated with 20 mM TesNaOH, pH 7.5, containing 20 miv KCI and 3 mM MgCI,. After the samples were loaded, the columns were washed with equilibration buffer and then successively eluted with equilibration buffer containing 0.5 M KC1, 1 mM GTP, and 3 mM ATP. Samples of each fraction were taken for SDSPAGE, western blotting, and quantitation by laser densitometry (Miernyk et al., 1992a).
Other Methods ATPase activity was measured using the malachite green procedure (Baykow et al., 1988; Geladopoulos et al., 1991). Sedimentation analyses and measurements of molecular chaperone activity were conducted exactly as previously described (Miernyk et al., 1992b).Protein levels were quantitated by the method of Bradford (1976), using fraction V BSA as the standard. Protein secondary structure predictions were analyzed according to the method of Garnier et al. (1978), using the PC/GENE software from IntelliGenetics, Inc. (Mountain View, CA).
RESULTS A N D DlSCUSSlON The method described for purification of recombinant Stress7O resulted in yields of approximately 250 pg of electrophoretically homogeneous protein per 100 mL of bacterial culture. Although substantially more fusion protein was synthesized in the cultures, most of the material in a typical preparation was refractory to factor Xa digestion. Changing digestion time, temperature, or physical conditions (pH, ions, etc.) resulted in little improvement. The experiments described herein were originally undertaken in response to a report that deletion of a large interna1 fragment from mammalian Stress70c apparently did not interfere with the ability of the protein to protect cells from what would normally be a lethal heat shock (Li et al., 1992). This deletion included a11 of the proposed ATPbinding site of this protein. Removal of this much of the protein-coding sequence results in a major alteration in the predicted 2" structure. Despite the magnitude of structural disruption, some molecular chaperone functions for the resulting protein might still be possible (Hubbard and Sander, 1991). We wished to directly test the involvement of ATP binding and hydrolysis in chaperone activity using a protein with relatively minor changes in 2" structure. A predicted 2" structure comparison of the wild-type and ATP-binding site mutant proteins used in these studies revealed no significant differences (Table I).
42 1
Table 1. Secondary structure predictions for wild-type and mutant Stress70 proteins Values are the percentages of the protein in the indicated conformation. Structural calculations were made according to the method of Garnier et al. (1978), using the PC/CENE software (IntelliGenetics, Inc.). Structural Features Chaperone Protein
Tomato Stress70c Tomato Stress70c AATP Maize Stress70er Maize Stress70erAATP
Helical
Extended
Turn
Coil
45.1 45.3
35.8
35.7
7.4 7.5
11.4 11.4
51.3 51.1
35.2 35.3
5.8 5.8
7.5 7.5
Characteristic of the Stress7O molecular chaperone proteins is a low-leve1 basal ATPase activity (Hendrick and Hartl, 1993; Craig et al., 1994; Georgopoulos and Welch, 1994; Szabo et al., 1994). Both the basal catalytic activity of recombinant Stress7Oc and the extent of stimulation by the E. coli DnaJ and GrpE co-chaperone proteins (Fig. 1)were comparable to previous observations with the native proteins (Zhou and Miernyk, 1996).The Stress70AATP protein had virtually zero basal ATPase activity, and there was no detectable stimulation by the co-chaperone proteins (Fig. 1). Essentially identical results were observed with comparisons of Stress70er and Stress70erAATP (data not presented). ATPase activity can be separated into three major component reactions: substrate binding, catalysis, and product release. The ability of Stress70 proteins to bind specifically to immobilized ATP was recognized early in their study, and this property is routinely exploited during protein purification (Welch and Feramisco, 1985). Recombinant wild-type Stress70er bound quantitatively to an immobilized ATP column and could be eluted specifically with 3 mM ATP (Fig. 2). In contrast, Stress70erAATP failed to bind to the immobilized ATP column (Fig. 2). A variety of changes in pH, ionic strength, and cation concentrations had no effect on the inability of Stress70erAATP to bind to the ATP column. Results essentially identical with those obtained with Stress70er and Stress70erAATP were seen with Stress70c and Stress70cAATP (data not presented). Based on deduced amino acid sequence analyses (Gaut and Hendershot, 1993; Wilbanks et al., 1994; Hendershot et al., 1995) and crystallographic studies (Flaherty et al., 1990), a structural model of the ATP-binding site of Stress70 has been proposed (McKay, 1993). This model invokes complex multiple interactions between amino acid side chains and various portions of the ATP molecule but is amenable to testing both in vivo (Hendershot et al., 1995) and in vitro (Gaut and Hendershot, 1993; Wilbanks et al., 1994).In particular, the hydrolytic attack of the phosphodiester bonds has been analyzed (McKay, 1993).A number of mutant proteins have been prepared; however, most have dealt with effects on catalysis rather than on nucleotide binding. The prediction of residues involved in ATP binding was based on in vivo analysis of E. coli partia1 loss of function mutants (Cegielska and Georgopoulos, 1989; Wild et al., 1992). Mutant proteins such as w e have prepared for
Miernyk and Hayman
422
St res s7O cAAT P
Stress70c
1 1
2
1
2
3
Figure 1. Comparison of the ATPase activities of recombinant wildtype tomato Stress70c and Stress70cAATP. Lanes 1, Stress70; lanes 2, Stress70 plus E. coli DnaJ; lanes 3, Stress.70 plus Dnaj plus GrpE.
tomato Stress70c and maize Stress7Oer have not previously been characterized. It has been suggested that Stress70 might have two ATPbinding sites (Schmid and Rothman, 1985; McKay, 1993). Our results with the mutant Stress70 proteins support the prediction of residues involved in ATP binding (Cegielska and Georgopoulos, 1989; Lin et al., 1991; Wild et al., 1992). They do not provide any support for the proposal of more than one class of nucleotide-binding site. In our in vitro analysis system, the mutant proteins failed completely to bind to an ATP column (Fig. 2). It remains conceivable, however, that a putative second class of ATP-binding site would require prior occupation of the other site. It is clear that the Stress70 proteins can exist in a variety of oligomeric structures in vivo (Hendrick and Hartl, 1993; Craig et al., 1994; Georgopoulos and Welch, 1994; Szabo et al., 1994). It has been proposed that the active form of Stress70 is the monomer (McKay, 1993), but this remains a point of controversy. Guy and associates have studied the oligomeric structure of spinach Stress70c (Anderson et al., 1994). They observed three different forms of the chaper-
Plant Physiol. Vol. 110, 1996
one protein: monomers, dimers, and a high-molecularweight oligomeric fraction. Addition of ATP converted a portion of the high-molecular-weight fraction to monomers and dimers and separately converted the dimer fraction to monomers and oligomers (Anderson et al., 1994). Thus, ATP binding has the potential to control biological activity. We also observed that maize Stress70er (Fig. 3A) and tomato Stress70c (data not presented) can exisi as monomers, dimers, and oligomers. It is interesting that, when the Stress70AATP proteins were analyzed by sedimentation, none of the dimer form was observed (Fig. 3E). Furthermore, there was an increase in the relative amount of oligomers and possibly an increase in the size of some components of the oligomer fraction. These results suggest that ATP binding or a structural change resulting from ATP binding is essential for Stress70 dimer formation. At this time, the possibility that the deletions somehow subtly change global protein structure such that oligomerization is promoted cannot be ruled out The in vitro molecular chaperone system used in these studies measures the membrane translocation and cotranslational modification of a model secretory precursor (Miernyk et al., 1992b). We previously established that Stress70c is essential for this membrane translocation. The relative chaperone activities of native maize Stress70c and the E. coli DnaK protein are similar to those we previously ADH V
BSA V
B
1.0
.
0.8
-
0.6
.
0.4
-
0.2
- A A
AFT TGB
v
v
A A -
O A
30 25 20
. 10 1
0.01 O e O 0 03
\
O
6
9
12
' 15
5
Fraction Number (30 drop) O
3
6
9
12
15
18
Fraction Number (2 ml) Figure 2. lmmobilized ATP affinity chromatography of wild-type maize Stress70er (O) and Stress70erAATP (A).Fractions were analyzed by SDS-PACE, western blotting, and laser densitometry (Miernyk et al., 1992a).
Figure 3. Sedimentation analyses of the maize Stress70er proteins. A, Wild-type Stress70er; B, Stress70erAATP. Fractions were analyzed by SDS-PACE, western blotting, and laser densitometry. Suc concentrations were determined by refractrometry. The positions of standard proteins are indicated by carats (A). BSA, 68 kD; alcohol dehydrogenase (ADH), 150 kD; apoferritin (AFT), 443 kD; thyroglobulin (TGB), 669 kD.
423
Molecular Chaperone Activity observed (Fig. 4; Miernyk et al., 1992b). Molecular chaperone activity of the recombinant tomato Stress70c is indistinguishable from that of the native maize protein. In the present experiments we observed that the mutant Stress70cAATP protein, which has no detectable ATPase activity, failed to promote membrane translocation of the precursor protein (Fig. 4). This result corroborates our earlier observations that reducing or eliminating ATPase activity through the use of slowly hydrolyzable ATP analogs or by autophosphorylation of the chaperone proteins causes a parallel reduction in chaperone activity. Our results are in general agreement with most results reported by others both in vitro (Rothman, 1989; Gaut and Hendershot, 1993; Szabo et al., 1994) and in vivo (Cegielska and Georgopoulos, 1989; Wild et al., 1992; Hendershot et al., 1995). However, they do not agree with the results of Li et al. (1992) or the proposal by Palleros et al. (1993). One possible explanation for this is that different degrees of chaperone activity are necessary for different target proteins. In some instances simply binding the chaperone to the target might provide all of the necessary molecular assistance. This would be analogous to the "plucking" model described by Hubbard and Sander (1991). In others, the relatively small conformational changes brought about by K' binding might be adequate for chaperone function. Finally, in instances in which the need for chaperone assistance is greater, nucleotide binding and hydrolysis, perhaps mediated by co-chaperone proteins (Liberek et al., 1991; Szabo et al., 1994; Zhou et al., 1995), might be required. Since a relatively small number of molecular chaperone types must deal with an enormous number of different target proteins (Hendrick and Hartl, 1993; Craig et al., 1994; Georgopoulos and Welch, 1994), it would not be surprising if the chaperones have evolved to use more than one mode of action. x e >
.-
4
o
Q
I
I
.-a>, U
"e,
o
5
10
15
20
25
[Stress-/O] p g Figure 4. Comparison of the in vitro molecular chaperone activities of native maize Stress70c (O), recombinant wild-type tomato Stress70c (A), E. coli DnaK ( O ) , and tomato Stress70cAATP (V). Relative molecular chaperone activity is the amount of processed, core-glycosylated, protease-resistant protein divided by the amount of precursor protein in control assays lacking maize microsomes (Miernyk et al., 199213).
CONCLUSIONS
Deletion of the proposed ATP-binding sites resulted in Stress70 proteins having little predicted secondary structure disruption but that were unable to bind to immobilized ATP and had no detectable ATPase activity. The mutant Stress70c protein with no ATPase activity also had no molecular chaperone activity in vitro. These results support the proposal that, at least in the instance of membrane translocation of a secretory precursor, ATPase activity is essential for Stress70 chaperone function. ACKNOWLEDCMENTS
B.M. Manarelli provided technical assistance during the early stages of the research. R.S. Boston generously provided the plasmid p9/25PCR1. Received June 30, 1995; accepted October 30, 1995. Copyright Clearance Center: 0032-0889/96/ 110/0419/06. LITERATURE ClTED
Anderson JV, Haskell DW, Guy CL (1994) Differential influence of ATP on native spinach 70-kilodalton heat-shock cognates. Plant Physiol 104: 1371-1380 Baykow AA, Evtushenko OA, Avaeva SM (1988) A malachite green procedure for orthophosphate determination and its use in alkaline phosphatase-based enzyme immunoassay. Anal Biochem 171: 266-270 Bradford MM (1976) A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254 Cegielska A, Georgopoulos C (1989) Functional domains of the Escherichia coli dnaK heat shock protein as revealed by mutational analysis. J Biol Chem 264: 21122-21130 Chappell TG, Konforti BB, Schmid SL, Rothman JE (1987) The ATPase core of a clathrin uncoating protein. J Biol Chem 262: 746-751 Craig EA, Weissman JS, Honvich AL (1994) Heat shock proteins and molecular chaperones: mediators of protein conformation and turnover in the cell. Cell 78: 365-372 Flaherty KM, DeLuca-Flaherty C, McKay DB (1990)Three-dimensional structure of the ATPase fragment of a 70K heat-shock cognate, protein. Nature 346: 623-628 Fontes EBP, Shank BB, Wrobel RL, Moose SP, Obrian GR, Wurtzel ET, Boston RS (1991) Characteristics of an immunoglobulin binding protein homolog in the maize Joury-2 endosperm mutant. Plant Cell 3: 483496 Garnier J, Osguthorpe DJ, Robson B (1978) Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins. J Mo1 Biol 1 2 0 97-120 Gaut JR, Hendershot LM (1993) Mutations within the nucleotide binding site of immunoglobulin binding protein inhibit ATPase activity and interfere with release of immunoglobulin heavy chain. J Biol Chem 268: 7248-7256 Geladopoulos TP, Sotiroudis TG, Evangelopoulos AE (1991) A malachite green colorimetric assay for protein phosphatase activity. Anal Biochem 192: 112-116 Georgopoulos C, Welch WJ (1994) Role of the major heat shock proteins as molecular chaperones. Annu Rev Cell Biol9: 601-634 Gupta RS, Golding GB (1993) Evolution of HSP70 genes and its implications regarding relationships between archaebacteria, eubacteria, and eukaryotes. J Mo1 Evol 3 7 573-582 Hendershot LM, Wei J-y, Gaut JR, Lawson B, Freiden PJ, Murti KG (1995)In vivo expression of mammalian BiP ATPase mutants causes disruption of the endoplasmic reticulum. Molec Biol Cell 6: 283-296 Hendrick JP, Hartl F-U (1993) Molecular chaperone functions of heat-shock proteins. Annu Rev Biochem 62: 349-384
424
Miernyk and Hayman
Hubbard TJP, Sander C (1991) The role of heat-shock and chaperone proteins in protein folding: Possible molecular mechanisms. Protein Eng 4: 711-717 Li GC, Li L, Liu RY, Tehman M, Lee WMF (1992) Heat shock protein hsp70 protects cells from thermal stress even after deletion of its ATP-binding domain. Proc Natl Acad Sci USA 89: 2036-2040 Liberek K, Marszalek J, Ang D, Georgopoulos C, Zylicz M (1991) Eschevichia coli DnaJ and GrpE heat shock proteins jointly stimulate ATPase activity of DnaK. Proc Natl Acad Sci USA 88: 2874-2878 Lin T-Y, Duck, NB, Winter J, Folk WR (1991) Sequences of two hsc70 cDNAs from Lycopevsicon esculentum. Plant Mo1 Biol 16: 475-478 McKay DB (1993) Structure and mechanism of 70-kDa heat-shockrelated proteins. Adv Protein Chem 44: 67-98 Miernyk JA, Duck NB, David NR, Randall D D (1992a)Autophosphorvlation of the pea mitochondrial heat-shock protein homolog. Plant Physiol 100: 965-969 Miernyk JA, Duck NB, Shatters RG Jr, Folk WR (1992b) Hsc70 can act as a molecular chaperone during the membrane translocation of a plant secretory protein precursor. Plant Cell 4: 821-829 Palleros DR, Reid KL, Shi L, Welch WJ, Fink AL (1993) ATPinduced protein-Hsp70 complex dissociation requires Kf but not ATP hydrolysis. Nature 365: 664-666 Rothman JE (1989) Polypeptide chain binding proteins: catalysts of protein folding and related processes in cells. Cell59: 591-601
Plant Physiol. Vol. 11O, 1996
Schmid L, Rothman JE (1985) Enzymatic dissociation of clathrin cages in a two-stage process. J Biol Chem 260: 10044-10049 Szabo A, Langer T, Schroder H, Flanagan J, Bukau E, Hartl F-U (1994)The ATP hydrolysis-dependent reaction cycle of the Eschevichia coli Hsp70 system-DnaK, DnaJ, and GrpE. Proc Natl Acad Sci USA 91: 10345-10349 Wang TF, Chang J-h, Wang C (1993) Identification oí the peptide binding domain of hsc70. 18-kilodalton fragment located immediately after ATPase domain is sufficient for high affinity binding. J Biol Chem 268: 26049-26051 Welch W, Feramisco JR (1985) Rapid purification of mammalian 70,000-dalton stress proteins: affinity of the proteins for nucleotides. Mo1 Cell Biol 5: 1229-1237 Wilbanks SM, DeLuca-Flaherty C, McKay DB (1994) Structural basis of the 70-kilodalton heat shock cognate protein ATP hydrolytic activity. I. Kinetic analysis of active site mutants. J Biol Chem 269: 12893-12898 Wild J, Kamath-Loeb A, Ziegelhoffer E, Lonetto M, Kawasaki Y, Gross CA (1992) Partia1 loss of function mutations in DnaK, the Eschevichia coli homolog of the 70-kDa heat shock proteins, affect highly conserved amino acids irnplicated in ATP binding and hydrolysis. Proc Natl Acad Sci USA 89: 7139-7143 Zhou R, Kroczynska B, Hayman GT, Miernyk JA (1995) AtJ2, an Arabidopsis homolog of Escherichia coli dnaJ. Plant Physiol 108: 821-822 Zhou R, Miernyk JA (1996)ATPase activities of the maize Stress70 molecular chaperone proteins. J Biol Chem (in press)
