Clin Exp Metastasis (2014) 31:585–593 DOI 10.1007/s10585-014-9652-7
RESEARCH PAPER
Augmented expression of urokinase plasminogen activator and extracellular matrix proteins associates with multiple myeloma progression Rehan Khan • Nidhi Gupta • Raman Kumar • Manoj Sharma • Lalit Kumar • Alpana Sharma
Received: 6 November 2013 / Accepted: 26 March 2014 / Published online: 8 May 2014 Ó Springer Science+Business Media Dordrecht 2014
Abstract Multiple myeloma (MM) represents a B cell malignancy, characterized by a monoclonal proliferation of malignant plasma cells. Interactions between tumor cells and extracellular matrix (ECM) are of importance for tumor invasion and metastasis. Protein levels of urokinase plasminogen activator (uPA) and fibulin 1, nidogen and laminin in plasma and serum respectively and mRNA levels of these molecules in peripheral blood mononuclear cells were determined in 80 subjects by using ELISA and quantitative PCR and data was analyzed with severity of disease. Pearson correlation was determined to observe interrelationship between different molecules. A statistical significant increase for ECM proteins (laminin, nidogen and fibulin 1) and uPA at circulatory level as well as at mRNA level was observed compared to healthy controls. The levels of these molecules in serum might be utilized as a marker of active disease. Significant positive correlation of all ECM proteins with uPA was found and data also correlates with severity of disease. Strong association found between ECM proteins and uPA in this study supports that there might be interplay between these molecules which can be targeted. This study on these molecules may
R. Khan N. Gupta R. Kumar A. Sharma (&) Department of Biochemistry, All India Institute of Medical Sciences (AIIMS), New Delhi 110029, India e-mail:
[email protected] M. Sharma Department of Radiation Oncology, Maulana Azad Medical College, New Delhi, India L. Kumar Department of Medical Oncology, All India Institute of Medical Sciences (AIIMS), New Delhi, India
help to gain insight into processes of growth, spread, and clinical behavior of MM. Keywords Multiple Myeloma ECM proteins uPA Nidogen Basement membrane
Introduction Multiple myeloma (MM) represents a B cell malignancy, characterized by a monoclonal proliferation of malignant plasma cells [1]. The malignant cells within the bone marrow (BM) have extensive interaction with the structural components of their microenvironment which is believed to play an important role in homing, proliferation and terminal differentiation of myeloma cells. Interactions between tumor cells and the extracellular matrix (ECM) are of importance for tumor invasion and metastasis. It has been previously shown that the interactions between MM cells and the BM ECM proteins contribute to drug resistance [2]. During tumour cell invasion, cells attach to and degrade components of the ECM [3]. Previous studies already revealed the importance of interactions of malignant cells with the basement membrane (specialised form of ECM) during invasion. Basement membrane controls a large number of cellular processes including adhesion, migration, differentiation, gene expression and apoptosis [4]. The major components of the basement membrane include collagen IV, laminins, heparan sulfate proteoglycan (perlecan) and nidogens and it is these proteins that allow for cell adhesion and the formation of networks to confer the mechanical stability of the basement membrane [5]. Components of the ECM as well as their proteolytic digestion products have been shown to stimulate the in vitro migration of a variety of normal and malignant cell
123
586
types [6]. The ECM composition of the BM is crucial for normal tissue homeostasis, because the chemical treatment or irradiation of the stroma has been shown to lead to tumor formation in otherwise non-malignant epithelium [7]. Laminin-1, a well characterised cell adhesion protein, represents the major non-collagenous glycoprotein of the basement membrane, involved in multiple important biological activities such as cell adhesion, migration, spreading, proliferation, growth and differentiation [8]. Spessotto et al. [9] have demonstrated that different laminin isoforms may evoke diverse cellular responses in different neoplastic lymphocytes. Invasion of the subendothelial basement membrane is mediated in part by interactions of tumour cells with laminin via specific cell surface receptors [10]. The nidogens bind and form a ternary complex with laminin-1 and collagen type IV, connecting the two networks and stabilizing and maintaining the structure of the basement membrane [11]. Physiologically, nidogens have been shown to interact with cell receptor molecules and also control cell polarization, migration and invasion [12]. In vitro binding of nidogen-2 to laminin c1 is weaker than for nidogen-1. Also nidogen-2 does not interact with fibulins [13]. Significant increase of nidogen-2 is observed in phorbol 12-myristate 13-acetate (PMA)-induced invasion of several human tumor cell lines [14], which further suggests that nidogen-2 has a role tumor invasion. However, there is no report about the expression and function of nidogens in MM. The urokinase plasminogen activator (uPA) system, which consists of a proteinase (uPA), a receptor (uPAR or CD87) and inhibitors, is involved in proteolysis, cell migration, tissue remodeling, angiogenesis and cell adhesion. uPA is a specific serine protease, which is able to convert plasminogen to its active form plasmin which digests various protein substrates in the ECM [15]. Furthermore, plasmin can catalyse the activation of latent matrix metalloproteinases (MMP) whereas uPA itself can activate hepatocyte growth factor (HGF) [16]. In addition to its proteolytic activity, the uPA system is involved in cell adhesion through the interaction with the ECM protein vitronectin [17]. Rigolin et al. [18] findings suggest that malignant plasma cells express uPA and uPAR. The expression of these factors could represent a process by which myeloma plasma cells interact with the BM environment and influence important biological events such as bone matrix degradation, plasma cell invasion and homing and, possibly, clinical evolution [19]. uPA can be produced by a number of cell types in the BM environment, making it possible for myeloma cells to bind either endogenously or exogenously derived uPA [20]. The fibulins are a family of secreted glycoproteins, which are characterized by epidermal growth-factor-like
123
Clin Exp Metastasis (2014) 31:585–593
domains repeats and a unique C-terminus structure. Fibulins modulate cell morphology, growth, adhesion, and motility [21]. Fibulins are hypothesized to function as intramolecular bridges that stabilize the organization of supramolecular ECM structures, such as elastic fibres and basement membranes. A correlation is reported between the expression of fibulins and certain types of malignancies. Fibulin proteins contribute to ECM remodeling during cancer cell invasion [22]. Fibulins are reported to exhibit both tumor suppressive and oncogenic activities [21]. The selected ECM proteins (fibulin 1, nidogen and laminin) were extensively studied in other cancers but role of these ECM proteins have not been yet explored in MM. These ECM proteins play a role in metastasis as reported in previous studies in other cancers [10, 14, 21, 22]. They exhibit antiangiogenic activities such as fibulin 1 [23] and it is well known that angiogenesis played a pivotal role in MM [24]. This observation led us to study and explore the role of these ECM proteins in MM. A variety of reports documented that malignant cells attached to ECM are more drug resistant than cells grown without ECM support [25]. Therefore, it is important to understand the ECM composition in MM to evaluate potential mediators of drug resistance. As it is already established that the number of blood tumor cells correlates with disease activity [26], this encourages us to observe if there is any difference in the expression of ECM proteins in blood itself of patients as compared to their corresponding BM and to healthy controls. To determine whether or not the ECM composition is aberrant in MM, we examined the expression of laminin, uPA, fibulins and nidogens in the blood of healthy controls and peripheral blood and BM of patients with MM. In addition, we compared the patterns of ECM expression along with severity of the disease.
Materials and methods Eighty subjects (50 MM patients and 30 healthy controls) were recruited for this study (Table 1). We have also got 15 patients BM samples out of 50 patients. Out of 15 patients 6 were in stage II and 9 were in stage III. Patients having b2-microglobulin of [2.0 lg/mL, registered at BRAIRCH, AIIMS, New Delhi, were included in this study. They were newly diagnosed (received no treatment), and the patients having cancer other than MM were excluded from the study. International staging system was used to categorize the patients into their specific stages according to their concentration of b2-microglobulin and albumin. Blood was withdrawn from 30 age and sex matched healthy controls after taking their consent to be enrolled in this study. Institute’s Ethical Committee has approved this study. Ten milliliters of blood were
Clin Exp Metastasis (2014) 31:585–593
587
withdrawn from patients. Plain sterile tubes free of endotoxins were used to withdraw blood for isolating serum (4 mL), whereas EDTA vials were used to collect blood for peripheral blood mononuclear cell’s (PBMC) isolation (6 mL). For serum isolation, blood was kept at room temperature for 10 min, and then, centrifugation was done for 10 min at 3,000 rpm. Isolated serum was stored at -80 °C for further use, while the Ficoll gradient was used for PBMC isolation. ECM proteins enzyme-linked immunosorbent assay High-sensitivity enzyme-linked immunosorbent assay (ELISA) kits were used for determining the circulatory levels of ECM proteins. Each sample was analyzed in duplicates to enhance the precision of the test. Total protein was estimated by using Bradford assay. The circulatory levels of each molecule were normalized to per mg of total protein in their respective samples. Laminin, fibulin 1 and nidogen ELISA kits were supplied by USCN Life Science Inc., USA. Human uPA activity assay Functionally active uPA present in plasma reacts with the biotinylated human PAI-1 capture. Latent or complexed uPA will not bind to the plate and will not be detected. Unbound uPA samples are washed away and an anti-uPA primary antibody is added. Excess primary antibody is washed away and bound antibody, which is proportional to the original active uPA present in the samples, is then reacted with the horseradish peroxidase secondary antibody. Following an additional washing step, TMB is then used for color development at 450 nm. The amount of
Table 1 Clinical characteristics of MM patients and the control subjects
color development is directly proportional to the concentration of active uPA in the sample. Levels of active uPA were normalized to per mg of total protein estimated by Bradford assay. Human uPA Activity Assay kit was procured from Molecular Innovations, Inc., USA. Quantitative mRNA expression by real-time reverse transcription PCR The mRNA levels of uPA and ECM proteins [laminin alpha 1 (La1), laminin beta 1 (Lb1), laminin gamma 1 (Lc1), fibulin 1 (Fbln1), nidogen 1 and 2 (Nd1 and Nd2)] were analyzed through relative quantitation using ABI 7500 real-time PCR (Applied Biosystems Inc.). Total RNA was isolated by ethanol–chloroform precipitation from PBMCs isolated from blood using TRIZOL reagent. One microgram of the total RNA was used to prepare cDNA using random hexamers (Fermentas) that were used as template in real-time PCR. Twenty microliters of reaction mixture included the Maxima SYBR Green master mix (Fermentas), cDNA, and the nuclease free water. The conditions for PCR were initial denaturation at 95 °C for 5 min, followed by 40 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. b-Actin was used as the endogenous control for quantitation. The forward and reverse primers used for each molecule were given in Table 2. Mean Ct values were calculated for each molecule using 2 - d Ct method, where Ct values of the molecules were normalized to that of b-actin and compared with Ct values of normal healthy controls to observe fold change in expression.
Table 2 Primer sequence of uPA and ECM proteins Primers
Direction
uPA
Forward
AAATGCTGTGTGCTGCTGAC
Reverse
AGGCCATTCTCTTCCTTGGT
La1
Forward
AGCGGATATGCAGCTCTTGT
Reverse
GTTATCCTGCCAGCACCATT
Lb1
Forward
TGAGGCAAAACAAAGTGCTG
Reverse
CTGCTTCAATGCTGTCCAAA
Lc1
Forward
GCATCTCCTACCCCTCTTCC
Reverse
AGCTGCCCAAAGATCTGAAA
Patients Total no. (n)
50
Male/female
33/17
Age mean ± SD (range)
50.8 ± 8 (37–66)
Anemia (Hb. \8.5 g %)
36 (72 %)
Clinical staging Stage I
10
Stage II
16
Stage III
24
Fbln1
Forward
CATCAACGAGACCTGCTTCA
Nd1
Reverse Forward
GAGATGACGGTGTGGGAGAT CCTGACAACACCTTGGGAGT
Reverse
GAAGTCCAGGGTGCATGTTT
Nd2
Healthy controls Total no. (n)
30
Male/female Age mean ± SD (range)
21/9 45 ± 7 (25–52)
Sequence
Forward
CTGTGGCCCCAACTCTGTAT
Reverse
CAGCAGGAGCACAGGTATGA
uPA urokinase plasminogen activator, La1 laminin alpha 1, Lb1 laminin beta 1, Lc1 laminin gamma 1, Fbln1 fibulin 1, Nd1 nidogen 1, Nd2 nidogen 2
123
588
Clin Exp Metastasis (2014) 31:585–593
Statistical analysis SPSS 15.0 was used for statistical assessment. Data were presented as mean ± SD. One-way ANOVA test was used to statistically analyze the differences in mean values of the parameters between MM patients of different stages and control subjects, while the significance value between various groups was calculated using Bonferroni post hoc test. Pearson correlation was done to correlate the different molecules with each other. A p value of \0.05 was considered statistically significant.
Results Circulatory levels of uPA and ECM proteins Mean values of uPA and various ECM proteins (after normalization) studied in MM patients and the control subjects are shown in Table 3. There is a significant increase (p \ 0.001) in mean levels of uPA, fibulin 1, nidogen and
laminin in patients (1.2, 1.4, 6.6 and 0.37 ng/mL per mg of total protein, respectively) as compared to healthy controls (0.22, 0.99, 4.3 and 0.27 ng/mL per mg of total protein, respectively). Stage I patients, when compared with healthy controls, showed insignificantly higher (p \ 1.0) levels of laminin, fibulin 1 and nidogen whereas uPA levels were significantly higher (p \ 0.001), but when compared with stage III patients, their levels were significantly lower (p \ 0.004, \0.007, \0.001 and \0.001, respectively). Stage II patients, when compared with healthy controls, showed significantly higher (p \ 0.001 and \0.03, respectively) levels of uPA and nidogen whereas levels of laminin and fibulin 1 showed insignificant (p \ 0.311 and \0.106, respectively) elevation, but when compared with stage III patients, their levels were significantly lower (p \ 0.001, \0.019 and \0.006) for uPA, laminin and nidogen whereas insignificantly (p \ 0.347) lower for fibulin 1. Table 3 clearly demonstrates statistical significance of the results in all study groups. Figure 1 shows the comparison of uPA and various ECM proteins between different stages of MM and healthy controls.
Table 3 Levels of uPA and ECM proteins in MM patients and healthy controls Parameters (ng/mL per mg of total protein) uPA
Total patients [TP] (n = 50) mean ± SD (range)
Controls [C] (n = 30) mean ± SD (range)
Significance (p) TP vs C
Significance (p) I vs II
Significance (p) I vs III
Significance (p) II vs III
1.2 ± 0.46 (0.5–2.8)
0.22 ± 0.08 (0.08–0.37)
0.001
0.112
0.001
0.001
Laminin
0.37 ± 0.3 (0.17–0.78)
0.27 ± 0.07 (0.13–0.39)
0.001
1.0
0.004
0.019
Fibulin 1 Nidogen
1.4 ± 0.5 (0.6–2.9) 6.6 ± 2.4 (2.7–15)
0.99 ± 0.34 (0.39–1.55) 4.3 ± 0.7 (2.8–5.7)
0.001 0.001
0.675 1.0
0.007 0.001
0.347 0.006
Fig. 1 Levels of uPA (plasma) and ECM proteins (serum) in MM patients and controls after normalization with total protein. a uPA, b fibulin 1, c laminin, d nidogen. P total patients, C healthy controls, I stage I patients, II stage II patients, III stage III patients, p refers to significance value, uPA urokinase plasminogen activator
123
Clin Exp Metastasis (2014) 31:585–593 Table 4 Mean values of mRNA fold expression by Q-PCR for uPA and ECM proteins in MM patients and controls
Parameters (fold expression) uPA La1 Lb1
589
Patients (n = 50) mean ± SD (range) 2.2 ± 0.9 (0.3–3.9) 0.0004 ± 0.0001 (0.0002–0.0004) 0.03 ± 0.02 (0.01–0.08)
Controls (n = 30) mean ± SD (range) 0.2 ± 0.1 (0.04–0.4)
Significance (p) 0.001
0.0003 ± 0.0001 (0.0001–0.0004) 0.001 0.01 ± 0.002 (0.003–0.01)
0.001
Lc1
0.7 ± 0.4 (0.1–1.4)
0.1 ± 0.03 (0.04–0.2)
0.001
Fbln1
1.2 ± 0.3 (0.6–2.3)
0.2 ± 0.1 (0.07–0.3)
0.001
Nd1
2.5 ± 1.1 (0.6–3.9)
0.7 ± 0.2 (0.3–0.9)
0.001
Nd2
1.6 ± 1.0 (0.4–4.3)
0.4 ± 0.1 (0.3–0.6)
0.001
Fig. 2 Fold expression of the ECM proteins and uPA in PBMC’s of MM patients (along with severity of the disease) and controls. P total patients, C healthy controls, I stage I patients, II stage II patients, III stage III patients, La1 laminin alpha 1, Lb1 laminin beta 1, Lc1 laminin gamma 1, Nd1 nidogen 1, Nd2 nidogen 2. Controls were compared with all the groups
mRNA expression levels of uPA and ECM proteins using quantitative PCR The mean fold expression values for each molecule showed an increase in mRNA expression by real-time RT-PCR (Table 4). Stage III patients showed significant increase (p \ 0.0001) when compared with the fold expression of controls for uPA and all ECM proteins. Stage II patients showed significant [p \ 0.0001 for uPA, Lc1, Fbln1 and nidogen (Nd1 and Nd2) whereas p \ 0.048 for La1] increase for uPA, laminin (La1 and Lc1) and nidogen (Nd1 and Nd2) when compared with the fold expression of controls whereas Lb1 showed insignificant (p \ 0.247) increase. Stage I patients showed insignificant (p \ 1.0 for all laminin and Nd2 whereas p \ 0.192 for Nd1) increase for laminin (La1, Lb1 and Lc1) and nidogen (Nd1 and Nd2) when compared with the fold expression of controls whereas uPA and fibulin 1 showed significant (p \ 0.0001) increase (Fig. 2). The changes observed for La1 and Lb1 are minimal in patients as well as in controls which are biologically of no relevance but statistically we have found
a significant difference. We have observed a significant change in mean fold expression for each molecule when the comparison was made between the expression in BMNCs and PBMCs of the same patient except La1 and Lb1 which showed significant difference but the expression were low (Table 5; Fig. 3). Correlation between uPA and ECM proteins On Pearson correlation analysis all the ECM proteins were found to have significant positive correlation with uPA on the comparison of ELISA (p \ 0.001) as shown in Table 6. The correlation analysis of quantitative PCR (Q-PCR) results between uPA and ECM proteins were also found to be significantly (p \ 0.05) correlated.
Discussion Several studies indicated that the interaction of tumour cells with components of the ECM represents a key step in
123
590
Clin Exp Metastasis (2014) 31:585–593
Table 5 Mean values of mRNA fold expression by Q-PCR for uPA and ECM proteins in MM patient’s bone marrow mononuclear cells (BMNCs) and peripheral blood mononuclear cells (PBMCs)
Parameters (fold expression) uPA La1 Lb1
BMNCs (n = 15) mean ± SD (range)
PBMCs (n = 15) mean ± SD (range)
3.2 ± 0.4 (2.5–5.5) 0.0005 ± 0.000007 (0.0005–0.0007) 0.06 ± 0.03 (0.04–0.2)
1.8 ± 0.5 (1–2.3)
Significance (p) 0.001
0.0003 ± 0.000004 (0.0003–0.0004) 0.001 0.03 ± 0.009 (0.014–0.041)
0.001
Lc1
1.3 ± 0.3 (1–2.4)
0.6 ± 0.1 (0.5–1.1)
0.001
Fbln1
1.6 ± 0.4 (1.2–2.9)
0.9 ± 0.1 (0.8–0.9)
0.001
Nd1
3.9 ± 0.6 (3.4–5.9)
2.1 ± 0.5 (1.3–3.1)
0.001
Nd2
2.9 ± 1.1 (2.5–7.0)
1.5 ± 0.6 (1–2.5)
0.0002
Fig. 3 Fold expression of the ECM proteins and uPA in BMNCs and PBMC’s of same MM patient (along with severity of the disease). BMNCs bone marrow mono nuclear cells (total patients), PBMCs peripheral blood mono nuclear cells (total patients), BII stage II patient’s BMNCs, BIII stage III patient’s BMNCs, PII stage II patient’s PBMCs, PIII stage III patient’s PBMCs, La1 laminin alpha 1, Lb1 laminin beta 1, Lc1 laminin gamma 1, Nd1 nidogen 1, Nd2 nidogen 2. Controls were compared with all the groups
Table 6 Correlation (ELISA) between uPA and ECM proteins in MM patients Parameters
Pearson correlation
Significance (p)
uPA vs. laminin
0.951
0.001
uPA vs. fibulin 1
0.910
0.001
uPA vs. nidogen
0.951
0.001
Fibulin 1 vs. laminin
0.961
0.001
Nidogen vs. laminin Fibulin 1 vs. nidogen
0.982 0.967
0.001 0.001
the biology of cancer cell migration and invasion. Because of the broad expression of laminin in extracellular matrices throughout the body, it is clear that this molecule itself cannot be the only factor that determines the specificity of MM cell homing. It can be assumed that several adhesion mechanisms and chemotactic signals co-act to enhance the selectivity of tumour cell migration. Moreover, the restricted localisation of MM cells in the BM might also relate to the presence of a unique combination of growth
123
and survival factors, which is not available at other tissue sites. The homing of myeloma cells to the BM is believed to be a multistep process, involving the action of various adhesion molecules, chemotactic signals and metalloproteases. Interference with one of the key steps in this process might be an important therapeutical tool to reduce tumour dissemination [25]. To the best of our knowledge, no studies have been carried out to investigate the circulatory levels as well as cellular expression of ECM proteins and their correlation with uPA in patients of MM. Circulatory levels of ECM proteins (fibulin 1, nidogen and laminin) and uPA, along with their mRNA levels, were estimated in a single study in newly diagnosed MM patients, and the data obtained were also correlated along with severity of the disease. In fact this is the first study to report on the levels of fibulin 1, nidogen (Nd1 and Nd2) and laminin ((La1, Lb1 and Lc1) and their mRNA expression in MM. The data generated in this study showed significantly higher circulatory levels of fibulin 1, nidogen and laminin, and elevated uPA activity
Clin Exp Metastasis (2014) 31:585–593
was also observed in MM patients as compared to the healthy controls. Our results also showed the higher expression in BM as compared to blood of the same patient. The increase in concentrations of these ECM proteins and uPA activity parallels with the severity of the disease. This data may suggest their role in disease progression as they may be involved in the process of metastasis and indirectly angiogenesis in MM. In our recent study [24], we have already reported elevated expression of angiogenic factors in MM patients. Kibler et al. [27] showed that only laminin, the microfibrillar collagen type VI and fibronectin were strong adhesive components for the myeloma cells and summarized that the interactions of human myeloma cells with the ECM may explain the specific retention of the plasma cells within the BM. The stroma displayed most of the potential ligands which could interact with adhesion molecules detected on the myeloma cells. Among these ligands, Faid et al. [28] found fibronectin and VCAM-1 for VLA-4, collagen I for VLA-2 and VLA-3 and laminin for VLA-2, 3 and 6. There are studies [29] which demonstrated that laminin acts as a chemoattractant for MM cells by binding to 67LR. Tancred et al. [30] found no difference in the expression of laminin in normal, MGUS and MM patients using immunohistochemistry (IHC). Mutlu et al. [31] reported the overexpression of Lc1 gene in prednisone resistant subline whereas it was downregulated in its melphalan resistant variant. In our study, we have observed the higher circulatory levels of laminin in stage III patients as compared to stage I and II patients whereas statistically insignificant difference was observed between stage I and II. In this study we have also observed elevated expression of laminin (La1, Lb1 and Lc1) at mRNA level which shows correlation with the severity of the disease. Daci et al. [32] in their study implicated the role of plasminogen/plasmin system in the bone remodelling process and reported that the interactions with osteoblasts upregulate the release of uPA from myeloma cells and might participate in myeloma-associated bone destruction. Blasi et al. [33] reported that conversion of bound and inactive pro-uPA to active uPA induces ECM degradation which results in promotion of tumor invasion and metastasis. Receptor binding of uPA or pro-uPA strongly accelerates pro-uPA activation and increases the enzymatic activity of uPA itself, which then accelerates the activation of plasminogen to plasmin. uPA and plasmin catalyse the cleavage of HGF to its active form [34, 35], which is the critical limiting step in HGF signaling and showed that osteoblast promoted myeloma cell invasion is mediated by HGF. uPA/uPAR are potent promoters of tumor growth and angiogenesis [35]. Hjertner et al. [36] reported the expression of uPA and uPAR in primary myeloma cells and myeloma cell lines and suggested that expression of
591
uPA/uPAR is an independent factor predicting poor prognosis. Inhibition of uPA inhibits invasion of myeloma cells [37], and uPA and MMP-9 have been shown to mediate invasion of the BM extravascular compartment once cells have exited the marrow endothelium [38]. In this study, we have observed increase in activity in plasma as well as expression (mRNA) of uPA which also shows correlation with the sternness of the disease. This study also points to the activation step of uPA as a possible target for therapeutic intervention. Disruption of the integrity of the basement membrane creates an invasion-permissive environment, which may promote cancer cell proliferation and invasion [39]. There are reports which showed decreased expression of nidogen in human gastrointestinal tumors [40], malignant melanomas [41] and hepatocellular carcinoma [42]. However, other studies have reported the elevated serum levels of nidogen-2 in ovarian carcinoma patients as compared to patients with benign gynecological tumors and normal controls and its elevated expression in ovarian cancer tissues [43]. This is the first study to report the increased nidogen expression in MM. The results of this study are in concordance with the results of previous studies on other cancers [44]. It has also been reported that nidogen can protect laminin-1 against proteolysis [5], suggesting that nidogen increase may be responsible for the rise in laminin. Increase in serum nidogen may be due to defect in basement membrane structural integrity. Potentially, this mechanism may facilitate the route to invasion for genetically altered MM cells and favor metastasis by promoting angiogenesis. In this study, we have observed significantly higher expression of nidogen at serum as well as at mRNA level (Nd1 and Nd2). DNA microarray studies of lung adenocarcinomas show that fibulins 1 and 2 are consistently associated with MMP2 expression, a protein that promotes tumour invasion and metastasis [45]. Fibulin-1 protein was overexpressed in the chemoresistant tissue along with other proteins belonging to ECM [46]. Talts et al. [47] reported the expression of tenascin-C, fibronectin and fibulin-1 and 2 in the tumor stroma, whereas nidogen was seen only in blood vessel basement membranes. There are reports which showed elevated levels of fibulin 1 in ovarian cancer [48] and human breast tumours [22]. On contrary, other studies demonstrated that fibulin-1 is antiangiogenic and suppresses tumor growth [23]. It also inhibits in vitro adhesion and motility of various carcinoma cell lines [49]. Fibulin1D decreases tumor growth in vivo and delays cell invasion and migration in vitro [50]. There are reports which showed decreased levels of fibulin 1 in osteoblastic osteosarcoma [51] and hepatocellular carcinoma [52]. Although there are studies exploring the role of uPA and laminin in MM, but no study has explored the role of fibulin 1 and nidogen in MM [31, 35]. Moreover, there is also
123
592
Clin Exp Metastasis (2014) 31:585–593
contradiction among studies reported so far in other cancers [46, 52]. Some reports showed elevated expression of fibulin 1 [23, 45] in other cancers, while others found decreased expression [51, 52]. Contradiction in results of several studies on ECM proteins (fibulin 1 and Niodgen) in other cancers prompted us to quantitate the expression of ECM proteins along with established laminin and uPA by using Q-PCR and ELISA and correlated with the sternness of the disease. In our study, serum levels, as well as mRNA levels of fibulin 1, were significantly elevated. As ECM is a component of tissue and is usually deposited by tissue fibroblasts, we have analyzed the expression of these ECM proteins in BMNCs as well in PBMCs and we have found a significant increase in the transcript levels of these molecules when compared to their expression in PBMCs obtained from healthy controls. Increased expression was also observed when the expression in BMNCs and PBMCs of the same patient were compared. We have also observed their elevated levels in serum. Upon analysis of these transcripts according to severity of the disease, stage III patients showed higher expression as compared to stage I and II. There is also a difference in stage I and stage II when compared. This trend in levels of these molecules might be utilized as a marker of active disease. It can an also serve as another measurable disease marker in following patients on a new treatment regimen. Study in large patient cohort both in blood and BM may validate (or differentiate) the usefulness of these ECM proteins in MM. In this maiden attempt, we are reporting the strong correlation among uPA and ECM proteins in newly diagnosed MM patients of different stages. Our findings show that, compared with normal controls, the ECM composition is aberrant in patients with MM, further establishing ECM as a key player in the MM disease process. Elevation in uPA suggests that the uPA proteolytic system may be involved in the activation of several factors relevant to the biology of MM. The strong association between ECM proteins and uPA observed in this study supports that there might be interplay between these molecules which can be targeted. This study on these molecules may help to gain insight into processes of growth, spread, and clinical behavior of MM. Acknowledgment We would like to thank Dr. Guresh Kumar, Department of Biostatistics, AIIMS, New Delhi for statistical analysis of data. Conflict of interest of interest.
The authors declare that they have no conflict
References 1. Ludwig H, Pohl G, Osterborg A (2004) Anemia in multiple myeloma. Clin Adv Hematol Oncol 2:233–241
123
2. Schmidmaier R, Morsdorf K, Baumann P, Emmerich B, Meinhardt G (2006) Evidence for cell adhesion-mediated drug resistance of multiple myeloma cells in vivo. Int J Biol Markers 21:218–222 3. Butcher EC, Picker LJ (1996) Lymphocyte homing and homeostasis. Science 272:60–66 4. Ashkenas J, Muschler J, Bissell M (1996) The extracellular matrix in epithelial biology, shared molecules and common themes in distinct phyla. Dev Biol 17:433–444 5. Dziadek M (1995) Role of laminin-nidogen complexes in basement membrane formation during embryonic development. Experientia 51:901–913 6. Klominek J, Robert KH, Sundqvist KG (1993) Chemotaxis and haptotaxis of human malignant mesothelioma cells: effects of fibronectin, laminin, type IV collagen and an autocrine motility factor-like substance. Cancer Res 53:4376–4382 7. Maffini MV, Soto AM, Calabro JM, Ucci AA, Sonnenschein C (2004) The stroma as a crucial target in rat mammary gland carcinogenesis. J Cell Sci 117:1495–1502 8. Malinda KM, Kleinman HK (1996) The laminins. Int J Biochem Cell Biol 28:957–959 9. Spessotto P, Yin Z, Magro G, Deutzmann R, Chiu A, Colombatti A, Perris R (2001) Laminin isoforms 8 and 10 are primary components of the subendothelial basement membrane promoting interaction with neoplastic lymphocytes. Cancer Res 61:339–347 10. Ramos DM, Cheng YF, Kramer RH (1991) Role of lamininbinding integrin in the invasion of basement membrane matrices by fibrosarcoma cells. Invasion Metastasis 11:125–138 11. Timpl R, Brown J (1996) Supramolecular assembly of basement membranes. Bioassays 18:123–132 12. Yi XY, Wayner E, Kim Y, Fish A (1998) Adhesion of cultured human kidney mesangial cells to native entactin: role of integrin receptors. Cell Adhes Commun 5:237–248 13. Miosge N, Sasaki T, Timpl R (2002) Evidence of nidogen-2 compensation for nidogen-1 deficiency in transgenic mice. Matrix Biol 21:611–621 14. Rouleau C, Roy A, St Martin T, Dufault, Boutin P, Liu D, Zhang M, Puorro-Radzwill K, Rulli L, Reczek D, Bagley R, Byrne A, Weber W, Roberts B, Klinger K, Brondyk W, Nacht M, Madden S, Burrier R, Shankara S, Teicher BA (2006) Protein tyrosine phosphatase PRL-3 in malignant cells and endothelial cells: expression and function. Mol Cancer Ther 5:219–229 15. Blasi F (1997) upa, upar, PAI-1: key intersection of proteolytic, adhesive and chemotactic highways? Immunol Today 18:415–417 16. Naldini L, Vigna E, Bardelli A, Follenzi A, Galimi F, Comoglio PM (1995) Biological activation of pro-HGF (hepatocyte growth factor) by urokinase is controlled by a stoichiometric reaction. J Biol Chem 270:603–611 17. Wei Y, Waltz DA, Rao N, Drummond RJ, Rosenberg S, Chapman HA (1994) Identification of the urokinase receptor as an adhesion receptor for vitronectin. J Biol Chem 269:32380–32388 18. Rigolin GM, Tieghi A, Ciccone M, Bragotti LZ, Cavazzini F, Della Porta M, Castagnari B, Carroccia R, Guerra G, Cuneo A, Castoldi G (2003) Soluble urokinase-type plasminogen activator receptor (suPAR) as an independent factor predicting worse prognosis and extra-bone marrow involvement in multiple myeloma patients. Br J Haematol 120:953–959 19. Holst-Hansen C, Johannessen B, Hoyer-Hansen G, Romer J, Ellis V, Brunner N (1996) Urokinase-type plasminogen activation in three human breast cancer cell lines correlates with their in vitro invasiveness. Clin Exp Metastasis 14:297–307 20. Hannocks MJ, Oliver L, Gabrilove JL, Wilson EL (1992) Regulation of proteolytic activity in human bone marrow stromal cells by basic fibroblast growth factor, interleukin-1, and transforming growth factor beta. Blood 79:1178–1184
Clin Exp Metastasis (2014) 31:585–593 21. Gallagher WM, Currid CA, Whelan LC (2005) Fibulins and cancer: friend or foe? Trends Mol Med 11:336–340 22. Greene LM, Twal WO, Duffy MJ, McDermott EW, Hill AD, O’Higgins NJ, McCann AH, Dervan PA, Argraves WS, Gallagher WM (2003) Elevated expression and altered processing of fibulin-1 protein in human breast cancer. Br J Cancer 88:871–878 23. Hazlehurst LA, Dalton WS (2001) Mechanisms associated with cell adhesion mediated drug resistance (CAM-DR) in hematopoietic malignancies. Cancer Metastasis Rev 20:43–50 24. Khan R, Sharma M, Kumar L, Husain SA, Sharma A (2013) Interrelationship and expression profiling of cyclooxygenase and angiogenic factors in Indian patients with multiple myeloma. Ann Hematol 92:101–109 25. Neri P, Bahlis NJ (2012) Targeting of adhesion molecules as a therapeutic strategy in multiple myeloma. Curr Cancer Drug Targets 12:776–796 26. Witzig T, Dhodapkar M, Kyle R, Greipp P (1993) Quantitation of circulating peripheral blood plasma cells and their relationship to disease activity in patients with multiple myeloma. Cancer 72:108 27. Kibler C, Schermutzki F, Waller HD, Timpl R, Mu¨ller CA, Klein G (1998) Adhesive interactions of human multiple myeloma cell lines with different extracellular matrix molecules. Cell Adhes Commun 5:307–323 28. Faid L, Van Riet I, De Waele M, Facon T, Schots R, Lacor P, Van Camp B (1996) Adhesive interactions between tumour cells and bone marrow stromal elements in human multiple myeloma. Eur J Haematol 57:349–358 29. Broek IV, Vanderkerken K, De Greef C, Asosingh K, Straetmans N, Van Camp B, Van Riet I (2001) Laminin-1-induced migration of multiple myeloma cells involves the highaffinity 67 kD laminin receptor. Br J Cancer 85:1387–1395 30. Tancred TM, Belch AR, Reiman T, Pilarski LM, Kirshner J (2009) Altered expression of fibronectin and collagens I and IV in multiple myeloma and monoclonal gammopathy of undetermined significance. J Histochem Cytochem 57:239–247 31. Mutlu P, Ural AU, Gu¨ndu¨z U (2012) Differential gene expression analysis related to extracellular matrix components in drugresistant RPMI-8226 cell line. Biomed Pharmacother 66:228–231 32. Daci E, Everts V, Torrekens S, Van Herck E, Tigchelaar-Gutterr W, Bouillon R, Carmeliet G (2003) Increased bone formation in mice lacking plasminogen activators. J Bone Miner Res 18:1167–1176 33. Blasi F, Carmeliet P (2002) uPAR: a versatile signalling orchestrator. Nat Rev Mol Cell Biol 3:932–943 34. Monvoisin A, Neaud V, De Ledinghen V, Dubuisson L, Balabaud C, Bioulac-Sage P, Desmouliere A, Rosenbaum J (1999) Direct evidence that hepatocyte growth factor-induced invasion of hepatocellular carcinoma cells is mediated by urokinase. J Hepatol 30:511–518 35. Dass K, Ahmad A, Azmi AS, Sarkar SH, Sarkar FH (2008) Evolving role of uPA/uPAR system in human cancers. Cancer Treat Rev 34:122–136 36. Hjertner O, Qvigstad G, Hjorth-Hansen H, Seidel C, Woodliff J, Epstein J, Waage A, Sundan A, Borset M (2000) Expression of urokinase plasminogen activator and the urokinase plasminogen activator receptor in myeloma cells. Br J Haematol 109:815–822 37. Hecht M, Heider U, Kaiser M, von Metzler I, Sterz J, Sezer O (2007) Osteoblasts promote migration and invasion of myeloma cells through upregulation of matrix metalloproteinases, urokinase plasminogen activator, hepatocyte growth factor and activation of p38 MAPK. Br J Haematol 138:446–458 38. Menu E, Asosingh K, Van Riet I, Croucher P, Van Camp B, Vanderkerken K (2004) Myeloma cells (5TMM) and their
593
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
interactions with the marrow microenvironment. Blood Cells Mol Dis 33:111–119 Lester BR, McCarthy JB (1992) Tumor cell adhesion to the extracellular matrix and signal transduction mechanisms implicated in tumor cell motility, invasion and metastasis. Cancer Metastasis Rev 11:31–44 Ulazzi L, Sabbioni S, Miotto E, Veronese A, Angusti A, Gafa` R, Manfredini S, Farinati F, Sasaki T, Lanza G, Negrini M (2007) Nidogen 1 and 2 gene promoters are aberrantly methylated in human gastrointestinal cancer. Mol Cancer 6:17–25 Schmoeckel C, Stolz W, Sakai LY, Burgeson RE, Timpl R, Krieg T (1989) Structure of basement membranes in malignant melanoma and nevocytic nevi. J Invest Dermatol 92:663–668 Cheng Z, Huang XH, Wang Q, Chen JS, Zhang LJ, Chen XL (2012) Clinical significance of decreased nidogen-2 expression in the tumor tissue and serum of patients with hepatocellular carcinoma. J Surg Oncol 105:71–80 Schwartz DR, Kardia SL, Shedden KA, Kuick R, Michailidis G, Taylor JM, Misek DE, Wu R, Zhai Y, Darrah DM, Reed H, Ellenson LH, Giordano TJ, Fearon ER, Hanash SM, Cho KR (2002) Gene expression in ovarian cancer reflects both morphology and biological behavior, distinguishing clear cell from other poorprognosis ovarian carcinomas. Cancer Res 62:4722–4729 Creighton C, Hanash S (2003) Expression of matrix metalloproteinase 9 (MMP-9/gelatinase B) in adenocarcinomas strongly correlated with expression of immune response genes. In Silico Biol 3:301–311 Pan S, Cheng L, White JT, Lu W, Utleg AG, Yan X, Urban ND, Drescher CW, Hood L, Lin B (2009) Quantitative proteomics analysis integrated with microarray data reveals that extracellular matrix proteins, catenins, and p53 binding protein 1 are important for chemotherapy response in ovarian cancers. OMICS 13:345–354 Moll F, Katsaros D, Lazennec G, Hellio N, Roger P, Giacalone PL, Chalbos D, Maudelonde T, Rochefort H, Pujol P (2002) Estrogen induction and overexpression of fibulin 1C mRNA in ovarian cancer cells. Oncogene 21:1097–1107 Talts JF, Weller A, Timpl R, Ekblom M, Ekblom P (1995) Regulation of mesenchymal extracellular matrix protein synthesis by transforming growth factor-b and glucocorticoids in tumor stroma. J Cell Sci 108:2153–2162 Xie L, Palmsten K, MacDonald B, Kieran MW, Potenta S, Vong S, Kalluri R (2008) Inhibitors and suppress tumor growth basement membrane derived fibulin-1 and fibulin-5 function as angiogenesis. Exp Biol Med 233:155–162 Twal WO, Czirok A, Hedegus B, Knaak C, Chintalapudi MR, Okagawa H, Sugi Y, Argraves WS (2001) Fibulin-1 suppression of fibronectin-regulated cell adhesion and motility. J Cell Sci 114:4587–4598 Qing J, Maher VM, Tran H, Argraves WS, Dunstan RW, McCormick JJ (1997) Suppression of anchorage-independent growth and Matrigel invasion and delayed tumor formation by elevated expression of fibulin-1D in human fibrosarcoma-derived cell lines. Oncogene 15:2159–2168 Kubista B, Klinglmueller F, Bilban M, Pfeiffer M, Lass R, Giurea A, Funovics PT, Toma C, Dominkus M, Kotz R, Thalhammer T, Trieb K, Zettl T, Singer CF (2011) Microarray analysis identifies distinct gene expression profiles associated with histological subtype in human osteosarcoma. Int Orthop 35:401–411 Kanda M, Nomoto S, Okamura Y, Hayashi M, Hishida M, Fujii T, Nishikawa Y, Sugimoto H, Takeda S, Nakao A (2011) Promoter hypermethylation of fibulin 1 gene is associated with tumor progression in hepatocellular carcinoma. Mol Carcinog 50:571–579
123
