Med Oncol (2010) 27:474–480 DOI 10.1007/s12032-009-9237-5
ORIGINAL PAPER
Autocrine human growth hormone expression leads to resistance of MCF-7 cells to tamoxifen Majid Mojarrad Æ Majid Momeny Æ Fatemeh Mansuri Æ Yassan Abdolazimi Æ Mina Hajifaraj Tabrizi Æ Seyed Hamidollah Ghaffari Æ Seyed Mohammad Tavangar Æ Mohammad Hussein Modarressi
Received: 25 March 2009 / Accepted: 14 May 2009 / Published online: 27 May 2009 Ó Humana Press Inc. 2009
Abstract Tamoxifen is the most common antiestrogen used in the treatment of estrogen-positive breast cancer but its adverse effects and also resistance to this drug are serious challenges in the treatment of breast cancer. Characterization of mechanisms responsible for these adverse effects can lead to design of more efficient therapeutic strategies for the treatment of breast cancer. Here, we used a cellular model to evaluate the effects of autocrine expression of human growth hormone on responses of cells to tamoxifen. Our results imply for the first time that autocrine expression of growth hormone in human breast adenocarcinoma cell line, MCF-7, results in increase in cell proliferative capacity of cells even in the presence of tamoxifen. This effect may be due to up-regulation of Gcoupled estrogen receptor, GPR30, which is activated by tamoxifen. Keywords Autocrine Growth hormone GPR30 Drug resistance
M. Mojarrad F. Mansuri Y. Abdolazimi M. H. Tabrizi M. H. Modarressi (&) Department of Medical Genetics, Tehran University of Medical Sciences, Tehran, Iran e-mail:
[email protected] M. Momeny S. H. Ghaffari Hematology, Oncology and BMT Research Center, Tehran University of Medical Sciences, Shariati Hospital, Tehran, Iran S. M. Tavangar Department of Pathology, Shariati Hospital, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran M. H. Modarressi Pasteur Institute of Iran, Tehran, Iran
Introduction Tamoxifen is the most common antiestrogen drug used for the treatment of estrogen receptor (ER)-positive breast cancer patients [1, 2]. This drug has been manifested to exert significant therapeutic effects on breast cancer and contributes to reduce the breast cancer mortality [3]. However, almost 25% of ER-positive breast cancer patients do not respond to tamoxifen and half of the patients receiving tamoxifen eventually die due to creation of tamoxifen-resistant phenotype [3]. Biological mechanisms underlying the resistance of breast cancer cells to tamoxifen are not fully illustrated. Precise definition of these mechanisms helps design more effective therapeutic strategies against breast cancer and results in improvement of breast cancer survival. Tamoxifen is an ER antagonist and can exert effects on neoplastic cells via blocking ERs so that ER cannot conformationally change and bind to target gene promoters to regulate them [4]. However, recently it has been shown that estrogen has a third receptor other than traditional receptors, ER-a and b. This receptor is a member of G-protein coupled receptor family, named G-protein coupled estrogen receptor (GPCR or GPR30), which not only is not blocked by tamoxifen but also tamoxifen has agonistic effects on it [5–8]. GPR30 is localized on cytoplasmic and reticulum endoplasmic membrane. Following activation by estrogen, it triggers several nongenomic signaling pathways which lead to increase of cell proliferation and motility through up-regulation of a variety of mitogenic genes such as cyclin A, D, E and C-fos [9–11]. Furthermore, these pathways can inhibit cell apoptosis pathways such as TGF-b pathway [12].
Med Oncol (2010) 27:474–480
Recently, Vivacqua et al. [6, 7] reported that 4-hydroxytamoxifen induces proliferation of thyroid and endometrial cancer cells via activation of GPR30. This finding suggests that resistance to tamoxifen may be achieved by overexpression of GPR30. Identification of regulatory factors of GPR30 expression can lead to design more appropriate strategies to control neoplastic cells’ response to tamoxifen and eventually achieving more effective treatment for breast cancer. One of the growth regulatory factors which may be involved in response of breast tumor to antiestrogen drugs is human growth hormone (HGH). There is striking evidence that growth hormone and estrogen are obligatory counterparts in normal development of mammary gland [13, 14]. It has been also shown that hypophysectomy dramatically represses metastatic mammary tumor in animal models [15, 16]. Furthermore, growth hormone receptor antagonist pegvisomant not only blocks mammary gland development in mice, but also inhibits tumor growth in MCF-7 breast cancer xenograft model [17]. These evidences suggest that growth hormone has a significant role in breast cancer development. An accumulating number of evidence reveals that autocrine expression of GH in mammary epithelium has a pivotal role in breast cancer development [18–25]. Autocrine GH expression in breast epithelium shows a positive correlation with neoplastic progression of breast tissue with highest level of expression in metastatic breast cancer [26]. Furthermore, it has been documented that forced expression of GH in spontaneously immortalized breast epithelial cells, MCF-10A, leads to neoplastic changes in cell phenotype and these cells can form tumor in immunodeficient xenograft animal model [27]. In cellular level, autocrine GH increases cell survival, proliferation and motility, as well as decreases cell apoptosis [18, 24, 28]. Autocrine growth hormone may also lead to chemoresistant tumor phenotype [24, 28]. Autocrine GH regulates p450 aromatase expression which is a key enzyme in estrogen biosynthesis, since it can confer resistance to aromatase inhibitor drugs in mammary carcinoma cells [29]. In this experiment, we aimed to investigate whether autocrine GH expression in breast adenocarcinoma cell line, MCF-7, leads to resistance of cells to antiproliferative effects of tamoxifen.
Materials and methods Reagents LY294002, AG 490, SU6665 and tamoxifen (Tam) were purchased from Sigma-Aldrich. All reagents were dissolved in DMSO, except for AG490 and Tam which were
475
solubilized in ethanol. Tam, LY294002, SU6656 and AG 490 were used as final concentration of 100 nM, 30 lM, 1 lM and 1 lM, respectively. Plasmid construction HGH was amplified by reverse transcription PCR using specific cloning primers listed in Table 1. As a control we make a mutated clone by replacing ATG translation start site with TTG, using mutation bearing primer (Table 1). PCR products were cloned into pCDNA3.1 (?) expression plasmid. These recombinant vectors were called pCDNA-HGH and pCDNA-MUT, respectively. Identification of clones was confirmed using automatic sequencing technique. Cell culture Human mammary adenocarcinoma cell line, MCF-7, purchased from National Cell Bank of Iran, Pasteur Institute of Iran (Tehran, Iran), was cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA) containing 20 lg/ml gentamicine supplemented with 10% FBS (Invitrogen, Carlsbad, CA). Cells were grown at 37°C in the presence of 5% CO2 and 95% humidity. Stable cell line production 2.5 9 105 MCF-7 cells were plated in a 25 mm2 flask until they reached to 60% confluency. Then, 8 lg of either pCDNA-HGH or pCDNA-MUT were introduced into cells by using lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to manufacturer’s instruction. Transfected cells were selected by 800 lg/ml G418 to achieve cells stably expressing transgene. Expression of GH protein was confirmed using immunocytochemistry investigation (data not shown). G418 resistant cell population was applied for later experiments. Immunohistochemistry Cell lines were seeded into the wells of eight-well chamber slides at a density of 50,000 cell/well and were allowed to Table 1 Primer sequences Primer name
Sequence
hGHcloningf
CGGGATCC CACCTCGCTGCAATGGCTAC
hGHcloningr MUTcloningf
CGGGATCCCAGCTAGAAGCCACAGCTG CGGGATCC CACCTCGCTGCATTGGCTAC
HPRTf
ATTGTAATGACCAGTCAACAGGG
HPRTr
TTGACACTGGCAAAACAATGC
GPR30f
GACCTTCAGGGACAAGCTGA
GPR30r
CGGTGCTGTCTGGAATGAC
476
adhere for 48 h. The cells then were fixed in 4% formalin in PBS for 15 min and cell membranes were permeabilized with 0.1% Triton X-100 in PBS. Endogenous peroxidase was blocked by immersing the slides in PBS containing 3% H2O2 for 15 min. The sections were then incubated with a 1:100 dilution of primary antibody overnight at 4°C. The slides were washed three times in PBS containing 0.05% Tween 20 and then incubated with a 1:100 dilution of sheep anti-rat HRP-conjugated antibody for 90 min at room temperature. After further washing in PBS-Tween 20, the reaction product was visualized using diaminobenzidine (DAB, 100 mg DAB in 100 ml PBS (pH 7.2), 100 ml H2O and 66 ll H2O2). After 5 min the sections were washed twice in distilled water and counter-stained in hematoxyline. Slides were mounted and analyzed under light microscope.
Med Oncol (2010) 27:474–480
IR (%) = 1 - ODexp/ODcon 9 100, where ODexp and ODcon are the optical densitometries of treated and untreated cells, respectively. Statistical analysis Data are expressed as mean ± standard deviation (SD). All experiments were performed in triplicate. The one-way ANOVA test was applied as statistical analysis. P values \0.05 were considered significant.
Results Human growth hormone expression was confirmed by immunohistochemistry
RNA extraction and quantitative real-time RT-PCR Total RNA was extracted from cells using RNeasy mini kit (Qiagen) as per manufacturer’s instruction. Then, 1 lg of RNA was applied to cDNA synthesis by Quantitect reverse transcriptase kit (Qiagen). Quantitative PCR reaction was performed on a rotor gen 6000 corbette detection system using QuantiFast SYBR Green technology (Qiagen) and following thermal cycling conditions: an initial activation step for 5 min at 95°C followed by 40 cycles including a denaturation step for 10 s at 95°C and a combined annealing/extension step for 30 s at 60°C. Primer sequences are listed in Table 1. Fold changes in gene expression were calculated by delta delta CT method and hypoxanthine-guanine phosphoribosyltransferase (HPRT) was amplified as normalizer gene.
An indirect immunoperoxidase method was used for detection of growth hormone protein in MCF-HGH cells. Figure 1 indicates the expression of HGH in MCF-HGH cells. Autocrine human growth hormone has no significant effects on ERa and ERb ERa and ERb are traditional ERs and are used as valuable markers to evaluate the breast cancer prognosis and drug response. To examine if autocrine GH collaborates with estrogen through regulating the expression of these receptors, we performed a quantitative real-time RT-PCR reaction. According to our results, we found no change in mRNA expression level of ERa and ERb (data not shown). It seems
Microculture tetralzolium test (MTT assay) The inhibitory effect of tamoxifen on growth and proliferation of MCF-HGH and MCF-MUT cells was assessed by MTT assay. The MTT assay is a colorimetric assay that relies on the ability of viable cells to convert a soluble tetrazolium salt, 3-(4,5-dimethyl-2-tetrazolyl)-2,5-diphenyl-2H tetrazolium bromide (MTT), into a formazan precipitate, causing a yellow-to-purple color change. In brief, 2 9 104 cells was plated onto each well of 96-well plate and incubated in cell culture incubator. After 24 h, medium was replaced by either control medium containing 0.5% DMSO as vehicle control or medium containing 100 nM tamoxifen every 24 h for 72 h. Then, 50 ll of MTT solution (5 mg/ml) was added to each well followed by further incubation at 37°C for 1 h. After solubilization of precipitated formazan by adding of 100 ll DMSO, the optical densitometry was measured at a wavelength of 550 nm. The inhibition rate (IR) of tamoxifen was evaluated using the following equation:
Fig. 1 Human growth hormone expression in MCF-HGH cells was confirmed in protein level by immunocytochemistry. Red signals in cytoplasm of cells indicate growth hormone protein
Med Oncol (2010) 27:474–480
477
that autocrine growth hormone modulates estrogen-mediated effects by other mechanisms. Autocrine human growth hormone upregulates GPR30 GPR30 is a newly found ER responsible for cell proliferation through inducing the effects of estrogen in ER independent manner [6, 30–34]. Quantitative real-time RTPCR results revealed that autocrine GH dramatically upregulates GPR30 via activation of JAK/STAT signaling pathway (Fig. 2). As shown, inhibition of JAK2 by treatment of MCF-HGH cells with AG490 significantly abrogates GH effects on mRNA level of GPR30. Furthermore, inhibition of either phosphatidylinositol 3-kinase (PI3K) and Src kinase, by LY294002 and SU6656 treatment, respectively, attenuate GH effects on GPR30 expression but these changes were not significant.
Fig. 3 Effects of tamoxifen on proliferation of MCF-HGH and MCFMUT cells. Cells were treated by 100 nM concentration of tamoxifen for 72 h. Using MTT assay, the inhibitory effect of tamoxifen on MCF-HGH and MCF-MUT cells proliferation was determined compared to the control as mentioned in ‘‘Materials and methods’’
Tamoxifen treatment decreases cell proliferation rate of MCF-MUT cells but not MCF-HGH cells To measure the effects of autocrine GH on antiproliferative activity of tamoxifen, we performed cell proliferation assay on MCF-MUT and MCF-HGH cells. As shown in Fig. 3, tamoxifen has a significant inhibitory effect on MCF-MUT cell proliferation. In comparison, treatment of MCF-HGH cells by tamoxifen augments the proliferative capacity of MCF-HGH cells although by a non-significant amount.
Discussion HGH is the main longitudinal growth regulating hormone [35]. Furthermore, GH has pivotal effects on mammary
Fig. 2 Effects of autocrine expression of GH with or without inhibitors on expression level of GPR30. As apparently shown, autocrine expression of hGH in MCF-7 cells significantly upregulates mRNA levels of GPR30. To identification of pathway that autocrine GH regulates GPR30 by which MCF-HGH was treated by specific inhibitors. As shown GPR30 expression was significantly decreased in cells treated by AG490. Two other inhibitors could also abrogate GH effect but these effects were not statistically significant
gland development [13, 14, 36]. This hormone collaborates with estrogen to regulate mammary gland growth in different developmental stage of this tissue and normal development of mammary gland will be disrupted by absence of either of these factors [29, 36]. In recent decades increasing number of documents implicates that local autocrine expression of GH is involved in neoplastic growth of mammary epithelial [37]. Restricted locally expression of growth hormone is observed in some developmental stage of breast tissue, such as lactation [14]. However, abnormal constitutive autocrine expression of GH in breast epithelial cells leads to cell immortalization, increase of cell proliferation and survival, oncogenic transformation, phenotype conversion, tumor angiogenesis and even chemoresistance and radioprotection of malignant cells [18, 24, 27, 38]. Hence, estrogen is the main hormone involved in breast cancer, and it seems that GH and estrogen collaborate together in breast tumorigenesis process. Recently, it has been reported that autocrine GH regulates p450 aromatase, a key enzyme in estrogen biosynthesis, which leads to resistance of mammary carcinoma cells to an aromatase inhibitor [29]. On the other hand, it has been shown that GH expressing MCF10A cells need 17-b estradiol to form tumor in immunodeficient xenograft model [26]. By this evidence, it is obvious that autocrine GH and estrogen play a two-sided role in breast cancer development. However, details of crosstalk between autocrine GH and estrogen and its roles in breast cancer malignancy remain to be elucidated. We show here that autocrine GH upregulates a newly identified ER named G-protein coupled ER, GPR30.
478
GPR30 mediates some of the estrogen effects via nongenomic signaling pathways which lead to increase in cell proliferation, cell motility and cell survival [5, 39]. Molecular mechanisms by which GPR30 mediates its effects are not fully determined. To date, transactivation of EGFR and PI3K activation, MAP kinase ERK1/2 activation and adenylyl cyclase activation are documented as effects of estrogen activated GPR30 [30, 40–46]. GPR30 upregulates several cell proliferation inducing genes, including c-fos, cyclin A, D, E and also pS2 [7, 31, 47–49]. Moreover, GPR30 inhibits Smad pathway and also TGF-b signaling [12, 50]. GPR30 makes a paradigm in endocrine therapy of cancer, because this receptor can be activated by ER antagonists such as tamoxifen, first line treatment for ER-positive metastatic breast cancer. This means that GPR30 may lead to adverse effects of ER antagonists. In this study we provided a cellular model of autocrine growth hormone expression in mammary adenocarcinoma cells, MCF-7. By MTT assay, we observed antiproliferative effects of tamoxifen on MCF-MUT cells which naturally express a basal level of GPR30, but autocrine expression of GH in MCF-HGH cells overcomes antiproliferative effects of tamoxifen. It seems that overexpression of GPR30 is responsible in resistance of MCF-7 to tamoxifen cells not GPR30 expression alone. By respect of this result, it seems that in GPR30 overexpressing malignant cells, ER antagonists not only have no therapeutic effect but also may lead to cancer progression. This conclusion is in concordance with Zujewski results reporting that tamoxifen treatment increases endometrial carcinoma incidence in women [51], where GH regulates its growth. Surprisingly, tamoxifen leads to increase of IGF-1 in uterine of rats and this effect is abrogated by disruption of GH in knock-out rats [52, 53]. Furthermore, treatment of thyroid cancer cells by tamoxifen induces cell proliferation, in vitro. According to these results, it seems that autocrine GH mediated upregulation of GPR30 has a role in development of ER antagonist resistant breast cancer. There is an interesting concordance between GPR30 functions and autocrine GH mediated events in breast cancer cells. Autocrine GH leads to overexpression of bcl-2 and CyclinD1 via Hox A1 transcription factor activation. Estrogen is also upregulating factor of these genes via GPR30 in an ERE-independent manner. However, it is not clear whether GPR30 mediates these effects via HOXA1 or other means and further studies are needed to address it. There is ample evidence that certain cellular kinase such as ERK1/2 and AKT can phosphorylate ERa and enhance ligand sensitivity of receptor, thus potentially leading to activation of ERa in a ligand-independent manner. These processes can overcome tamoxifen antagonistic effects on ER.
Med Oncol (2010) 27:474–480
GH by binding to growth hormone receptor activates downstream signaling pathways which ERK1/2 and AKT are downstream effectors of them. By this evidence, it is possible that autocrine GH can also enhance ER-dependent response of cells in the presence of tamoxifen. In this experiment, we show that autocrine expression of HGH in breast adenocarcinoma cell line, MCF-7, has protective effects against antiproliferative effects of tamoxifen. Furthermore, our results suggest that autocrine GH induces these effects by two possible ways: first, overexpression of GPR30 that increases cell proliferation and decreases cell apoptosis. Second, phosphorylation and ligand independent activation of ERa. Precise characterization of these possible mechanisms of GH effects remains to be determined.
References 1. Osborne CK, Zhao H, Fuqua SA. Selective estrogen receptor modulators: structure, function, and clinical use. J Clin Oncol. 2000;18:3172–86. 2. Katzenellenbogen BS, Montano MM, Ediger TR, Sun J, Ekena K, Lazennec G. Estrogen receptors: selective ligands, partners, and distinctive pharmacology. Recent Prog Horm Res. 2000;55: 163–93. 3. Early Breast Cancer Trialist’ Collaborative Group (EBCTC). Effects of chemotherapy and hormonal therapy for early breast cancer on recurrence and 15-year survival: an overview of the randomized trials. Lancet. 2005;365:1687–17. doi:10.1016/S01406736(05)66544-0. 4. Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL. The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell Cycle. 1998;95:927–37. 5. Funakoshi T, Yanai A, Shinoda K, Kawano MM, Mizukami Y. G protein-coupled receptor 30 is an estrogen receptor in the plasma membrane. Biochem Biophys Res Commun. 2006;346(3):904– 10. doi:10.1016/j.bbrc.2006.05.191. 6. Vivacqua A, Bonofiglio D, Recchia AG, Musti AM, Picard D, Ando S, et al. The G protein-coupled receptor GPR30 mediates the proliferative effects induced by 17beta-estradiol and hydroxytamoxifen in endometrial cancer cells. Mol Endocrinol. 2006; 20(3):631–46. doi:10.1210/me.2005-0280. 7. Vivacqua A, Bonofiglio D, Albanito L, Madeo A, Rago V, Carpino A, et al. 17beta-estradiol, genistein, and 4-hydroxytamoxifen induce the proliferation of thyroid cancer cells through the g protein-coupled receptor GPR30. Mol Pharmacol. 2006;70 (4):1414–23. doi:10.1124/mol.106.026344. 8. Prossnitz ER, Sklar LA, Oprea TI, Arterburn JB. GPR30: a novel therapeutic target in estrogen-related disease. Trends Pharmacol Sci. 2008;29(3):116–23. 9. Matsuda K, Sakamoto H, Mori H, Hosokawa K, Kawamura A, Itose M, et al. Expression and intracellular distribution of the G protein-coupled receptor 30 in rat hippocampal formation. Neurosci Lett. 2008;441(1):94–9. doi:10.1016/j.neulet.2008.05.108. 10. Wang C, Prossnitz ER, Roy SK. G protein-coupled receptor 30 expression is required for estrogen stimulation of primordial follicle formation in the hamster ovary. Endocrinology. 2008;149 (9):4452–61. doi:10.1210/en.2008-0441.
Med Oncol (2010) 27:474–480 11. Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER. A transmembrane intracellular estrogen receptor mediates rapid cell signaling. Science. 2005;307(5715):1625–30. doi: 10.1126/science.1106943. 12. Kleuser B, Malek D, Gust R, Pertz HH, Potteck H. 17-Betaestradiol inhibits transforming growth factor-beta signaling and function in breast cancer cells via activation of extracellular signal-regulated kinase through the G protein-coupled receptor 30. Mol Pharmacol. 2008;74(6):1533–43. doi:10.1124/mol.108. 046854. 13. Sternlicht M. Key stages in mammary gland development: the cues that regulate ductal branching morphogenesis. Breast Cancer Res. 2006;8(1):201. doi:10.1186/bcr1368. 14. Kleinberg D. Early mammary development: growth hormone and IGF-1. J Mammary Gland Biol Neoplasia. 1997;2(1):49–57. doi: 10.1023/A:1026373513521. 15. Luft R, Olivecrona H, Sjogren B. Hypophysectomy in man. Nord Med. 1952;47(11):351–4. 16. Ray BS, Pearson OH. Hypophysectomy in treatment of disseminated breast cancer. Surg Clin North Am. 1962;42:419–33. 17. Divisova J, Kuiatse I, Lazard Z, Weiss H, Vreeland F, Hadsell DL, et al. The growth hormone receptor antagonist pegvisomant blocks both mammary gland development and MCF-7 breast cancer xenograft growth. Breast Cancer Res Treat. 2006;98(3): 315–27. doi:10.1007/s10549-006-9168-1. 18. Mukhina S, Mertani HC, Guo K, Lee KO, Gluckman PD, Lobie PE. Phenotypic conversion of human mammary carcinoma cells by autocrine human growth hormone. Proc Natl Acad Sci USA. 2004;101(42):15166–71. doi:10.1073/pnas.0405881101. 19. Mertani HC, Garcia-Caballero T, Lambert A, Ge´rard F, Palayer C, Boutin JM, Vonderhaar BK, Waters MJ, Lobie PE, Morel G. Cellular expression of growth hormone and prolactin receptors in human breast disorders. Int J Cancer. 1998;79(2):202–11. doi: 10.1002/(SICI)1097-0215(19980417)79:2\202::AID-IJC17[3.0. CO;2-B. 20. Antony GJ, Van Wyk JJ, French FS, Weaver RP, Dugger GS, Timmons RL, et al. Influence of pituitary stalk section on growth hormone, insulin and TSH secretion in women with metastatc breast cancer. J Clin Endocrinol Metab. 1969;29(9):1238–50. 21. Emerman JT, Leahy M, Gout PW, Bruchovsky N. Elevated growth hormone levels in sera from breast cancer patients. Horm Metab Res. 1985;17(8):421–4. doi:10.1055/s-2007-1013563. 22. Slootweg MC, de Groot RP, Herrmann-Erlee MP, Koornneef I, Kruijer W, Kramer YM. Growth hormone induces expression of c-jun and jun B oncogenes and employs a protein kinase C signal transduction pathway for the induction of c-fos oncogene expression. J Mol Endocrinol. 1991;6(2):179–88. doi:10.1677/jme.0. 0060179. 23. Stoll BA. Growth hormone and breast cancer. Clin Oncol (R Coll Radiol). 1992;4(1):4–5. doi:10.1016/S0936-6555(05)80761-7. 24. Waters MJ, Conway-Campbell BL. The oncogenic potential of autocrine human growth hormone in breast cancer. Proc Natl Acad Sci USA. 2004;101(42):14992–3. doi:10.1073/pnas.0406 396101. 25. Wagner K, Hemminki K, Israelsson E, Grzybowska E, Klaes R, Chen B, et al. Association of polymorphisms and haplotypes in the human growth hormone 1 (GH1) gene with breast cancer. Endocr Relat Cancer. 2005;12(4):917–28. doi:10.1677/erc.1.01073. 26. Raccurt M, Lobie PE, Moudilou E, Garcia-Caballero T, Frappart L, Morel G, Mertani HC. High stromal and epithelial human gh gene expression is associated with proliferative disorders of the mammary gland. J Endocrinol. 2002;175: 307–18. doi:10.1677/ joe.0.1750307. 27. Zhu T, Starling-Emerald B, Zhang X, Lee KO, Gluckman PD, Mertani HC, Lobie PE. Oncogenic transformation of human
479
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
mammary epithelial cells by autocrine human growth hormone. Cancer Res. 2005;65(1):317–24. Perry JK, Emerald BS, Mertani HC, Lobie PE. The oncogenic potential of growth hormone. Growth Horm IGF Res. 2006;16: 277–89. doi:10.1016/j.ghir.2006.09.006. Perry JK, Mohankumar KM, Emerald BS, Mertani HC, Lobie PE. The contribution of growth hormone to mammary neoplasia. J Mammary Gland Biol Neoplasia. 2008;13:131–45. doi:10.1007/ s10911-008-9070-z. Filardo EJ, Quinn JA, Frackelton AR Jr, Bland KI. Estrogen action via the G protein-coupled receptor, GPR30: stimulation of adenylyl cyclase and cAMP-mediated attenuation of the epidermal growth factor receptor-to-MAPK signaling axis. Mol Endocrinol. 2002;16(1):70–84. doi:10.1210/me.16.1.70. Maggiolini M, Vivacqua A, Fasanella G, Recchia AG, Sisci D, Pezzi V, et al. The G protein-coupled receptor GPR30 mediates c-fos up-regulation by 17beta-estradiol and phytoestrogens in breast cancer cells. J Biol Chem. 2004;279(26):27008–16. doi: 10.1074/jbc.M403588200. Filardo EJ, Thomas P. GPR30: a seven-transmembrane-spanning estrogen receptor that triggers EGF release. Trends Endocrinol Metab. 2005;16(8):362–7. doi:10.1016/j.tem.2005.08.005. Hsieh YC, Yu HP, Frink M, Suzuki T, Choudhry MA, Schwacha MG, et al. G protein-coupled receptor 30-dependent protein kinase A pathway is critical in nongenomic effects of estrogen in attenuating liver injury after trauma-hemorrhage. Am J Pathol. 2007;170(4):1210–8. doi:10.2353/ajpath.2007.060883. Albanito L, Madeo A, Lappano R, Vivacqua A, Rago V, Carpino A, et al. G protein-coupled receptor 30 (GPR30) mediates gene expression changes and growth response to 17beta-estradiol and selective GPR30 ligand G-1 in ovarian cancer cells. Cancer Res. 2007;67(4):1859–66. doi:10.1158/0008-5472.CAN-06-2909. Ahmad AM, Hopkins MT, Thomas J, Ibrahim H, Fraser WD, Vora JP. Body composition and quality of life in adults with growth hormone deficiency; effects of low-dose growth hormone replacement. Clin Endocrinol (Oxf). 2001;54(6):709–17. doi: 10.1046/j.1365-2265.2001.01275.x. Marino M, Galluzzo P, Ascenzi P. Estrogen signaling multiple pathways to impact gene transcription. Curr Genomics. 2006;7(8): 497–508. doi:10.2174/138920206779315737. Kaganowicz A, Farkouh NH, Frantz AG, Blaustein AU. Ectopic human growth hormone in ovaries and breast cancer. J Clin Endocrinol Metab. 1979;48(1):5–8. Kaulsay KK, Mertani HC, To¨rnell J, Morel G, Lee KO, Lobie PE. Autocrine stimulation of human mammary carcinoma cell proliferation by human growth hormone. Exp Cell Res. 1999;250: 35–50. doi:10.1006/excr.1999.4492. Prossnitz ER, Arterburn JB, Sklar LA. GPR30: a G proteincoupled receptor for estrogen. Mol Cell Endocrinol. 2007;265– 266:138–42. doi:10.1016/j.mce.2006.12.010. Filardo EJ. Epidermal growth factor receptor (EGFR) transactivation by estrogen via the G-protein-coupled receptor, GPR30: a novel signaling pathway with potential significance for breast cancer. J Steroid Biochem Mol Biol. 2002;80(2):231–8. doi:10.1016/ S0960-0760(01)00190-X. Filardo EJ, Quinn JA, Sabo E. Association of the membrane estrogen receptor, GPR30, with breast tumor metastasis and transactivation of the epidermal growth factor receptor. Steroids. 2008;73(9–10):870–3. doi:10.1016/j.steroids.2007.12.025. Revankar CM, Mitchell HD, Field AS, Burai R, Corona C, Ramesh C, et al. Synthetic estrogen derivatives demonstrate the functionality of intracellular GPR30. ACS Chem Biol. 2007;2(8): 536–44. doi:10.1021/cb700072n. Prossnitz ER, Oprea TI, Sklar LA, Arterburn JB. The ins and outs of GPR30: a transmembrane estrogen receptor. J Steroid
480
44.
45.
46.
47.
48.
Med Oncol (2010) 27:474–480 Biochem Mol Biol. 2008;109(3–5):350–3. doi:10.1016/j.jsbmb. 2008.03.006. Filardo EJ, Quinn JA, Bland KI, Frackelton AR Jr. Estrogeninduced activation of Erk-1 and Erk-2 requires the G proteincoupled receptor homolog, GPR30, and occurs via trans-activation of the epidermal growth factor receptor through release of HBEGF. Mol Endocrinol. 2000;14(10):1649–60. doi:10.1210/me.14. 10.1649. Albanito L, Sisci D, Aquila S, Brunelli E, Vivacqua A, Madeo A, et al. Epidermal growth factor induces G protein-coupled receptor 30 expression in estrogen receptor-negative breast cancer cells. Endocrinology. 2008;149(8):3799–808. doi:10.1210/en.2008-0117. Zhang Z, Duan L, Du X, Ma H, Park I, Lee C, et al. The proliferative effect of estradiol on human prostate stromal cells is mediated through activation of ERK. Prostate. 2008;68(5):508– 16. doi:10.1002/pros.20722. Kanda N, Watanabe S. 17beta-estradiol stimulates the growth of human keratinocytes by inducing cyclin D2 expression. J Invest Dermatol. 2004;123(2):319–28. doi:10.1111/j.0022-202X.2004. 12645.x. Kamanga-Sollo E, White ME, Chung KY, Johnson BJ, Dayton WR. Potential role of G-protein-coupled receptor 30 (GPR30) in estradiol-17beta-stimulated IGF-I mRNA expression in bovine
49.
50.
51.
52.
53.
satellite cell cultures. Domest Anim Endocrinol. 2008;35(3):254– 62. doi:10.1016/j.domaniend.2008.06.001. Sirianni R, Chimento A, Ruggiero C, De Luca A, Lappano R, Ando S, et al. The novel estrogen receptor, G protein-coupled receptor 30, mediates the proliferative effects induced by 17betaestradiol on mouse spermatogonial GC-1 cell line. Endocrinology. 2008;149(10):5043–51. doi:10.1210/en.2007-1593. Prakash Pandey D, Lappano R, Albanito L, Madeo A, Maggiolini M, Picard D. Estrogenic GPR30 signalling induces proliferation and migration of breast cancer cells through CTGF. EMBO J. 2009;28:523–32. Zujewski J. Selective estrogen receptor modulators (SERMs) and retinoids in breast cancer chemoprevention. Environ Mol Mutagen. 2002;39:264–70. Roy RN, Gerulath AH, Cecutti A, Bhavani BR. Effect of tamoxifen treatment on the endometrial expression of human insulin-like growth factors and their receptor mRNAs. Mol Cell Endocrinol. 2000;165:173–8. doi:10.1016/S0303-7207(00)00248-3. Lobie PE, Garcı´a-Arago´n J, Wang BS, Baumbach WR, Waters MJ. Cellular localization of the growth hormone receptor/binding proteins in the male and female reproductive systems. Endocrinology. 1990;126:2214–21.
