Autologous transplantation of mobilized peripheral blood ... - Nature

Bone Marrow Transplantation, (1998) 22, 957–963  1998 Stockton Press All rights reserved 0268–3369/98 $12.00 http://www.stockton-press.co.uk/bmt

Autologous transplantation of mobilized peripheral blood CD34ⴙ cells selected by immunomagnetic procedures in patients with multiple myeloma R Abonour1,4, KM Scott1, LA Kunkel2, MJ Robertson1, R Hromas1, V Graves4, EN Lazaridis3, L Cripe1, V Gharpure1, CM Traycoff1, B Mills2, EF Srour1 and K Cornetta1 1

Bone Marrow Transplantation Program and 3Division of Biostatistics, Department of Medicine, 4Department of Pathology, Indiana University School of Medicine, Indianapolis, IN; and 2Nexell Therapeutics, Irvine, CA, USA

Summary: In the use of autologous PBPC transplantation in patients with multiple myeloma, contamination of PBPC with myeloma cells is commonly observed. Enrichment for CD34ⴙ cells has been employed as a method of reducing this contamination. In this study the reduction of myeloma cells in PBPC was accomplished by the positive selection of CD34ⴙ cells using immunomagnetic bead separation (Isolex 300 system). PBPC were mobilized from 18 patients using cyclophosphamide (4.5 g/m2) and G-CSF (10 ␮g/kg/day). A median of two leukaphereses and one selection was performed per patient. The median number of mononuclear cells processed was 3.50 × 1010 with a recovery of 1.11 × 108 cells after selection. The median recovery of CD34ⴙ cells was 48% (range 17–78) and purity was 90% (29–99). The median log depletion of CD19ⴙ cells was 3.0. IgH rearrangement, assessed by PCR, was undetectable in 13 of 24 evaluable CD34ⴙ enriched products. Patients received 200 mg/m2 of melphalan followed by the infusion of a median of 2.91 × 106/kg CD34ⴙ cells (1.00– 16.30). The median time to absolute neutrophil count ⬎0.5 × 109/l was 11 days, and sustained platelet recovery of ⬎20 × 109/l was 14 days. We conclude that immunomagnetic-based enrichment of CD34ⴙ cells results in a marked reduction in myeloma cells without affecting engraftment kinetics. Keywords: CD34 selection; multiple myeloma; immunomagnetic separation; transplantation

The use of standard-dose chemotherapy in the management of multiple myeloma yields unsatisfactory outcomes in terms of both complete response rate and overall survival. In contrast, high-dose chemotherapy and combination chemo-radiotherapy have significantly improved both the disease-free and overall survival rates of patients suffering from multiple myeloma.1–3 This improvement has been seen in both refractory and newly diagnosed patients treated Correspondence: Dr R Abonour, Indiana Cancer Research Institute, 1044 W Walnut, Room 202, Indianapolis, IN 46202-5254, USA Received 30 April 1998; accepted 8 July 1998

with high-dose chemotherapy and autologous peripheral blood stem cell support.4–7 Nonetheless, the high rate of relapse in the setting of autologous transplantation continues to be a major problem. It has been speculated that some of these relapses, particularly early ones, result from the transplantation of clonogenic myeloma cells.8,9 Indeed, several investigators have shown that peripheral blood progenitor cell (PBPC) products contain significant numbers of circulating clonogenic myeloma cells.10–13 In order to reduce the risk of relapse due to the transfer of myeloma cells, several techniques that remove these cells from the transplanted products are being investigated.14–17 One such technique is the positive selection of CD34+ cells, shown to contain the necessary precursors for both short- and long-term hematopoietic reconstitution. Since it is believed that the CD34 antigen is not expressed on clonal myeloma cells, selection of CD34+ cells from autologous mobilized peripheral blood progenitor cells may result in the reduction of myeloma contamination of these cells by several orders of magnitude.18,19 We report here the results obtained from 18 patients with multiple myeloma who received high-dose chemotherapy followed by the infusion of autologous peripheral blood cells enriched for CD34+ using an automated immunomagnetic bead separation. Recovery of CD34+ cells, depletion of clonogenic B cells, and engraftment of in vitro processed cells were evaluated. To determine the degree of clonogenic B cell depletion we examined the expression of monoclonal immunoglobulin (Ig) heavy chain genes by RT-PCR in unfractionated PBPC, and in both CD34+ and CD34− fractions.

Patients and methods Patient selection Patients who met the standard criteria for the diagnosis of multiple myeloma were potentially eligible for this study. Disease staging was done according to the Durie and Salmon criteria.20 Eligibility criteria included age between 18 and 65, Eastern Cooperative Oncology Group (ECOG) performance status ⭐2, normal cardiac function, creatinine clearance ⬎60 ml/min, and a diffusion capacity of ⬎50%. Patients who progressed after high-dose cyclophosphamide

CD34 selection from PBPC in multiple myeloma R Abonour et al

958

were not eligible to proceed to high-dose melphalan. All patients met the pre-transplant assessment criteria as per our institutional protocol and signed an informed consent conforming to our Institutional Review Board guidelines. Induction chemotherapy/mobilization for leukapheresis PBPC were mobilized using 10 ␮g/kg/day G-CSF (Amgen, Thousand Oaks, CA, USA) subcutaneously beginning 48 h after completion of cyclophosphamide (total 4.5 g/m2; 1.5 g/m2 every 3 h times three doses). Leukapheresis was initiated using the mononuclear cell collection procedure of the COBE Spectra Cell Separator (COBE Laboratories, Lakewood, CO, USA). To qualify for selection, patients were required to show successful mobilization as demonstrated by ⭓20 CD34+ cells/␮l in peripheral blood and have a WBC ⭓1 × 109/l. Leukapheresis was ceased when a minimum of 5 × 106 CD34+ cells/kg were obtained for selection products and 1.5 × 106 CD34+ cells/kg were obtained in the unmanipulated back up to be used in case of graft failure. CD34+ cell selection The Baxter Isolex 300 system was used to process PBPC. The first eight patients’ products were processed using the semiautomated device (Isolex 300), while the remainder were processed on a fully automated version (Isolex 300i). Following the platelet wash to remove the majority of the platelets from the apheresis products, mononuclear cells were incubated with murine anti-human CD34 (clone C95) for 15 min at room temperature. After washing, sensitized cells were then incubated with Dynal paramagnetic micospheres (Dynal, Great Neck, NY, USA) at room temperature. The bead–cell complexes were then separated from unbound CD34− cells using a magnet to retain the bead–CD34+ cell complexes, while CD34− cells were washed away. Next, CD34+ cells were freed from the beads by incubation with a releasing agent. The agent used initially was chymopapain (ChymoCell-T, Boots Pharmaceuticals, Lincolnshire, IL, USA) and then, based on the manufacturer’s recommendation, was replaced by a synthetic peptide (Stem Cell Releasing Agent, Baxter Healthcare, Irvine, CA, USA). The CD34+ enriched products were evaluated for the following parameters: total nucleated cell counts, immunophenotype, sterility and viability. Cell staining and flow cytometric analysis To allow analysis of the content of enriched and unselected products, cells were stained on ice for 20 min with combinations of FITC- and PE-conjugated monoclonal antibodies (mAbs). These antibodies included CD34, HLA-DR, CD38, and CD19 (Becton Dickinson Immunocytometry System, San Jose, CA, USA). Nonspecific isotype-matched mAbs were used to determine background fluorescence. Cells were washed with PBS plus 1% HSA, fixed with 1% formaldehyde buffer, and kept at 4°C until analyzed using a FACScan flow cytometer. Data were collected in listmode and subsequently analyzed using Cell Quest software (BDIS). The percentage of CD34+ cells was calculated

using the mean of three different measurements, after subtraction of non-specific background fluorescence. For samples in which the level of CD19+ cells was below our reliable level of flow cytometric detection (previously established to be 0.1%) a value of 0.1% CD19+ cells was assigned. High-dose chemotherapy/CD34+ cell infusion High-dose cytoreductive therapy consisted of melphalan 200 mg/m2 given at a dose of 100 mg/m2 in 100 ml of normal saline over 30 min on days −3 and −2. Patients, treated in single-bed rooms, received prophylactic quinolone antibiotics and fluconazole. Frozen cell products were brought to the patient’s room, thawed individually, and infused without delay. All patients received 5 ␮g/kg/day of G-CSF until absolute neutrophil counts were 2 × 109/l for 2 consecutive days. Response was assessed according to the guidelines followed by ECOG study No. s9321. IgH RT-PCR RNA was isolated using TriPure reagent (Boehringer Mannheim, Indianapolis, IN, USA) from 1 × 106 cells, based on Chomczynski’s protocol.21 To generate cDNA, 2 ␮g of RNA was combined with a mixture containing dNTP, hexanucleotides, RNase inhibitor, buffer, and RT AMV (Boehringer Mannheim), and incubated for 1 h at 42°C. Amplification of the Ig heavy chain gene was performed by semi-nested PCR using consensus primers for a section of the rearranged IgH gene between frame work 2 and the J regions. The primers used in round one were: FR2B [5′GTCCTGCAGGC(C/T)(C/T)CCGG(A/G)AA(A/G)(A/G) G TCTGGAGTGG 3′] and LJH [5′TGAGGAACGGTGACC 3′].22–24 Second-round primers consisted of the FR2B primer and the J consensus primer [5′TGAGGAGACGGTGACCAGGATCCCTTGGCCCCAG 3′]. PCR was performed using 1.0 unit of Taq polymerase (Perkin Elmer, Branchburg, NJ, USA), H2O 24.8 ␮l, 10× buffer 5 ␮l, MgCl2 15 mm, dNTP 0.2 mm, primer each 0.2 ␮g, and 10 ␮l cDNA. Each round of PCR consisted of 45 cycles of denaturing at 94°C for 30 s and annealing at 60°C for 30 s. At the beginning of each PCR, a 5 min denaturing at 94°C was performed; at the end of the 45 cycles 20 min of extension at 72°C was carried out. Products were examined by electrophoresis on 3% agarose gels. To evaluate the integrity of the isolated RNA, RT-PCR was performed to detect the beta 2 microglobulin gene. Samples were considered to be negative for monoclonal cells only if they were positive for beta 2 microglobulin. IgH RT-PCR assay sensitivity and validation Precautions to eliminate false positive PCR included using separate work areas for pre-PCR and amplification assays, and using filter-containing disposable pipette tips. An established B lymphoblastoid cell line (JY) was used to determine the sensitivity of our PCR.25 Log dilutions of the JY cells (from 106 cells to a single cell) were made with 106 K562 cells, a hematopoietic cell line in which the IgH chain is germline and not rearranged. Following our RT-PCR procedure, visible bands were seen in the 100 JY: 106 K562


dilution, indicating a sensitivity of 0.01%. In each PCR assay, a negative control (cDNA from K562), positive control (cDNA from JY) and water were used. Statistics Descriptive statistics, including the mean, standard deviation, and median, were calculated for each of the variables analyzed. Kaplan–Meier estimates of overall survival and of progression-free survival were plotted. The analysis of covariance (ANCOVA) model explored the joint effects of multiple independent predictors (total mononuclear cells harvested, log-transformed MNC-recovered, MCN-loaded, number of CD34 cells loaded, and releasing agent) on the response variable (log-transformed total count of CD34positive cells recovered). We used ␹2 tests to assess the effectiveness of the peptide releasing agent vs chymopapain, and to investigate the results of the PCR assay.

Results Patient characteristics Eighteen patients with chemotherapy responsive multiple myeloma were enrolled in this study. Clinical characteristics are summarized in Table 1. Eight patients had prior melphalan exposure and 14 patients had received four to seven cycles of vincristine, doxorubicin, and dexamethasone prior to enrollment in the study. Time from diagnosis to the initiation of the transplant procedure was equal to or greater than 1 year in 11 patients. None of these patients’ disease progressed following administration of high-dose cyclophosphamide.

Table 1

Mobilization, collection and selection of CD34+ cells Patients’ PBPC were mobilized using cyclophosphamide and G-CSF. The target number of CD34+ cells for selection and unmanipulated products was achieved by two or less leukaphereses in 12 patients, while six patients required three or more leukaphereses (Table 2). The average time from administering high-dose cyclophosphamide to the initiation of leukapheresis was 13 days (range 9–20). The average peripheral blood white cell count at time of leukapheresis was 23.4 ± 16.6 × 109/l (range 2.5–70). The mean percentage of lymphocytes was 3.71 ± 2.59% and of monocytes was 6.67 ± 2.97%, giving an average of 2.4 ± 1.9 × 109/l mononuclear cells. The average volume of blood processed on each leukapheresis day was 17.92 ± 6.12 l, yielding an average of 4.58 ± 3.10 × 1010 white cells. Device performance Of 30 selections performed, 29 were successful, while one selection was terminated due to significant cell clumping, thought to be related to a high number of neutrophils in the apheresis product on that day. One leukapheresis product with high cell counts was split for two separate selections as per the manufacturer’s recommendations. In 12 patients one selection was performed, while six patients required two to four selections (Table 2). The median number of cells processed was 3.50 × 1010 with a median recovery of 0.81% (Table 3). The median percentage of CD34+ cells in the starting products was 0.58 (0.16–7.73) and in the selected products was 90 (range 29–99). Median CD34+ cell yield was 48% (range 17–78%) (Table 3). The percentage of CD34+ cells was ⬎90% in 51% of the selected products. A median of 5.84 × 106 CD34+ cells/kg were selected (range 3–38 × 106

Patient characteristics

UPN

Age

Sex

Stage

Class

Prior treatment

% Plasma cells-1

% Plasma cells-2

Dx–Txn

1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418

53 51 54 52 42 51 52 55 47 60 65 60 51 61 53 61 58 49

M F M M M M M M F F F M M M F M M M

II III II I III I III III I III II II II III III II II III

IgG␭ IgG␬ IgG␭ IgG␭ NS IgG␭ IgG␬ IgA␬ IgG␭ IgG␬ IgA␬ IgG␭ IgG␬ IgG␬ ␬ IgG␬ IgG␬ IgG␭

VAD VAD MP/VAD MP/XRT/VAD XRT/VAD VAD CHOP/VAD MP/VAD VAD MP/VAD MP MP VAD VAD XRT/VAD MP MD VAD

2 33 13 4 3 18 3 21 6 20 46 40 3 18 1 3 40 8

4 16 11 2 2 4 3 5 3 3 24 3 1 10 1 1 10 11

13 20 8 36 8 19 8 28 8 20 8 8 5 14 12 16 14 12

% Plasma cells-1 = %plasma cells in bone marrow at enrollment; % plasma cells-2 = %plasma cells in bone marrow post-cyclophosphamide mobilization; Dx-Txn = months from diagnosis to transplantation procedure; VAD = vincristine, doxorubicin, and dexamethasone; XRT = local radiotherapy; MP = melphalan, prednisone; MD = melphalan, dexamethasone; CHOP = cyclophosphamide, doxorubicin, vincristine, and prednisone.

959


960

Table 2 Number of aphereses and selections. Results of selections and outcomes UPN

No. No. % PCRb Outcomec Follow- Status/Month aphereses selections CD34a up post-Txn months

1401 1402 1403 1404 1405 1406 1407 1408 1409 1410 1411 1412 1413 1414 1415 1416 1417 1418

4 5 2 4 2 1 2 2 2 3 5 3 1 1 1 2 2 2

3 4 1 2 2 1 1 1 1 2 1* 3 1 1 1 1 1 1

54 76 98 84 68 97 92 81 90 97 31 91 99 99 32 96 99 97

NA + + + + + − − − − + + − − − − − −

NCR PR NR NCR NCR CR NR PR CR CR PR R CR CR CR NCR R NCR

35 23 33 33 33 32 2 9 21 19 19 19 18 18 16 13 13 9

PD/7 PD/6 PD/18 death death PD/15 PD/10 PD/6 PD/12 PD/13

PD/6

a

% CD34 in the infused products. IgH RT-PCR results of the infused products. c Outcome at 1 month post transplantation. CR = complete remission; NCR = near complete remission; PR = partial response; R = response; NR = no response; PD = progressive disease; NA = not available. *First selection performed on the automated device failed secondary to cell clumping, a second selection was completed on the semi-automated device (see text). b

cells/kg). No correlation was found between the number of CD34+ cells loaded on the device and the yield (P = 0.89). In addition, there was no significant difference in recovery of CD34+ cells between the fully automated and the semiautomated systems, with median and range of 36% (25– 78) vs 51% (17–57) respectively (P = 0.91). There was a significant relationship between the use of the peptide releasing agent and CD34+ purity of more than 90% (␹2 test, P = 0.021). The median percentage of CD19+ cells in the starting products was 7.4 (range 0.10–13.10%). Following CD34+ selection, the median percentage of CD19+ cells was 0.14 (range 0.10–0.59%), indicating a 3.0 log depletion of CD19+ cells (Table 3). RT-PCR results We performed RT-PCR to amplify sequences of the variable region of the Ig heavy chain gene to detect up to 100 clonogenic cells per total of 106 cells (0.01%). Adequate Table 3

Total cells CD34+ cells CD19+ cells

samples for analysis of CD34+, CD34−, and preselected products were available for 24 out of 29 products. All the preselected and the CD34− samples were positive by RT-PCR, indicating the presence of clonogenic B cells (Figure 1). Of the CD34+ products, 54% were negative for clonogenic cells by RT-PCR, with a 4 log depletion of the clonogenic B cells (range 2.9–5.1) when a 0.01% value was assigned to negative products. Of the products selected using the peptide releasing agent (n = 15), 65% were negative by RT-PCR. In contrast, 37% were negative by RT-PCR when chymopapain (n = 9) was used as a releasing agent. This difference in clonogenic contamination was statistically significant (␹2 test, P = 0.033). The status of RT-PCR did not correlate with the purity of the product (%CD34 ⬎80) but did correlate with the extent of CD19+ cell depletion (Fisher’s exact test P = 0.031), as shown in Table 4. Although the explanation for this observation is not clear, one possibility is that chymopapain nonspecifically released trapped clonal B cells. Infusion and engraftment of CD34+ cells The median number of CD34+ cells infused per kilogram was 2.91 × 106 (range 1–16.30 × 106 cells/kg). In 13 patients the CD34+ cell dose was equal to or higher than 2 × 106 cells/kg. All infusions were well-tolerated, without significant adverse reaction. The average time to absolute neutrophil count above 0.5 × 109/l was 11 ± 2 days (range 9–14 days). The average time to platelet count above 20 × 109/l without transfusion support in 17 evaluable patients was 15 ± 7 days (range 9–42 days). Thirteen patients required 14 days or less to achieve a sustained platelet recovery, three required 16–19 days, and one patient with prior pulmonary embolus required 42 days. The median number of units of packed red blood cells infused was 4 (range 0–7). Platelets were transfused on a median of three occasions (range 1–12). The four patients in this study who received 1 × 106 CD34+ cells/kg continue to have sustained hematopoietic recovery with more than 19 months of follow-up. Clinical response Of the 18 patients, 11 achieved complete remission or near complete remission (CR, NCR), four achieved partial remission, and three showed no response to this treatment. With a median follow-up of 25 months (9–35 months), the overall, event-free, and progression-free survival rates were 75, 35, and 39%, respectively (Figure 2). Three of four patients with partial response progressed at 6, 7 and 12 months post transplantation (Table 2). In addition, five of

Median mononuclear cells, CD34+ and CD19+ cells loaded and recovered of 29 selections No. loaded cells

No. recovered cells

% Yield/Log depletion

3.50 × 1010 (0.98–7.9) 1.90 × 108 (0.56–32.5) 1.60 × 108 (0.03–3.74)

1.11 × 108 (0.2–9.1) 0.92 × 108 (0.16–13.7) 1.59 × 105 (0.2–31.2)

2.4 log (1.6–3.0) 48% (17–78) 3.0 log (1.9–4.2)


11 patients in CR or NCR progressed at 6–18 months post transplantation. Discussion In this study, we demonstrate in 18 consecutive patients with multiple myeloma the feasibility of using immunomagnetic bead separation to select adequate numbers of CD34+ cells sufficient to achieve rapid hematopoietic recovery after high-dose melphalan. The target number of CD34+ cells was reached using cyclophosphamide and GCSF mobilized peripheral blood progenitor cells with reasonable days of leukapheresis (⭐2 in 78% of subjects) and a moderate volume of blood processed per day (mean 17.9 l). Enrichment for CD34+ cells using immunomagnetic bead separation was possible in all of the products except one. Hematopoietic recovery was rapid and similar to those results reported by other researchers using CD34+ enriched peripheral blood progenitor cells.15,26,27 The median recovery of 48% of CD34+ cells in this study was similar to those rates reported by others (Table 5). In addition, the median purity of 90% was also similar to that observed using the same device in different applications or a different device in the same disease group.15,26 Clonal B cells in the peripheral blood and leukapheresis products are commonly present in patients with varying stages of multiple myeloma and at different points of their 106

106 105 104 103 102 101 100

Standard dilution

Patient product u

− +

u

A

− +

u

B

− +

C

u

−

+ (c+)

D

Figure 1 Results of RT-PCR of the IgH rearrangement of pre- and postselection products. Top panel shows the standard dilution indicating visible band with 102 JY cells and a sensitivity of 0.01%. Bottom panel includes representative samples from four different patients and a positive control (c+). u denotes unselected leukapheresis product, − denotes CD34 negative fraction, and + for CD34-positive samples. A is from patient 1415, B from 1416, C from 1417 and D from patient 1411. Product size ranged between 200 and 300 bp.

treatment. Gertz and colleagues9 have shown that leukapheresis products contained ⭓0.2 × 106 plasma cells/l in more than half of the patients undergoing high-dose therapy. Other researchers have also shown that leukapheresis products collected following chemotherapy, contain from 0.01 to more than 10% myeloma cells.28,29 In addition, in an extended period of leukapheresis, the contamination of products with plasma cells seems to increase in the last days of collection. Gazitt and colleagues, who performed leukapheresis after high-dose cyclophosphamide and GMCSF, reported a similar observation. They showed more than a 2 log increase of myeloma cells in the leukaphereses obtained in the last 2 days of a 6-day collection. It is not clear whether the high-dose cyclophosphamide in combination with growth factor contributed to the mobilization of these clonal B cells. Perhaps this phenomenon can be further elucidated by investigating any alterations in the expression pattern of adhesion molecules on myeloma cells following such therapy. We assessed B cell depletion by two methods: flow cytometric analysis for the presence of CD19+ cells and RTPCR for IgH rearrangement. We achieved a 3.0 log depletion of CD19+ cells using immunomagnetic bead separation. This degree of depletion was similar to that calculated based on the results of RT-PCR for IgH rearrangement. After the positive selection for CD34+ cells, 54% of the selected products were negative for the presence of clonal B cells by RT-PCR. A total of 10 patients in our study received RT-PCR-negative products with a median of 4 log depletion of clonal B cells (range 2.9–5.1), while 41% received products contaminated with clonal B cells. Schiller and colleagues,15 using an avidin-biogel system for CD34+ selection, analyzed leukaphereses and CD34+ selected products using allele-specific oligonucleotides PCR, showing a 2.7–4.5 (median 3) log reduction in tumor contamination. In that study 42% of the leukapheresis products was initially negative. In addition, Schiller et al demonstrated that it is possible to deplete tumor cells beyond detection in selected CD34+ cells from five out of eight patients whose leukaphereses were originally contaminated. Thus, since approximately 40% of the selected products contained clonal cells, additional steps may be required to further reduce this contamination. In theory, this reduction +

1.0

+

+

++

+

Table 4 Result of RT-PCR based on the CD34+ purity or CD19+ contamination of the final products CD19 = 0.1% CD19 ⬎ 0.1% CD34 ⭓ 80% CD34 ⬍ 80% Positive RT-PCR Negative RT-PCR

7

4

8

3

13

0

10

3

Survival

0.8

++

+

++

+

0.6 +

0.4 0.2

OS PFS

0.0

In this table we show RT-PCR results of 24 selected products in relation to % of CD34 and CD19 in these products. The probability by Fisher’s exact test of having a positive PCR was independent of the CD34+ purity (P = 1) while having more than 0.1% CD19+ cells in the selected products was more likely to produce positive PCR (P = 0.031).

0

10

20

30

Months Figure 2 Overall survival (OS) and progression-free survival (PFS) with a median follow-up of 25 months.

961


962

Table 5

Comparison of published studies using enriched CD34+ PBPC in the management of multiple myeloma

Author/(Ref)

Device

No. patients

No. patients selected

No. selection

Schiller15 Gazitt30 Lemoli12 Johnson31 Watts32 Mahe33 Present study

Ceprate Cell sort Ceprate Ceprate Ceprate Ceprate Isolex

37 10 23 8 27 18 18

37 10 10 8 27 11 18

NA 10 NA 9 33 11 29

% CD34 recovery

58 31 52 35 48

47 40 (33–95) (21–38) (8–107) (14–64) (17–78)

% CD34 purity

No. positive preselection

No. positive post selection

Assay

Log depletion

77 (27–91) 88 90 (51–94) 49 (18–98) 69 (6–93) 72 (46–87) 90 (29–99)

8/14 10 10* 2/7 NA NA 17/17

3/8 NA 5 0.7 NA NA 7/17

ASO-PCR ASO-PCR IgH PCR IgH PCR NA NA IgH RT-PCR

3 (2.7–4.5) 5 (2.7–7.5) 2.5–3* 3–4 NA NA 4 (2.9–5.1)

ASO-PCR = allele-specific oligonucleotides PCR; IgH PCR = amplification of the rearranged Ig heavy chain; NA = not available; * = analysis based on flow cytometry results.

may be accomplished by combining a positive selection for CD34+ and negative selection for myeloma cells bearing such antigens as CD38+/CD45−, CD22+, or CD19+. It has been shown by Gertz et al that the increased number of monoclonal plasma cells in blood stem cell harvests was associated with shortened relapse-free survival.9 Thus, eliminating monoclonal plasma cells from the infused products may prolong relapse-free survival. In our study the progression-free survival rate was 40% with a median follow-up of 25 months, similar to results reported by Schiller et al27 using CD34+ enriched products. The impact of transplanting stem cell products contaminated with tumor cells can be addressed through gene marking studies or larger randomized studies. Immunomagnetic-based CD34+ enrichment of peripheral blood progenitor cells collected in patients with multiple myeloma was feasible in this single institution study with limited numbers of leukaphereses. The infusion of CD34+ selected products was safe and led to prompt hematopoietic recovery. The benefit of the deletion of clonal cells on disease progression is yet to be determined.

5 6

7

8

9 10

Acknowledgements 11 This work was supported in part by a Center of Excellence in Molecular Hematology grant (P50 DK49218) and by American Cancer Society grant (CRTG-97–042-EDT). R Abonour is the recipient of a CAP award from the National Centers for Research Resources (NIH M01 RR00750). We thank the Indiana University Stem Cell Laboratory, apheresis and BMT unit staff for excellent technical and clinical care. We also thank Beth Mann and Tess Weather for their invaluable assistance in data collection, and Jean Good for assistance in manuscript preparation.

References 1 Barlogie B, Jagannath S, Epstein J et al. Biology and therapy of multiple myeloma in 1996. Semin Hematol 1997; 34 (Suppl. 1): 67–72. 2 Gahrton G. Bone marrow and peripheral blood stem cell transplantation in multiple myeloma. Ann Oncol 1997; 8: 219–221. 3 Jagannath S, Tricot G, Barlogie B. Autotransplants in multiple myeloma: pushing the envelope. Hematol Oncol Clin N Am 1997; 11: 363–381. 4 Attal M, Harousseau JL, Stoppa AM et al. A prospective, ran-

12

13 14

15

16

domized trial of autologous bone marrow transplantation and chemotherapy in multiple myeloma. Intergroupe Francais du Myelome. New Engl J Med 1996; 335: 91–97. Cunningham D, Paz-Ares L, Gore ME et al. High-dose melphalan for multiple myeloma: long-term follow-up data. J Clin Oncol 1994; 12: 764–768. Harousseau JL, Attal M, Divine M et al. Autologous stem cell transplantation after first remission induction treatment in multiple myeloma: a report of the French Registry on autologous transplantation in multiple myeloma. Blood 1995; 85: 3077–3085. Fermand JP, Chevret S, Ravaud P et al. High dose chemoradiotherapy and autologous blood stem cell transplantation in multiple myeloma: results of a phase II trial involving 63 patients. Blood 1993; 82: 2005–2009. Gertz MA, Witzig TE, Pineda AA et al. Monoclonal plasma cells in the blood stem cell harvest from patients with multiple myeloma are associated with shortened relapse-free survival after transplantation. Bone Marrow Transplant 1997; 19: 337–342. Gazitt Y, Reading CL. Autologous transplantation with tumorfree graft: a model for multiple myeloma patients (review). Leuk Lymphoma 1996; 23: 203–212. Craig JI, Langlands K, Parker AC et al. Molecular detection of tumor contamination in peripheral blood stem cell harvests. Exp Hematol 1994; 22: 898–902. Vescio RA, Han EJ, Schiller GJ et al. Quantitative comparison of multiple myeloma tumor contamination in bone marrow harvest and leukapheresis autografts. Bone Marrow Transplant 1996; 18: 103–110. Lemoli RM, Fortuna A, Motta MR et al. Concomitant mobilization of plasma cells and hematopoietic progenitors into peripheral blood of multiple myeloma patients: positive selection and transplantation of enriched CD34+ cells to remove circulating tumor cells. Blood 1996; 87: 1625–1634. Chen BJ, Epstein J. Circulating clonal lymphocytes in myeloma constitute a minor subpopulation of B cells. Blood 1996; 87: 1972–1976. Fruehauf S, Haas R, Zeller WJ et al. CD34 selection for purging in multiple myeloma and analysis of CD34+ B cell precursors. Stem Cells 1994; 12: 95–102. Schiller G, Vescio R, Freytes C et al. Transplantation of CD34+ peripheral blood progenitor cells after high-dose chemotherapy for patients with advanced multiple myeloma. Blood 1995; 86: 390–397. Reece DE, Barnett MJ, Connors JM et al. Treatment of multiple myeloma with intensive chemotherapy followed by autologous BMT using marrow purged with 4-hydroperoxycyclophosphamide. Bone Marrow Transplant 1993; 11: 139–146.


17 Anderson KC, Andersen J, Soiffer R et al. Monoclonal antibody-purged bone marrow transplantation therapy for multiple myeloma. Blood 1993; 82: 2568–2576. 18 Vescio R, Hong CH, Cao J et al. The hematopoietic stem cell antigen, CD34, is not expressed on the malignant cells in multiple myeloma. Blood 1994; 84: 3283–3290. 19 Willems P, Crookewit A, Raymakers R et al. CD34 selection from myeloma peripheral blood cell autografts contain residual tumor cells due to impurity not to CD34+ myeloma cells. Br J Haematol 1996; 93: 613–622. 20 Durie BGM, Salmon SE. A clinical staging system for multiple myeloma: correlation of measured myeloma cell mass with presenting clinical features, response to treatment and survival. Cancer 1975; 36: 842–854. 21 Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Ann Biochem 1987; 162: 156–159. 22 Ralph QM, Brisco MJ, Joshua DE, et al. Advancement of multiple myeloma from diagnosis through plateau phase to progression does not involve a new B-cell clone: evidence from the Ig heavy chain gene. Blood 1993; 82: 202–206. 23 Ramasamy I, Brisco M, Morley A. Improved PCR method for detecting monoclonal immunoglobulin heavy chain rearrangement in B cell neoplasms. J Clin Path 1992; 45: 770–775. 24 Trainor KJ, Brisco MJ, Story CJ et al. Monoclonality in Blymphoproliferative disorders detected at the DNA level. Blood 1990; 75: 2220–2222. 25 Rozans MK, Smith BR, Emerson S et al. Functional assessment of T cell depletion from bone marrow prior to therapeutic transplant using limiting dilution culture methods. Transplantation 1986; 42: 380–387.

26 Cornetta K, Gharpure V, Mills B et al. Rapid engraftment after allogeneic transplantation using CD34-enriched marrow cells. Bone Marrow Transplant 1998; 21: 65–71. 27 Schiller G, Vescio R, Freytes C et al. Autologous CD34-selected blood progenitor cell transplants for patients with advanced multiple myeloma. Bone Marrow Transplant 1998; 21: 141–145. 28 Gazitt Y, Tian E, Barlogie B et al. Differential mobilization of myeloma cells and normal hematopoietic stem cells in multiple myeloma after treatment with cyclophosphamide and granulocyte–macrophage colony-stimulating factor. Blood 1996; 87: 805–811. 29 Lemoli RM, Cavo M, Fortuna A et al. Concomitant mobilization of plasma cells and hematopoietic progenitors into peripheral blood of patients with multiple myeloma. J Hematother 1996; 5: 339–349. 30 Gazitt Y, Reading CC, Hoffman R et al. Purified CD34+ Lin− Thy+ stem cells do not contain clonal myeloma cells. Blood 1995; 86: 381–389. 31 Johnson RJ, Owen RG, Smith GM et al. Peripheral blood stem cell transplantation in myeloma using CD34 selected cells. Bone Marrow Transplantation 1996; 17: 723–727. 32 Watts MJ, Sullivan AM, Ings SJ et al. Evaluation of clinical scale CD34+ cell purification: experience of 71 immunoaffinity column procedures. Bone Marrow Transplant 1997; 20: 157–162. 33 Mahe B, Milpied N, Hermouet S et al. G-CSF alone mobilizes sufficient peripheral blood CD34+ cells for positive selection in newly diagnosed patients with myeloma. Br J Haematol 1996; 92: 263–268.

963