Bioaccumulation of Arsenic in Recombinant Escherichia coli

Biotechnology and Bioprocess Engineering 2009, 14: 565-570 DOI/10.1007/s12257-008-0197-y

Bioaccumulation of Arsenic in Recombinant Escherichia coli Expressing Human Metallothionein =

Yu-Jie Su1,2, Jian-Qun Lin1*, Jian-Qiang Lin1*, and Dong-Hui Hao1 1

State Key Lab of Microbial Technology, Shandong University, Jinan 250-100, China Qingdao Institute of BioEnergy and Bioprocess Technology, Chinese Academy of Sciences, Qingdao 266-071, China

=

2

Abstract The recombinant bëÅÜÉêáÅÜá~=Åçäá (bK=Åçäá) expressing human hepatic metallothionein_IA (hMT_IA) was constructed for bioaccumulation of Arsenic (As). The gene sequence of hMT_IA was modified for codon preference of bK=Åçäá and synthesized using chemical method. The vector of pGEX_4T_1 was used=and hMT_IA was expressed as the fusion protein with glutathione S-transferase (GST) tag. The bioaccumulation capability of arsenite compounds As(III) of the recombinant bK=Åçäá increased more than 3-fold from 76.3 to 319.6 µg/g dry cells compared with the control. The conditions of 50 µM of As(III) and low pHs were optimal for As(III) bioaccumulation. The heavy metals of Cd, Hg, and Zn inhibited As(III) bioaccumulation. The bioaccumulation reached 70% of the saturated value within 1 h. The recombinant bK=Åçäá will be useful in bioremediation of arsenic or other kinds of heavy metal contaminated water. © KSBB hÉóïçêÇëW=ãÉí~ääçíÜáçåÉáå, ~êëÉåáÅ, Äáç~ÅÅìãìä~íáçå, ÄáçêÉãÉÇá~íáçå, ÜÉ~îó=ãÉí~ä=

INTRODUCTION Arsenic (As) is one of the major heavy metal pollutants. It enters the environment primarily from geochemical sources, such as the mining of arsenopyrite gold ores [1], which constitute about one-third of world gold reserves [2], metallurgy industry [3], and combustion of arsenic bearing coal [4]. Arsenic is a potent gene and chromosomal mutagen [5], able to generate intercellular oxidative DNA damage [6], cause many diseases including vascular diseases, diabetes, and cancers, specifically cancers of the skin, lung, bladder, kidney, and liver [7]. The toxicity of arsenic depends on its oxidation state and its speciation. Inorganic species of arsenic are the most toxic. Arsenite compounds As(III) are reported to be 20∼100 times more toxic than arsenate compounds As(V) in marine environment [8] and 60 times more toxic in human beings [9]. The current technologies for As removal are chemical methods such as coagulation and ion exchange [10,11] et al., which need addition of chemicals or strict conditions [2]. Biological method has many advantages over the chemical ones *Corresponding authors Tel: +86-531-88364429 Fax: +86-531-88565610 e-mail: [email protected] Tel: +86-531-88364429 Fax: +86-531-88565610 e-mail: [email protected]

in the aspects of environmental friendliness, ease in applica tion, and cost reduction. The conventional biological methods utilize the wild type microbial cells to remove heavy metals by cell surface adsorption and intracellular binding [12]. Surface adsorption is made by the functional groups such as -NH2, -COOH, -SH, and -OH on microbial cell walls [13]. After the metals being transported into the cells, they can bind to the functional groups of the intracellular native molecules. The intracellular accumulation of the metal irons of Ni, Cd, Pb, Ag, Co, Cu, Zn, and Mn by microbial cells were reported [12], but rare reports for As. The binding capacity and especially the binding affinity of the wild type microorganisms are not high enough. Recent researches have focused on the development of biomaterials with increased affinity and capacity for target heavy metals [14,15]. Metallothioneins (MTs) are a family of low molecular weight, cysteine-rich, and metal-binding proteins [16]. MTs exist widely in a variety of organisms of yeasts and mammalians [16]. MTs are generally considered being responsible for heavy metal detoxification and are essential for metal metabolism in eukaryotes. Compared with conventional biosorbents, MTs have high binding affinity with many kinds of heavy metals. This characteristic makes MTs especially useful in removing low level heavy metals, for example, in drinking water. The maximum concentration of arsenic in drinking water recommended by the World Health Organization is 10

566

μg/L, which is below the low limit for most conventional sorbents [17]. In this paper, recombinant E. coli producing human MT will be constructed for bioremoval of As.

MATERIALS AND METHODS Strain, Plasmids, Medium, and Cultivation Conditions

E. coli JM109 (recA1, supE44, endA1, hsdR17, gyrA96, relA1, thi, Δ(lac-proAB) )′ (traD36, proAB+, lacIq, laclΔM15)) [18]; plasmid pGEX_4T_1, which contains glutathione Stransferase (GST) gene, expresses the aim protein in fusion with the 26 kD GST under the induction of β-D-thiogalactopyranoside (IPTG); and plasmid pGHM (constructed in this study) were used. MJS medium contained: ethanesulfonic acid (HEPES), 12.5 mM (pH 7.1); NaCl, 50 mM; NH4Cl, 20 mM; KCl, 1 mM; MgCl2, 1 mM; CaCl2, 0.1 mM; MnCl2, 0.05 mM; Casamino Acid, 0.8%; glycerol(C3H8O3), 0.4%; and vitamin B1, 0.0005% [19]. LB medium contained (g/L): peptone, 0.5; yeast extract, 1.0; and NaCl, 1.0. The cultivation was performed in 100 mL of flasks containing 20 mL of the medium, inoculated with 200 μL of seed culture broth, cultivated at 37oC, shaken at 200 rpm. Ampicillin (Amp) of the final concentration of 100 µg/mL was supplemented in cultivating the recombinant strain. The bioaccumulation experiment of arsenite compounds As(III) was performed using MJS medium with the cultivation conditions as described above. When OD600 reached 0.5, IPTG and NaAsO2 were added to the final concentrations of 1 mM and 50 μmol/L, respectively, and further cultivated for 3 h for the bioaccumulation. Chemical Synthesis of Human Hepatic MT Gene

The DNA sequence of human MT was commercially synthesized based on the amino acid sequence of hMT_IA reported in Genbank. Some rare codons for E. coli were changed to E. coli common codons. The synthesized DNA sequence was shown in the following, with the modified codons marked in the darks. GATCGGATCCATGGACCCGAACTGCTCCTGCGCT ACTGGTGGCTCCTGCACTTGCACTGGCTCCTGCAAA TGCAAAGAATGCAAATGCAACTCCTGCAAAAAAAG CTGCTGCTCCTGCTGCCCGATGAGCTGTGCTAAATG TGCTCAGGGCTGCATCTGCAAAGGTGCATCCGAAA AATGCAGCTGCTGTGCTTGACACCACCACCACCACC ACGAATTCGTCGACGATC The original codons of the modifications marked darkly in the above DNA sequence were CCC, GCC, ACC, GAG, AAGAAG, CCC, GCCAAG, GCC, GGG, TCAGAGAAG, and GCC, respectively. BamH I cutting site in the N-terminal and EcoR I and Sal I cutting sites in the C-terminal were added.

Fig. 1. Gel electrophoresis analysis of pGHM. A, bK=Åçäá (pGHM); B, bK=Åçäá (pGEX-4T-1); and C, Marker DL2000.

Analytical Methods

SDS-PAGE analysis of proteins was carried out according to the reference [20]. Plasmid purification was done using Plasmid Purification Kit (Takara, Japan). Analyses of bioaccumulated As, Cd, and Zn were done as follows. The samples of cultivation broth were centrifuged to obtain cell sediment, washed twice using 5 mM of HEPES solution containing 0.85% of NaCl, lyophilized, and treated overnight using 4 mL of 70% nitric acid for cell disruption. The disrupted cells were then properly diluted for further measurements. To prevent metal contamination, all glassware was soaked in 20% nitric acid overnight and rinsed three times using deionized water before complete drying. The concentration of As was measured using A)S-820 type atomic fluorescence spectrometer (Beijing Jida Instrument Co., China). The concentrations of Cd and Zn were measured using Inductively Coupled Plasma Optical Emission Spectrometry (IRIS Intrepid II XSP, Thermo Electron Co., USA). The concentration of Hg was measured using PE600 type atomic absorption spectrophotometer (Perkin Elmer Co., USA). All experiments were in triplicates.

RESULTS AND DISCUSSION Vector Construction for MT Expression

The synthesized DNA sequence was digested using BamH I and Sal I, inserted into the vector of pGEX-4T-1, which was digested using the same restriction enzymes to construct the plasmid of pGHM with the length of 5182 bp. pGHM was then transformed into E. coli to build E. coli (pGHM). The plasmid of E. coli (pGHM) was extracted, purified, and then digested using BamH I and Sal I, respectively, and analyzed

Biotechnol. Bioprocess Eng. 567=

Fig. 2. SDS_page electrophoresis analysis of MT. A, bK=Åçäá; B, bK= Åçäá (pGEX-4T-1); C,=bK=Åçäá (pGHM); and D, Protein molecular weight marker.

using 2% agarose gel electrophoresis (Fig. 1). Fig. 1 showed that pGHM contained a segment of 230 bp, which was the same size as the inserted DNA segment. Sequence determina tion of pGHM was also made and further confirmed the correctness of pGHM construct. E. coli (pGHM) was inoculated and cultivated in ampicillin containing liquid LB medium. IPTG was added to the final concentration of 1.0 mM when OD600 of the culture broth reached 0.5, and then further incubated for 3 h under induction. After the cultivation, the cells were collected and the intracellular proteins were analyzed using SDS-PAGE electrophoresis (Fig. 2). A control of E. coli (pGEX) was also made, treated with the same operations with E. coli (pGHM). The control had an intracellular protein band with the molecular weight of 26 kDa, which was the same with that of GST (Fig. 2). Compared with the control, E. coli (pGHM) had an extra intracellular protein band with a molecular weight of 33 kDa (Fig. 2). The plasmid pGEX_4T_1 is a fusion protein expression plasmid, with the aim protein expressed in fusion with GST as described in materials and methods. The protein sizes of hMT_IA and GST were 7 and 26 kDa, respectively. Therefore, the size of the fusion should be 33 kDa (7 kDa + 26 kDa). Fig. 2 showed that the intracellular proteins of E. coli (pGHM) had an extra band of 33 kDa compared with the control. It confirmed that human MT (hMT_IA) was expressed in E. coli (pGHM) in the fusion. Bioaccumulation of As(III) in bKÅçäá=(pGHM) Under Various Conditions

The experiments of bioaccumulation of As(III) were done using E. coli (pGHM), with E. coli (pGEX) as the control. After the bioaccumulation, the cells were harvested and the bioaccumulated arsenic was measured (Fig. 3). The bioaccumulating capacity of E. coli (pGHM) increased more than 3 times, from 76.3 to 319.6 μg/g dry cells, compared with the control (Fig. 3).

Fig. 3. Bioaccumulation of As by bK=Åçäá=(pGHM).

MTs are distributed widely in nature, in species ranging from single-cell organisms to human. Twenty of the approximately 60 amino acids in mammalian MTs are cysteines. There are no α-helix and β-collapse in MTs, which confers MTs the stabilized structure, resistance to heat, and proteolytic digestion. The cysteines-to-metals chelation makes the MT molecule organize into two separate domains called α and β domains linked by a short peptide, Lys-Lys-Ser [21]. MT molecule contains 20 cysteine residues and each As(III) is able to bind with three cysteine residues, therefore, the maximum number of As(III) that can be bound to a MT molecule is six. The forms of the MT-As1 to MT-As6 complexes are determined by the concentrations of As(III) and MT in the solution [22,23]. Arsenic reacts with protein sulphydryl groups and has high affinity with MTs, as the result, MTs can effectively protect cells from toxicity [24]. The optimal As(III) concentration for bioaccumulation using E. coli (pGHM) was investigated as described in materials and methods, except that the final NaAsO2 concentrations of 10, 50, 100, and 200 μmol/L, respectively, were used. The result showed that the optimal As(III) concentration was 50 μmol/L (Fig. 4). The bioaccumulation increased with the increase of As(III) concentration until 50 μmol/L, while, decreased over 50 μmol/L (Fig 4). At high concentrations, As(III) is much toxic and interrupts with MT synthesis. It was reported that arsenic concentration in many primarily disposed industrial waste water was between 30∼50 μmol/L [25]. It showed that E. coli (pGHM) developed in this study had potential in real applications of bioremoval of arsenic in waste water. The time length for As(III) bioaccumulation of E. coli (pGHM) was investigated using the method as described in materials and methods, except that after the addition of IPTG and NaAsO2, the cultivations were made for 10 min, 30 min, 1 h, and 2 h, respectively (Fig. 5). As shown in Fig. 5, As(III) bioaccumulation increased fast enough to reach 70% of the saturated value within 1 h and reach 93% of the saturated

568

Fig. 4. Effect of As(III) concentration on the bioaccumulation.

Fig. 5. Time course of As(III) bioaccumulation.

value at 2 h. The time length contained the time lengths for gene induction, MT biosynthesis, As(III) transportation into the cells, and binding to the MTs. The biological processes of gene induction and MT synthesis take longer time than the physical processes of As(III) transportation and binding. In real application, MT is synthesized during cell cultivation period and then the recombinant cells are used in arsenic bioremoval, which can reduce the time length to a great extent in As(III) removing. The rapid bioaccumulation speed makes the bioremediation process more practical. The optimal pH for As(III) bioaccumulation of E. coli (pGHM) was investigated. E. coli (pGHM) was cultivated in MJS media, induced by 1 mM of IPTG for 3 h. Then, the cells were harvested, transferred into the phosphate buffers of vari ous pHs of 3, 5, 7, 9, and 11, respectively, that contained NaAsO2 of the final concentration of 50 µmol/L, cultivated at 37oC, 200 rpm for 1 h. The pH was adjusted using 10 M NaOH or HCl. After the cultivation, the cells were harvested and the amount of bioaccumulated arsenic was measured (Fig.

Fig. 6. Effect of pH on As(III) bioaccumulation.

6). The results showed that the bioaccumulation decreased linearly from 400 to 12.8 µg/g dry cells with the increase of pH from 3 to 11 (Fig. 6). pH greatly influences the integration of the metals into MT. The results in this study indicated that acidic conditions were in favor of As(III) integration (Fig. 6). As the growth of E. coli is strongly inhibited in low pH, the pHs lower than 3 are not used in this research. A series of recombinant arsenic resistant bacterium of obligately chemlithotrophic have been constructed in our lab [18,26,27]. Coexpression of both MT and arsenic resistant genes in obligately chemlithotrophic bacterial strains other than E. coli will be done for the applications in removing heavy metals in extremely acidic, arsenic rich waste water from biomining industry. In prokaryotes and unicellular eukaryotes, arsenate As(V) and arsenite As(III) enter the cell through phosphate (Pi) transporters and aquaglyceroporins, respectively [28]. The MT expressed inside the recombinant E. coli cells provides the extra binding sites for the intracellular arsenic. On the other hand, expressing MT on the outer membrane of the bacterium is in favor of cell growth and other physiological functions. Besides, it needs no trans-membrane transportation of the heavy metals. Expression of MT in E.coli as fusions to membrane proteins was reported on Cd bioaccumulation [29,30]. A more than 5 fold increase of Cd binding capacity was obtained [31]. Competitions of Other Heavy Metals with As(III) in Bioaccumulation

The competing effects among As, Hg, Cd, and Zn in the bioaccumulation of E. coli (pGHM) were investigated using the same method as described in materials and methods, except that the mixture of 1 µmol/L of NaAsO2, HgCl2, CdCl2, and ZnCl2, respectively, was used instead of 50 µmol/L of NaAsO2. Then, the cells were harvested and the bioaccumulated heavy metals were measured (Fig. 7). The results showed that recombinant hMT-I expressed in E.

Biotechnol. Bioprocess Eng. 569=

Table 1. Comparison of As(III) uptake by wild type and gene engineered bacteria

Wild type Engineered

Strain

pH

Time

Absorbed As(III) per gram of dried cells (μg/g)

Reference

j~êáåçãçå~ë=Åçããìåáë=

Natural pH

2∼3 day

119

[35]

Sulphate-reducing bacteria

2.0

24 h

200

[36]

bK=Åçäá=expressing ArsR

7.4

1h

165

[2]

bK=Åçäá=expressing human metallothionein

3.0

1h

400

This study

resistant gene (ArsR), which could specifically bind to As(III) [2]. However, the accumulated As(III) was only 102.2 µg/g dry cells [2], which was much lower than the value obtained in this study of 319.6 µg/g dry cells. Some results of As(III) bioremoval using the wild type or engineered bacteria strains were showed in Table 1.

CONCLUSION

Fig. 7. Relative mol ratios of the bioaccumulated heavy metals of As(III), Hg, Cd, and Zn.

coli (pGHM) had the highest affinity to Hg, while the lowest affinity to As(III) among the tested four heavy metals (Fig. 7). The binding of MT with heavy metals was not specific and the binding capability of different heavy metals was related to the equilibrium constants of the thermodynamics and kinetics. As shown in Fig. 6, pH has great effects on As(III) bioaccumulation. The medium pH of 7.1 was used in the experiments (Fig. 7), in which the pH value was reported optimal for bioaccumulation of Cd and Zn [32]. While the bioaccumulation of As(III) at pH 7.1 is only half of the maxima (Fig. 6). It was reported that Zn and Cd combined to MT at pH 6, while Zn disconnected at pH 4.5, and Cd disconnected at pH 2.0 [33]. pH is the major reason affecting the affinities of the tested heavy metals binding to MT. pH variation of waste water often affects the metal clean-up process. High pH may result in the formation of stable metal complexes, e.g. hydroxides, oxides, and carbonates, making the heavy metals less available to biosorbents. Low pH may increase the mobility of heavy metals and therefore may enhance their availability [25]. However, Cd and Zn accumulation was decreased under acidic condition [25,33]. pH was reported to have no significant effect on the expressions of both MT and Hg2+ transport system in bacterium [25]. The affinity and selectivity of Hg of recombinant E. coli expressing both MT and Hg2+ transport system were unaffected by Na+, Ka+, Mg2+, and Cd2+ [34]. High affinity and selectivity towards As(III) was obtained using the recombinant E. coli over expressing the regulator protein of arsenic

By the way of recombinant gene technology, to enhance the bioaccumulation ability of bacteria cells, is effective in removing heavy metals from the environment [31]. In this study, As(III) bioaccumulation of E. coli (pGHM) increased more than 3 times compared with the control. The recombinant strain is potential in bioremediation. Acknowledgments This work was supported by the National Basic Research Program (2004CB619202, 2010CB630 902) and the National High Technology Research and Development Program (2007AA06A407) of China.

Received September 12, 2008; August 7, 2009

REFERENCES 1. Macy, J. M., K. Nunan, K. D. Hagen, D. R. Dixon, P. J. Harbour, M. Cahill, and L. I. Sly (1996) Chrysiogenes arsenatis gen. nov., sp. nov., a new arsenate-respiring bacterium isolated from gold mine wastewater. Int. J. Syst. Bacteriol. 46: 1153-1157. 2. Kostal, J., R. Yang, C. H. Wu, A. Mulchandani, and W. Chen (2004) Enhanced arsenic accumulation in engineered bacterial cells expressing ArsR. Appl. Environ. Microbiol. 70: 4582-4587. 3. Han, F. X., Y. Su, D. L. Monts, M. J. Plodinec, A. Banin, and G. E. Triplett (2003) Assessment of global industrialage anthropogenic arsenic contamination. Naturwissenschaften. 90: 395-401. 4. Merrifield, M. E., T. Ngu, and M. J. Stillman (2004) Arsenic binding to Fucus vesiculosus metallothionein. Biochem. Biophys. Res. Commun. 324: 127-132. 5. Kessel, M., S. X. Liu, A. Xu, R. Santella, and T. K. Hei (2002) Arsenic induces oxidative DNA damage in mammalian cells. Mol. Cell. Biochem. 234-235: 301-308.

570

6. Ninomiya, M., T. Kajiguchi, K. Yamamoto, T. Kinoshita, N. Emi, and T. Naoe (2006) Increased oxidative DNA products in patients with acute promyelocytic leukemia during arsenic therapy. Haematologica. 91: 1571-1572. 7. Karagas, M. R., T. D. Tosteson, J. Blum, J. S. Morris, J. A. Baron, and B. Klaue (1998) Design of an epidemiologic study of drinking water arsenic exposure and skin and bladder cancer risk in a U.S. population. Environ. Health Perspect. 106: 1047-1050. 8. Neff, J. M. (1997) Ecotoxicology of arsenic in the marine environment. Environ. Toxicol. Chem.16: 917-927. 9. Ferguson, J. F. and J. Gavis (1972) A review of the arsenic cycle in natural water. Water Res. 6: 1259-1274. 10. Katsoyiannis, I., A. Zouboulis, H. Althoff, and H. Bartel (2002) As(III) removal from groundwaters using fixedbed upflow bioreactors. Chemosphere 47: 325-332. 11. Zhang, Q. L., N. Y. Gao, Y. C. Lin, B. Xu, and L. S. Le (2007) Removal of arsenic(V) from aqueous solutions using iron-oxide-coated modified activated carbon. Water Environ. Res. 79: 931-936. 12. Malik, A. (2004) Metal bioremediation through growing cells. Environ. Int. 30: 261-278. 13. Kuyucak, N. and B. Volesky (1988) Biosorbents for recovery of metals from industrial solutions. Biotechnol. Lett. 10: 137-142. 14. Gadd, G. M. (1990) Metaltolerance. pp. 178-210. In C. Edwards (eds.). Microbiology of extreme environments. McGraw-Hill, NY, USA. 15. Gadd, G. M. and C. White (1993) Microbial treatment of metal pollution-a working biotechnology? Trends Biotechnol. 11: 353-359. 16. Hamer, D. H. (1986) Metallothionein. Annu. Rev. Biochem. 55: 913-951. 17. Kapoor, A. and T. Viraraghavan (1995) Fungal biosorption- an alternative treatment option for heavy metal bearing wastewaters: a review. Bioresour. Technol. 53: 195-206. 18. Yanish-Perron, C., J. Vieira, and J. Messing (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mp18 and pUC19 vectors. Gene. 33: 103-119. 19. Zhao, Q., X. M. Liu, Y. Zhan, J. Q. Lin, W. M. Yan, J. Bian, and Y. Liu (2005) Construction of an engineered Acidithiobacillus caldus with high-efficiency arsenic resistance. Wei Sheng Wu Xue Bao. 45: 675-679. 20. Sambrook, J. and D. W. Russell (2001) Molecular Cloning: A Laboratory Manual. 3rd ed., pp. 1175-1182. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA. 21. Ru, B. G., A. H. Pan, B. Q. Huang, and J. Y. Zhang (1991) Metallothionein. Adv. Biochem. Biophys. 4: 254259, 289. 22. Jiang, G., Z. Gong, X. F. Li, W. R. Cullen, and X. C. Le (2003) Interaction of trivalent arsenicals with metallothionein. Chem. Res. Toxicol. 16: 873-880. 23. Duncan, K. E. R., T. T. Ngu, J. Chan, M. T. Salgado, M.

E. Merrifield, and M. J. Stillman (2006) Peptide folding, metal-binding mechanisms, and binding site structures in metallothioneins. Exp. Biol. Med. 231: 1488-1499. 24. Liu, J., Y. Liu, R. A. Goyer, W. Achanzar, and M. P. Waalkes (2000) Metallothionein-I/II null mice are more sensitive than wild-type mice to the hepatotoxic and nephrotoxic effects of chronic oral or injected inorganic arsenicals. Toxicol. Sci. 55: 460-467. 25. Chen, S. and D. B. Wilson (1997) Genetic engineering of bacteria and their potential for Hg2+ bioremediation. Biodegradation 8: 97-103. 26. Tian, K. L., J. Q. Lin, X. M. Liu, Y. Liu, C. K. Zhang, and W. M. Yan (2003) Conversion of an obligate autotrophic bacteria to heterotrophic growth: expression of a heterogeneous phosphofructokinase gene in the chemolithotroph Acidithiobacillus thiooxidans. Biotechnol. Lett. 25: 749-754. 27. Lin, J. Q., J. B. Peng, and W. M. Yan (2001) Progress of the studies on gene transfer system of Thiobacillus Ferrooxidans. Chinese J. Appl. Environ. Biology 193-196. 28. Tripathi, R. D., S. Srivastava, S. Mishra, N. Singh, R. Tuli, D. K. Gupta, and F. J. M. Maathuis (2007) Arsenic hazards: strategies for tolerance and remediation by plants. Trends Biotechnol. 25: 158-165. 29. Valls, M., R. Gonzalez-Duarte, S. Atrian, and V. De Lorenzo (1998) Bioaccumulation of heavy metals with protein fusions of metallothionein to bacterial OMPs. Biochimie. 80: 855-861. 30. Kao, W. C., Y. P. Chiu, C. C. Chang, and J. S. Chang (2006) Localization Effect on the Metal Biosorption Capability of Recombinant Mammalian and Fish Metallothioneins in Escherichia coli. Biotechnol. Prog. 22: 1256-1264. 31. Bae, W., A. Mulchandani, and W. Chen (2002) Cell surface display of synthetic phytochelatins using ice nucleation protein for enhanced heavy metal bioaccumulation. J. Inorg. Biochem. 88: 223-227. 32. Kim, S. K., B. S. Lee, D. B. Wilson, and E. K. Kim (2005) Selective cadmium accumulation using recombinant Escherichia coli. J. Biosci. Bioeng. 99: 109-114. 33. Xiong, Y. and B. Ru (1997) Purification and characteristics of recombinant mouse metallothionein-I from Escherichia coli. J. Biochem. 121: 1102-1106. 34. Chen, S. and D. B. Wilson (1997) Construction and characterization of Escherichia coli genetically engineered for bioremediation of Hg(2+)-contaminated environments. Appl. Environ. Microbiol. 63: 2442-2445. 35. Takeuchi, M., H. Kawahata, L. P. Gupta, N. Kita, Y. Morishita, Y. Ono, and T. Komai (2007) Arsenic resistance and removal by marine and non-marine bacteria. J. Biotechnol. 127: 434-442. 36. Teclu, D., G. Tivchev, M. Laing, and M. Wallis (2008) Bioremoval of arsenic species from contaminated waters by sulphate-reducing bacteria. Water Res. 42: 4885-4893.