Biochemistry and Molecular Biology Education Journal

Biochemistry and Molecular Biology Education Journal Copy of e-mail Notification

Biochemistry and Molecular Biology Education Published by John Wiley & Sons, Inc. Dear Author, Your article page proofs for Biochemistry and Molecular Biology Education are ready for review. John Wiley & Sons has made this article available to you online for faster, more efficient editing. Please follow the instructions below and you will be able to access a PDF version of your article as well as relevant accompanying paperwork. First, make sure you have a copy of Adobe Acrobat Reader software to read these files. This is free software and is available for user downloading at (http://www.adobe.com/products/acrobat/readstep.html). Open your web browser, and enter the following web address: http://115.111.50.156/jw/retrieval.aspx?pwd=e775ab1feba8 You will be prompted to log in, and asked for a password. Your login name will be your email address, and your password will be e775ab1feba8 Example: Login: your e-mail address Password: e775ab1feba8 The site contains 1 file. In order to speed the proofing process, we strongly encourage authors to correct proofs by annotating PDF files. Please see the Instructions on the Annotation of PDF files included with your page proofs. Please take care to answer all queries on the last page of the PDF proof; proofread any tables and equations carefully; and check that any Greek characters (especially "mu") have converted correctly. Please read your figure legends carefully. This file contains: Author Instructions Checklist Instructions on the Annotation of PDF Files Reprint Order Information Copyright Transfer Agreement Color Reproduction Charge Form A copy of your page proofs for your article Within 48 hours, please return your annotated PDF with corrections and comments, and the color form, as applicable, to the following email address: [email protected]

Biochemistry and Molecular Biology Education Journal Copy of e-mail Notification

PLEASE ALWAYS INCLUDE YOUR ARTICLE NO. (BAMBED-12-0134.R1) WITH ALL CORRESPONDENCE. Your article will be published online via our EarlyView service after correction receipt. Your prompt attention to and return of page proofs is crucial to faster publication of your work. Thank you for your cooperation. If you have any questions, please contact: Production Editor, BMB Email: [email protected] If you experience technical problems, please contact Balaji/Sam (e-mail: [email protected], phone: +91 (44) 4205-8888 (ext.308)). Be sure to include your article number. This e-proof is to be used only for the purpose of returning corrections to the publisher. Sincerely, Production Editor, BMB Email: [email protected]

ELECTRONIC PROOF CHECKLIST, Biochemistry and Molecular Biology Education

Your article will be published online via Wiley’s EarlyView® service (wileyonlinelibrary.com) shortly after receipt of corrections. EarlyView® is Wiley’s online publication of individual articles in full text HTML and/or pdf format before release of the compiled print issue of the journal. Articles posted online in EarlyView® are peer-reviewed, copyedited, author corrected, and fully citable via the article DOI (for further information, visit www.doi.org). EarlyView® means you benefit from the best of two worlds—fast online availability as well as traditional, issue based archiving.

READ PROOFS CAREFULLY • This will be your only chance to review these proofs. Please note that once your corrected article is posted online, it is considered legally published, and cannot be removed from the Web site for further corrections. •

Please note that the volume and page numbers shown on the proofs are for position only.

ANSWER ALL QUERIES ON PROOFS • Please annotate all corrections and remember to respond to all author queries at the back of your page proofs.

CHECK FIGURES AND TABLES CAREFULLY • Check size, numbering, and orientation of figures. • All images in the PDF are downsampled (reduced to lower resolution and file size) to facilitate Internet delivery. These images will appear at higher resolution and sharpness in the printed article. • Review figure legends to ensure that they are complete. • Check all tables. Review layout, title, and footnotes. RETURN

CORRECTED PROOFS Other forms as needed

RETURN ALL RELEVANT ITEMS WITHIN 48 HOURS OF RECEIPT The preferred method to return corrected proofs is to return the annotated PDF to [email protected]. If this is not possible you may fax to 717-738-9478 or 717-738-9479

USING e-ANNOTATION TOOLS FOR ELECTRONIC PROOF CORRECTION Required software to e-Annotate PDFs: Adobe Acrobat Professional or Adobe Reader (version 7.0 or above). (Note that this document uses screenshots from Adobe Reader X) The latest version of Acrobat Reader can be downloaded for free at: http://get.adobe.com/uk/reader/ Once you have Acrobat Reader open on your computer, click on the Comment tab at the right of the toolbar:

This will open up a panel down the right side of the document. The majority of tools you will use for annotating your proof will be in the Annotations section, pictured opposite. We’ve picked out some of these tools below:

1. Replace (Ins) Tool – for replacing text.

2. Strikethrough (Del) Tool – for deleting text.

Strikes a line through text and opens up a text box where replacement text can be entered. How to use it

Strikes a red line through text that is to be deleted. How to use it



Highlight a word or sentence.



Highlight a word or sentence.



Click on the Replace (Ins) icon in the Annotations section.



Click on the Strikethrough (Del) icon in the Annotations section.



Type the replacement text into the blue box that appears.

3. Add note to text Tool – for highlighting a section to be changed to bold or italic.

4. Add sticky note Tool – for making notes at specific points in the text.

Highlights text in yellow and opens up a text box where comments can be entered. How to use it

Marks a point in the proof where a comment needs to be highlighted. How to use it



Highlight the relevant section of text.





Click on the Add note to text icon in the Annotations section.

Click on the Add sticky note icon in the Annotations section.



Click at the point in the proof where the comment should be inserted.



Type the comment into the yellow box that appears.



Type instruction on what should be changed regarding the text into the yellow box that appears.

USING e-ANNOTATION TOOLS FOR ELECTRONIC PROOF CORRECTION

5. Attach File Tool – for inserting large amounts of text or replacement figures.

6. Add stamp Tool – for approving a proof if no corrections are required.

Inserts an icon linking to the attached file in the appropriate pace in the text. How to use it

Inserts a selected stamp onto an appropriate place in the proof. How to use it



Click on the Attach File icon in the Annotations section.



Click on the Add stamp icon in the Annotations section.



Click on the proof to where you’d like the attached file to be linked.





Select the file to be attached from your computer or network.

Select the stamp you want to use. (The Approved stamp is usually available directly in the menu that appears).



Click on the proof where you’d like the stamp to appear. (Where a proof is to be approved as it is, this would normally be on the first page).



Select the colour and type of icon that will appear in the proof. Click OK.

7. Drawing Markups Tools – for drawing shapes, lines and freeform annotations on proofs and commenting on these marks. Allows shapes, lines and freeform annotations to be drawn on proofs and for comment to be made on these marks..

How to use it 

Click on one of the shapes in the Drawing Markups section.



Click on the proof at the relevant point and draw the selected shape with the cursor.



To add a comment to the drawn shape, move the cursor over the shape until an arrowhead appears.



Double click on the shape and type any text in the red box that appears.

For further information on how to annotate proofs, click on the Help menu to reveal a list of further options:

Additional reprint purchases Should you wish to purchase additional copies of your article, please click on the link and follow the instructions provided: https://caesar.sheridan.com/reprints/redir.php?pub=10089&acro=BMB Corresponding authors are invited to inform their co-authors of the reprint options available. Please note that regardless of the form in which they are acquired, reprints should not be resold, nor further disseminated in electronic form, nor deployed in part or in whole in any marketing, promotional or educational contexts without authorization from Wiley. Permissions requests should be directed to mail to: [email protected] For information about ‘Pay-Per-View and Article Select’ click on the following link: wileyonlinelibrary.com/aboutus/ppv-articleselect.html

Color figures were included with the final manuscript file s that we received for your article. Because of the high cost of color printing, we can only print figures in color if authors cover the expense. Please indicate if you would like your figures to be prin ted in color or black and white. Color images will be reproduced online in Wiley Online Library at no charge, whether or not you opt for color printing.

Failure to return this form will result in the publication of your figures in black and white. JOURNAL

Biochemistry and Molecular Biology Education

VOLUME

ISSUE

TITLE OF MANUSCRIPT NO. OF COLOR PAGES

MS. NO.

No. Color Pages 1 2 3 4

Color Charges 500 1000 1500 2000

AUTHOR(S)


Color Charges 2500 3000 3500 4000


*** Please contact [email protected] for a quote if you have more than 12 pages of color***

Please print my figures in black and white Please print my figures in color

$

Please refer to Editorial office instructions regarding my figures.

**International orders must be paid in currency and drawn on a U.S. bank BILL TO: Name

Purchase Order No.

Institution

Phone

Address Fax E-mail

Color Charges 4500 5000 5500 6000

International Union of Biochemistry and Molecular Biology

COPYRIGHT TRANSFER AGREEMENT Date:

Contributor name:

Contributor address: Manuscript number (Editorial office only): Re: Manuscript entitled (the “Contribution”) for publication in

(the “Journal”)

published by or any successor publisher (“Wiley-Blackwell”) on behalf of International Union of Biochemistry and Molecular Biology (“the Union”). Dear Contributor(s): Thank you for submitting your Contribution for publication. In order to expedite the editing and publishing process and enable Wiley-Blackwell on behalf of the Union to disseminate your Contribution to the fullest extent, we need to have this Copyright Transfer Agreement signed and returned as directed in the Journal’s instructions for authors as soon as possible. If the Contribution is not accepted for publication, or if the Contribution is subsequently rejected, this Agreement shall be null and void. Publication cannot proceed without a signed copy of this Agreement.

A. COPYRIGHT 1. The Contributor assigns to the Union, during the full term of copyright and any extensions or renewals, all copyright in and to the Contribution, and all rights therein, including but not limited to the right to publish, republish, transmit, sell, distribute and otherwise use the Contribution in whole or in part in electronic and print editions of the Journal and in derivative works throughout the world, in all languages and in all media of expression now known or later developed, and to license or permit others to do so. 2. Reproduction, posting, transmission or other distribution or use of the final Contribution in whole or in part in any medium by the Contributor as permitted by this Agreement requires a citation to the Journal and an appropriate credit to the Union and Wiley-Blackwell as Publisher, suitable in form and content as follows: (Title of Article, Contributor, Journal Title and Volume/Issue, Copyright © [year], [copyright owner as specified in the Journal] [Publisher]. Links to the final article on Wiley-Blackwell’s website are encouraged where appropriate.

B . R E TA I N E D R I G H T S Notwithstanding the above, the Contributor or, if applicable, the Contributor’s Employer, retains all proprietary rights other than copyright, such as patent rights, in any process, procedure or article of manufacture described in the Contribution.

C. PERMITTED USES BY CONTRIBUTOR 1. Submitted Version. The Union licenses back the following rights to the Contributor in the version of the Contribution as originally submitted for publication: a. After publication of the final published version, the right to self-archive on the Contributor’s personal website or in the Contributor’s institution’s/ employer’s institutional repository or archive. This right extends to both intranets and the Internet. The Contributor may not update the submitted version or replace it with the published Contribution. The version posted must contain a legend as follows: This is the pre-peer-reviewed version of the following article: FULL CITE, which has been published in final form at [Link to final article]. b. The right to transmit, print and share copies with colleagues. 2. Accepted Version. Re-use of the accepted and peer-reviewed (but not final) version of the Contribution shall be by separate agreement with WileyBlackwell. Requests for permission should be addressed to the Wiley-Blackwell permissions department at [email protected]. Wiley-Blackwell has agreements with certain funding agencies governing re-use of this version. The details of those relationships, and other offerings allowing open web use, are set forth at the following website: http://www.wiley.com/go/funderstatement. NIH grantees should check the box at the bottom of this document.

3. Final Published Version. The Union hereby licenses back to the Contributor the following rights with respect to the final published version of the Contribution: a. Copies for colleagues. The personal right of the Contributor only to send or transmit individual copies of the final published version in any format to colleagues upon their specific request provided no fee is charged, and further provided that there is no systematic distribution of the Contribution, e.g. posting on a listserve, website or automated delivery. b. Re-use in other publications. The right to re-use the final Contribution or parts thereof for any publication authored or edited by the Contributor (excluding journal articles) where such re-used material constitutes less than half of the total material in such publication. In such case, any modifications should be accurately noted. c. Teaching duties. The right to include the Contribution in teaching or training duties at the Contributor’s institution/place of employment including in course packs, e-reserves, presentation at professional conferences, in-house training, or distance learning. The Contribution may not be used in seminars outside of normal teaching obligations (e.g. commercial seminars). Electronic posting of the final published version in connection with teaching/training at the Contributor’s institution/place of employment is permitted subject to the implementation of reasonable access control mechanisms, such as user name and password. Posting the final published version on the open Internet is not permitted. d. Oral presentations. The right to make oral presentations based on the Contribution. 4. Article Abstracts, Figures, Tables, Data Sets, Artwork and Selected Text (up to 250 words). a. Contributors may re-use unmodified abstracts for any non-commercial purpose. For on-line uses of the abstracts, the Union encourages but does not require linking back to the final published versions. b. Contributors may re-use figures, tables, data sets, artwork, and selected text up to 250 words from their Contributions, provided the following conditions are met: (i) Full and accurate credit must be given to the Contribution. (ii) Modifications to the figures, tables and data must be noted. Otherwise, no changes may be made. (iii) The re-use may not be made for direct commercial purposes, or for financial consideration to the Contributor. (iv) Nothing herein shall permit dual publication in violation of journal ethical practices.

CTA – IUBMB

D. CONTRIBUTIONS OWNED BY EMPLOYER 1. If the Contribution was written by the Contributor in the course of the Contributor’s employment (as a “work-made-for-hire” in the course of employment), the Contribution is owned by the company/employer which must sign this Agreement (in addition to the Contributor‘s signature) in the space provided below. In such case, the company/employer hereby assigns to the Union, during the full term of copyright, all copyright in and to the Contribution for the full term of copyright throughout the world as specified in paragraph A above. 2. In addition to the rights specified as retained in paragraph B above and the rights granted back to the Contributor pursuant to paragraph C above, the Union hereby grants back, without charge, to such company/employer, its subsidiaries and divisions, the right to make copies of and distribute the final published Contribution internally in print format or electronically on the Company’s internal network. Copies so used may not be resold or distributed externally. However, the company/employer may include information and text from the Contribution as part of an information package included with software or other products offered for sale or license or included in patent applications. Posting of the final published Contribution by the institution on a public access website may only be done with Wiley-Blackwell’s written permission and payment of any applicable fee(s). Also, upon payment of Wiley-Blackwell’s reprint fee, the institution may distribute print copies of the published Contribution externally.

E. GOVERNMENT CONTRACTS In the case of a Contribution prepared under U.S. Government contract or grant, the U.S. Government may reproduce, without charge, all or portions of the Contribution and may authorize others to do so, for official U.S. Govern-

ment purposes only, if the U.S. Government contract or grant so requires. (U.S. Government, U.K. Government, and other government employees: see notes at end).

F. C O P Y R I G H T N O T I C E The Contributor and the company/employer agree that any and all copies of the final published version of the Contribution or any part thereof distributed or posted by them in print or electronic format as permitted herein will include the notice of copyright as stipulated in the Journal and a full citation to the Journal as published by Wiley-Blackwell.

G . C O N T R I B U T O R ’ S R E P R E S E N TAT I O N S The Contributor represents that the Contribution is the Contributor‘s original work, all individuals identified as Contributors actually contributed to the Contribution, and all individuals who contributed are included. If the Contribution was prepared jointly, the Contributor agrees to inform the co-Contributors of the terms of this Agreement and to obtain their signature to this Agreement or their written permission to sign on their behalf. The Contribution is submitted only to this Journal and has not been published before. (If excerpts from copyrighted works owned by third parties are included, the Contributor will obtain written permission from the copyright owners for all uses as set forth in WileyBlackwell’s permissions form or in the Journal’s Instructions for Contributors, and show credit to the sources in the Contribution.) The Contributor also warrants that the Contribution contains no libelous or unlawful statements, does not infringe upon the rights (including without limitation the copyright, patent or trademark rights) or the privacy of others, or contain material or instructions that might cause harm or injury.

All Contributors must sign below. All Contributors must check one box except that NIH grantees should check both the Contributorowned work and the NIH grantee box. If your Contribution was written during the course of employment, your employer must also sign where indicated. Contributor-owned work AT TA C H A D D I T I O N A L S I G N AT U R E PA G E S A S N E C E S S A RY

Contributor’s signature

Date

Type or print name and title

Co-contributor’s signature

Date

Type or print name and title

Company/Institution-owned work (made-for-hire in the course of employment)

Company or Institution (Employer-for-Hire)

Date

Authorized signature of Employer

Date

U.S. Government work

Note to U.S. Government Employees A contribution prepared by a U.S. federal government employee as part of the employee’s official duties, or which is an official U.S. Government publication, is called a “U.S. Government work,” and is in the public domain in the United States. In such case, the employee may cross out Paragraph A.1 but must sign (in the Contributor’s signature line) and return this Agreement. If the Contribution was not prepared as part of the employee’s duties or is not an official U.S. Government publication, it is not a U.S. Government work.

U.K. Government work (Crown Copyright)

Note to U.K. Government Employees The rights in a Contribution prepared by an employee of a U.K. government department, agency or other Crown body as part of his/her official duties, or which is an official government publication, belong to the Crown. U.K. government authors should submit a signed declaration form together with this Agreement. The form can be obtained via http://www.opsi.gov.uk/advice/crown-copyright/copyright-guidance/ publication-of-articles-written-by-ministers-and-civil-servants.htm

Other Government work

Note to Non-U.S., Non-U.K. Government Employees If your status as a government employee legally prevents you from signing this Agreement, please contact the editorial office.

NIH Grantees

Note to NIH Grantees Pursuant to NIH mandate, Wiley-Blackwell will post the accepted version of Contributions authored by NIH grant-holders to PubMed Central upon acceptance. This accepted version will be made publicly available 12 months after publication. For further information, see www.wiley.com/go/nihmandate.

CTA – IUBMB

BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION c/o John Wiley & Sons, Inc. STM Division 111 River Street Hoboken, NJ 07030

RE: _______________________

--COPYRIGHT TRANSFER AGREEMENT-Papers cannot be published unless a signature is on file. Please return this form with your page proofs. To: International Union of Biochemistry and Molecular Biology (IUBMB) I/We hereby confirm that a)

The IUBMB shall, in consideration of publication, become entitled to the work copyright and translation rights therein and that I/we assign all copyrights in the paper to IUBMB for publication in printed and electronic forms.

b)

For U.S. GOVERNMENT EMPLOYEES: This work was done in my capacity as a U.S. government employee; the above assignment applies only to the extent allowable by law.

Signed: All authors shall sign, or the signing author must indicate that consent is held from each co-author for copyright to be assigned to IUBMB. Date: ________________________________ Signed: _______________________________________________________________________ I hold consent from each co-author for copyright to be assigned to IUBMB.

J_ID: BMBD Customer A_ID: BMB20692 Date: 22-March-13

Stage:

Page: 1

Laboratory Exercise Molecular Tools for Cryptic Candida Species Identification with Applications in a Clinical Laboratory

AQ2

Soledad Gamarra†‡ Catiana Dudiuk† Estefanıá Mancilla‡ nica Vera Marıá Vero Garate‡ Sergio Guerrero‡§ Guillermo Garcia-Effron†‡

AQ1

stico Molecular, Facultad de From the †Laboratorio de Micologıá y Diagno gicas, Universidad Nacional del Litoral, Bioquı´mica y Ciencias Biolo CONICET, Santa Fe (CP 3000), Argentina, ‡Catedra de Parasitologıá y gicas, Universidad Micologıá, Facultad de Bioquı´mica y Ciencias Biolo Nacional del Litoral, Santa Fe (CP 3000), Argentina, §Laboratorio de Bioquı´mica Microbiana, Instituto de Agrobiotecnologıá del Litoral, Universidad Nacional del Litoral, CONICET, Santa Fe (CP 3000), Argentina

Abstract Candida spp. includes more than 160 species but only 20 species pose clinical problems. C. albicans and C. parapsilosis account for more than 75% of all the fungemias worldwide. In 1995 and 2005, one C. albicans and two C. parapsilosis-related species were described, respectively. Using phenotypic traits, the identification of these newly described species is inconclusive or impossible. Thus, molecular-based procedures are mandatory. In the proposed educational experiment we have adapted different basic molecular biology techniques designed to identify these species including PCR, multiplex PCR, PCRbased restriction endonuclease analysis and nuclear ribosomal RNA amplification. During the classes, students

acquired the ability to search and align gene sequences, design primers, and use bioinformatics software. Also, in the performed experiments, fungal molecular taxonomy concepts were introduced and the obtained results demonstrated that classic identification (phenotypic) in some cases needs to be complemented with molecular-based techniques. As a conclusion we can state that we present an inexpensive and well accepted group of classes involving important concepts that C 2013 by The Internacan be recreated in any laboratory. V tional Union of Biochemistry and Molecular Biology, 00(00):000–000, 2013

Keywords: Candida spp.; molecular taxonomy

Introduction Candida spp. is the most common fungal pathogen and the fourth most common cause of hospital acquired blood stream infections [1]. The genus Candida (Berkhout) includes more than 160 species but only 20 species pose clinical problems [2–5]. Out of these species C. albicans and C. parapsilosis account for more than 75% of all the fungemias worldwide. In 1995, Sullivan et al. described a C. albicans-related species named C. dubliniensis [6]. More recently, Tavanti et al. demonstrated that the three groups of C. parapsilosis were in

stico *Address for correspondence to: Laboratorio de Micologıá y Diagno gicas, Molecular, CONICET, Facultad de Bioquı´mica y Ciencias Biolo Universidad Nacional del Litoral, Ciudad Universitaria UNL (Ruta 168), C.C. 242-S3000ZAA, Santa Fe (Santa Fe), Argentina; E-mail: [email protected]. Received 11 December 2012; accepted 16 February 2013 DOI: 10.1002/bmb.20692 Published online 00 Month 2013 in Wiley Online Library (wileyonlinelibrary.com)

fact three different related species (C. parapsilosis sensu stricto, C. orthopsilosis, and C. metapsilosis) [7]. Since then, an increased interest in studying the epidemiology of these newly described species has arisen based on the observed antifungal susceptibilities and virulence differences [6,8–18]. Candida spp. identification has relied largely on phenotypical traits such as carbon auxotrophy and on microscopic examination (e.g., chlamydoconidia formation). However, the identification of these newly described species by phenotypic methods is frequently inconclusive or impossible. Thus, molecular-based procedures are mandatory for the taxonomic differentiation between C. albicans and C. dubliniensis and between C. parapsilosis sensu lato species [6,7,19]. The differentiation between C. albicans and C. dubliniensis using molecular techniques can be performed by different procedures [6,20–24]. The one used by us in these classes is the method proposed by Donnelly et al. [20]. It is based on the sequence differences between the C. dubliniensis actin 1 gene (CdACT1) and the C. albicans actin 1 gene (CaACT1). The intron and exon sequences of these genes are 83.4 and 97.9%

1

Biochemistry and Molecular Biology Education ID: bharathi.s

I

Black Lining: [ON]

I

Time: 14:10

I

Path: N:/3b2/BMBD/Vol00000/130012/APPFile/JW-BMBD130012


Stage:

Page: 2

Biochemistry and Molecular Biology Education identical, respectively. These sequence differences reflect the differential evolutionary pressure that introns and exons suffer. The method is a multiplexed PCR that uses two pair of primers [20]. One of the pairs (DUBF/DUBR) is designed to hybridize the CdACT1 gene. The sense primer (DUBF) hybridizes one conserved region of both CaACT1 and CdACT1 exon I. On the other hand, the antisense primer (DUBR) was designed to hybridize specifically with the CdACT1 gene intron. Thus, using these primers, a 288 bp. PCR product should be obtained only if a C. dubliniensis DNA is used as a template. The second pair of oligonucleotides (RNAF/RNAR) primes a conserved sequence from fungal nuclear ribosomal RNA used for fungal molecular identification [25]. The PCR product obtained using these primers (of 610 bp. approximately for Candida spp.) serve as an internal positive control. When both primers pairs were combined in a single PCR reaction (multiplexing), all Candida spp. should yield the 610 bp. amplimer while only C. dubliniensis strains should produce both the 610 bp. and the 288 bp. bands. Turning to the molecular differentiation between the C. parapsilosis sensu lato species, multiple molecular-based methodologies have been proposed [26–31]. In our teaching experiment we decided to use a two-step method that include a PCR amplification of a C. parapsilosis sensu lato FKS1 gene fragment followed by an EcoRI digestion [19]. The oligonucleotide pair REAF/REAR primes a conserved region of the C. parapsilosis sensu stricto FKS1 (CpFKS1), C. metapsilosis FKS1 (CmFKS1) and C. orthopsilosis FKS1 (CoFKS1) genes. The PCR amplification would produce a 1032 bp. fragment that yield none, one and two EcoRI restriction sites for CpFKS1, CmFKS1 and CoFKS1, respectively. These EcoRI digestions allow the differentiation between these species. What is described herein are laboratory practice classes aimed to introduce the students to fungal molecular taxonomy and to show that classic fungal taxonomy (phenotypic identification) in some cases needs to be complemented with molecular-based.

Material and Methods Classes and Students The classes described here are named ‘‘molecular taxonomy’’ and are part of the courses ‘‘clinical mycology’’ and ‘‘molecular biology techniques applied to the study of fungi and parasites.’’ These courses are offered to the undergraduate students of Biochemistry and to the postgraduate students of the Biological Sciences PhD program, respectively. The Molecular taxonomy classes followed two classes named ‘‘classic yeast taxonomy’’ were students received the training for yeast phenotypic identification (e.g., carbon- and nitrogen-source assimilation techniques, germ tube induction, etc.). One week before the laboratory classes, a 2 days 3-h meetings were scheduled. In the first one, a concise explanation of the molecular-based methodologies for differentiation between

2

C. albicans and C. dubliniensis and between the C. parapsilosis sensu lato species was given. Moreover, a description of the general aspect of the laboratory classes was imparted with emphasis in the methodologies to be used. Also, a brief reminder of how to use a freeware bioinformatics software named BioEdit Sequence Aligment Editor [32] and the GenBank nucleotide database (http://www.ncbi.nlm.nih.gov/ nuccore) was given. In the second 3-h meeting, the mentioned software and database were used by the students to obtain the ACT1 and FKS1 genes nucleotide sequences and to design oligonucleotides. We recommended students to read the paper by Donnelly et al. and by Garcia-Effron et al. were equivalent experiments were firstly described [19,20]. Afterwards, with the assistance of laboratory teachers, the students compared their designed primers and the ones used by these authors and a discussion was stimulated [19,20]. The experiments and result analysis were completed in a 2 days 5-h laboratory sessions. The students were asked to study a class guide which included a brief theoretical introduction and detailed protocols. Both classes started with a brief explanation of the main concept, the steps of the protocols to be used that day and how to analyze the results. Each laboratory group typically has 12 students which were divided into four groups (named group 1 to 4).

Experimental Procedures The first laboratory class, each group received three Candida spp. strains grown overnight in YPD broth (2% yeast extract, 4% Bacto peptone, 4% dextrose). These strains were phenotypically identified by students in the ‘‘classic yeast taxonomy’’ classes as: C. albicans/C. dubliniensis, C. parapsilosis sensu lato or C. tropicalis strain (Table I). To stimulate a discussion about the different quantity and quality of the fungal genomic DNA obtained, each group extracted yeast genomic DNAs by different procedures. All the groups used a phenol-based DNA purification [33]. Moreover, groups 1 and 2 extracted the DNA using the Accuprep Genomic DNA Purification Kit (Bioneer-Genbiotech, Buenos Aires, Argentina) following manufacturer’s instructions. On the other hand, groups 3 and 4 were asked to extract the yeast DNAs using the Accuprep kit with a previous glass beads disruption step (Table I). Extracted genomic DNAs were subjected to electrophoresis and spectroscopy analysis. At the end of the first laboratory class, students set two PCR reactions per strain. The first (named PCR1) is the reaction proposed by Donelly et al. to differentiate C. dubliniensis from C. albicans [20]. The PCR2 is the PCR reaction used as the first step of the C. parapsilosis sensu lato species identification [19] (Table II). Students were guided by a laboratory teacher to know how to program the thermocycler and they run the PCR reaction. After the PCR program finished, the PCR tubes where frozen until the next class. At the beginning of class 2, each group of students received one agarose gel ready to be seeded and the frozen PCR reactions were subjected to electrophoresis analysis. The groups would obtain the results showed in Table II. A

Teaching Fungal Molecular Taxonomy ID: bharathi.s

I

Black Lining: [ON]

I

Time: 14:10

I


T1

T2


Stage:

Page: 3

Fungal strains and activities given to each laboratory group TABLE 1

Strains

DNA extractiona

Group 1

Group 2

Group 3

Group 4

C. dubliniensis NCPF 3949

C. albicans ATCC 90028

C. albicans ATCC 90028

C. dubliniensis NCPF 3949

C. parapsilosis sensu stricto ATCC 22019

C. parapsilosis sensu stricto ATCC 22019

C. orthopsilosis ATCC 96139

C. orthopsilosis ATCC 96139

C. tropicalis ATCC 750

C. metapsilosis ATCC 96144

C. tropicalis ATCC 750

C. metapsilosis

DEK

DEK

DEKþP

DEKþP

PB

PB

PB

PB

a DEK: DNA extraction Kit (Accuprep), PB: Phenol-based extraction procedure, EKDþP: DNA Extraction Kit (Accuprep) with a physical disruption step (with glass beads).

result’s discussion was stimulated to help the students to select the PCR tube in which the 1-h EcoRI digestion would be performed. The selection was performed based in the PCR band size. The restriction enzyme digestion was performed following the manufacturer’s instructions. Digestion products were analyzed by electrophoresis on agarose gels and results were discussed. At the end of the second laboratory class the students answered a questionnaire in which their evaluation was based and filled out two poll forms which evaluated the quality of the classes and teachers. Objectives of each of the questions are T3 listed in Table III.

PCR Reactions PCRs were carried out in a 50 ll volume containing 1X PCR buffer; 2 mM MgCl2; 250 lM each of dATP, dGTP, dCTP, and dTTP; 0.5 lM of each primers for PCR1 (DUBF, DUBR, RNAF, and RNAR) and 1 lM of each primers for PCR2 (REA-F and REA-R) (primer sequences are displayed in Table II); 2.5 U of Taq DNA polymerase; and 25 to 50 ng of Candida spp. genomic DNA. PCR1 and PCR2 experiments were performed using a thermal cycler for one cycle of 5 min at 95 C followed by 35 cycles of 30 s at 95 C, 45 s at 58 C, and 90 s at 72 C, followed by one final cycle of 10 min at 72 C.

PCR reactions TABLE 2

PCR1a

Strains

PCR2b

C. albicans

þ (one band: 600 pb.)

–

C. dubliniensis

þ (two bands: 600 pb. and a 288 pb.)

–

C. parapsilosis sensu lato



C. tropicalis


–

DUBF: GTATTTGTCGTTCCCCTTTC

REA-F: GATGACCAATTYTCAAGAGTd

Oligonucleotide primers

c

DUBR: GTGTTGTGTGCACTAACGTC RNAF: GCATATCAATAAGCGGAGGAAAAG RNAR: GGTCCGTGTTTCAAGACG

REA-R: GTCAACATAAATGTAGCATTCTAGAAATC

a

Designed to differentiate C. albicans and C. dubliniensis [20]. Used to identify C. parapsilosis sensu lato species [19]. c Sequence (5 0 to 3 0 ) [19,20,25]. d Y represent a degenerate sequence (C or T). b

3

Gamarra et al. ID: bharathi.s

I

Black Lining: [ON]

I

Time: 14:10

I



Page: 4

Stage:

Biochemistry and Molecular Biology Education

8) In the experiments I was only following instructions (like a cooking recipe):

Evaluation questions TABLE 3

Agree A) Student’s evaluation (Average points obtained, maximum of 10).

Agree

Neutral

Disagree

10) I understand each step of the protocols. Agree

2) Which tests are available to identify C. orthopsilosis and C. metapsilosis? (9.5)

Neutral

Disagree

11) I found easy to make deductions from my observations.

3) Why did the C. albicans ACT1 and C. dubliniensis ACT1 exons share a higher homology than the observed in introns? (9.0)

Agree

Neutral

Disagree

12) The class content makes me feel near the reality of a research laboratory.

4) How many bands do you expect to observe in an agarose gel after a multiplex PCR reaction using primers DUBF/ DUBR and RNAF/RNAR and the DNA obtained from: C. dubliniensis, C. albicans, C. parapsilosis, Aspergillus fumigatus, Cryptococcus neoformans, Rhodotorula mucilaginosa and C. tropicalis? Why? (6.5)

Agree

Neutral

Disagree

13) The class motivate me to check the results. Agree

Neutral

Disagree

14) Overall evaluation of the classes:

Objectives: Questions 1 and 2: Know if the students understand the limitations of classical and molecular identification procedures. Question 3: Know if the students understand the concept of differential evolutionary pressure. Questions 4: Know if the students understand the difference between specific (DUBF and DUBR/REAF and REAR) and panfungal (RNAF and RNAR) primers. B) Laboratory class’ evaluationa (Modified from [34,35])

Available

Easy to find

Hard to find

Insufficient

Adequate

Very Poor

2) Clarity of the explanations (). 3) Teaching staff overall availability to answer questions (). 4) Stimulation for student’s participation (). D) Self-evaluationb.

3) Acquired knowledge: Theoretical: Practical: Psychomotor (pipetting, handling, etc.):

Long

4) Overall score:

4) The work load was: Reasonable

Poor

1) Organization of the theoretical content ().

Minimal

Rather Long

Satisfactory

C) Teacher’s evaluationb:

3) The time allotted for the experiments was: Too short

Good

2) Participation in the laboratory class.

Unavailable

2) The help received from the laboratory staff was: Limited

Very Good

1) Interest in the experiments.

1) The laboratory equipment and material were:

Heavy

Disagree

9) The lab manual was easy to follow and organised

1) Name the limitations of the phenotypic methods designed to differentiate C. albicans from C. dubliniensis? (9.0)

Ample

Neutral

Light

a

Very light

Students have to circle one of the options. Students rated teachers using a 1–5 scale (1: very good and 5: very poor)

b

5) The lab work taught me some basic skils: Agree

Neutral

Disagree

6) The purpose of each experiment was clear: Agree

Neutral

Equipment

Disagree

During this laboratory exercise the following equipment was used: microcentrifuges, vortex mixers, thermocycler, gel electrophoresis equipment, heating block, pipets, microspectrophotometer and a gel documentation system.

7) The lab class trained me to interpret the data: Agree

Neutral

Disagree

4


I

Black Lining: [ON]

I

Time: 14:10

I



FIG 1

Electrophoresis in A 1% Agarose Gel. Line M, molecular size marker; Lanes 1 To 3, C. dubliniensis DNA extracted using different procedures (Line 1: phenolbased DNA extraction, line 2: The Accuprep DNA extraction kit, Lane 3: Accuprep DNA extraction kit with A previous physical disruption step). Lanes 4 To 6, Pcr 1 using as template the DNA extracted from C. dubliniensis (Lane 4), C. tropicalis (Lane 5) and C. parapsilosis Sensu Stricto (Lane 6). Lanes 7 To 9, Pcr 2 using DNA obtained from C. dubliniensis (Lane 7), C. tropicalis (Lane 8) and C. parapsilosis Sensu Stricto (Lane 9).

Laboratory Supplies Each group of three students received: gloves, lab glasses, disponsable lab coats, sterile pipette tips, ice boxes, sterile tubes (1.5 ml and 0.2-mL PCR tubes) and different aliquots of enzymes and solutions. The aliquots were provided to avoid cross contamination and enzyme degradation since students have little or no experience in handling these solutions.

Results and Discussion Bioinformatics Using BioEdit software and the GenBank nucleotide database, students were able to easily find the CaACT1, CdACT1, and FKS1 genes sequences. Moreover, the primers for CaACT1 and CdACT1 were designed by the students and were consistent or very similar with those designed by Donnelly et al. [20]. On the other hand, the C. parapsilosis sensu lato FKS1 primers designed by students showed important discrepancies with the published primers [19]. Students aligned CpFKS1, CoFKS1 and CmFKS1 sequences using the bioedit software and choose conserved regions to design the primers. However, they did not consider that FKS genes are conserved among fungal species [36]. Thus, student’s primers would hybridize different fungal species FKS1 genes and not only C. parapsilosis sensu lato species FKS1 genes.

Stage:

Page: 5

commercial kit. The extractions performed with the glass beads pretreatment (Groups 3 and 4) yielded better DNA quantities and qualities. The reasons for these results were discussed with the students. The conclusion was that a physical disruption step followed by chemical disruption is better to break the fungal cell wall than the one disruption step (chemical) used by the commercial kit (Fig. 1). The PCR1 and PCR2 experiments from all the groups achieved the awaited results, as can be seen in Fig. 1. As expected, students choose the PCR tubes containing the biggest band (1032 bp) to perform the EcoRI digestion. The restriction enzyme digestions were performed correctly and students were able to discriminate between the C. parapsilosis sensu lato species (Fig. 2).

Learning Results and Discipline Achievements The answers to the questionnaire showed that the students meet the objectives of the laboratory class (Table III). Students learned that there is no phenotypic method able to differentiate C. albicans from C. dubliniensis and C. parapsilsosis sensu stricto from C. metapsilosis and c. orthopsilosis. Thus, using a molecular method is mandatory (questions 1 and 2). Moreover, 11 out of 12 answered that it is necessary to first use a classical method to identify C. parapsilosis sensu lato complex. These answers demostrate that students undestood that clasical and molecular-based identification are complementary and both are essential to arrive to a definitive identification. The second objective of the classes was to understand the concept of differential evolutionary pressure in introns and exons. The answers to question three demonstrate that this objective was also achieved by students. With their answers, students confirmed that they have a clear notion that exons could not mutate freely while introns have no such restriction. Moreover, the students understand how molecular taxonomy uses these concepts considering that two related species has to have

Experimental Results DNA extractions qualities and quantities were better when using the phenol-based procedures. However, interesting conclusions were obtained. Students realized the biohazard inconvenience due to the phenol. Moreover, the majority thought that the phenol-base protocol was more laborious than the

FIG 2

2% Agarose gel electrophoresis of the C. parapsislosis Sensu Lato Fks1 fragment digested by Ecor1. Lane M, 100-Bp molecular size marker; Lane 1, C. Metapsilosis; Lane 2, C. Parapsilosis Sensu Stricto.

5


I

Black Lining: [ON]

I

Time: 14:10

I


F1

F2

3


Stage:

Page: 6

Biochemistry and Molecular Biology Education higher homology in exons than in introns. Analyzing the answers to question 4 it was clear that the majority of the students understand the panfungal nature of the PCR2 (RNAF/ RNAR primers). However, 3 out of the 12 students thought that this PCR was in fact a pancandida reaction (positive for all Candida spp. but negative for Aspergillus spp. Cryptococcus spp. and Rhodotorula spp.) while 2 believed that the PCR was only positive for C. albicans and/or C. dubliniensis. Therefore, in future classes, we will dwell on the panfungal nature of the RNAF and RNAR primers. The evaluation of student’s participation was performed in two ways: by a self-evaluation test (Table III) and by following the attitude of the students by taking notes of the questions raised along the laboratory exercises and the answers given to open questions. Also, the way students handle samples and followed the protocols were evaluated. The class and teachers were evaluated by the questions listed in Table III. As a conclusion we can state that we present an inexpensive and well accepted group of classes involving important concepts that can be recreated in any laboratory.

References [1] Walsh, T. J. and Groll, A. H. (1999) Emerging fungal pathogens: Evolving challenges to immunocompromised patients for the twenty-first century. Transpl. Infect. Dis. 1, 247–261. [2] Barret, J. A., Payne, R. W., and Yarrow, D., in Barret, J. A., Payne, R. W., and Yarrow, D. Eds. (1990) Descriptions of the Species, Arranged Alphabetically. Yeasts: Characteristics and Identification, Cambridge University Press, Cambridge, pp.79–695. [3] Fridkin, S. K. (2005) The changing face of fungal infections in health care settings. Clin. Infect. Dis. 41, 1455–1460. [4] Nucci, M. and Marr, K. A. (2005) Emerging fungal diseases. Clin. Infect. Dis. 41, 521–526. [5] Pfaller, M. A. and Diekema, D. J. (2007) Epidemiology of invasive candidiasis: A persistent public health problem. Clin. Microbiol. Rev. 20, 133–163. [6] Sullivan, D. J., Westerneng, T. J., Haynes, K. A., Bennett, D. E., and Coleman, D. C. (1995) Candida Dubliniensis Sp. Nov.: Phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals. Microbiology 141 (Part 7),1507–1521. [7] Tavanti, A., Davidson, A. D., Gow, N. A., Maiden, M. C., and Odds, F. C. (2005) Candida Orthopsilosis and Candida Metapsilosis Spp. Nov. to replace Candida Parapsilosis groups II and III. J. Clin. Microbiol. 43, 284–292. [8] Canton, E., Espinel-Ingroff, A., Peman, J., and Del, C. L. (2010) In vitro fungicidal activities of echinocandins against Candida Metapsilosis, C. Orthopsilosis, and C. Parapsilosis evaluated by time-kill studies. Antimicrob. Agents Chemother. 54, 2194–2197. [9] Diekema, D. J., Messer, S. A., Boyken, L. B., et al. (2009) In vitro activity of seven systemically active antifungal agents against a large global collection of rare Candida species as determined by CLSI broth microdilution methods. J. Clin Microbiol 47, 3170–3177. [10] Gomez-Lopez, A., Alastruey-Izquierdo, A., Rodriguez, D., et al. (2008) Prevalence and susceptibility profile of Candida metapsilosis and Candida orthopsilosis: Results from population-based surveillance of candidemia in Spain. Antimicrob. Agents Chemother. 52, 1506–1509. [11] Lockhart, S. R., Messer, S. A., Pfaller, M. A., and Diekema, D. J. (2008) Geographic distribution and antifungal susceptibility of the newly described species Candida orthopsilosis and Candida metapsilosis in comparison to the closely related species Candida parapsilosis. J. Clin. Microbiol. 46, 2659–2664.

6

[12] Moran, G. P., Sullivan, D. J., Henman, M. C., et al. (1997) Antifungal drug susceptibilities of oral Candida dubliniensis isolates from human immunodeficiency virus (HIV)-infected and non-HIV-infected subjects and generation of stable fluconazole-resistant derivatives in vitro. Antimicrob. Agents Chemother. 41, 617–623. [13] Orsi, C. F., Colombari, B., and Blasi, E. (2010) Candida metapsilosis as the least virulent member of the ‘C. Parapsilosis’ complex. Med. Mycol. 48, 1024–1033. [14] Silva, A. P., Miranda, I. M., Lisboa, C., Pina-Vaz, C., and Rodrigues, A. G. (2009) Prevalence, distribution, and antifungal susceptibility profiles of Candida parapsilosis, C. orthopsilosis, and C. metapsilosis in a tertiary care hospital. J. Clin. Microbiol. 47, 2392–2397. [15] Szabo, Z., Szilagyi, J., Tavanti, A., et al. (2009) In vitro efficacy of 5 antifungal agents against Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis as determined by time-kill methodology. Diagn. Microbiol. Infect. Dis. 64, 283–288. [16] Van Asbeck, E., Clemons, K. V., Martinez, M., Tong, A. J., and Stevens, D. A. (2008) Significant differences in drug susceptibility among species in the Candida parapsilosis group. Diagn. Microbiol. Infect. Dis. 62, 106–109. [17] Varga, I., Soczo, G., Kardos, G., et al. (2008) Comparison of killing activity of caspofungin against Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis. J. Antimicrob. Chemother. 62, 1466–1468. [18] Gilfillan, G. D., Sullivan, D. J., Haynes, K., Parkinson, T., Coleman, D. C., and Gow, N. A. (1998) Candida dubliniensis: Phylogeny and putative virulence factors. Microbiology 144 (Part 4),829–838. [19] Garcia-Effron, G., Canton, E., Peman, J., Dilger, A., Roma, E., and Perlin, D. S. (2011) Assessment of two new molecular methods for identification of Candida parapsilosis Sensu Lato species. J. Clin. Microbiol. 49, 3257–3261. [20] Donnelly, S. M., Sullivan, D. J., Shanley, D. B., and Coleman, D. C. (1999) Phylogenetic analysis and rapid identification of Candida dubliniensis based on analysis of Act1 intron and exon sequences. Microbiology 145 (Part 8),1871–1882. [21] Sullivan, D. and Coleman, D. (1998) Candida dubliniensis: Characteristics and identification. J. Clin. Microbiol. 36, 329–334. [22] Neppelenbroek, K. H., Campanha, N. H., Spolidorio, D. M., Spolidorio, L. C., Seo, R. S., and Pavarina, A. C. (2006) Molecular fingerprinting methods for the discrimination between C. Albicans and C. Dubliniensis. Oral Dis. 12, 242–253. [23] Joly, S., Pujol, C., Rysz, M., Vargas, K., and Soll, D. R. (1999) Development and characterization of complex DNA fingerprinting probes for the infectious yeast Candida dubliniensis. J. Clin. Microbiol. 37, 1035–1044. [24] Kurzai, O., Heinz, W. J., Sullivan, D. J., Coleman, D. C., Frosch, M., and Muhlschlegel, F. A. (1999) Rapid PCR test for discriminating between Candida albicans and Candida dubliniensis isolates using primers derived from the Ph-regulated Phr1 and Phr2 genes of C. Albicans. J. Clin. Microbiol. 37, 1587–1590. [25] Haynes, K. A., Westerneng, T. J., Fell, J. W., and Moens, W. (1995) Rapid detection and identification of pathogenic fungi by polymerase chain reaction amplification of large subunit ribosomal DNA. J. Med. Vet. Mycol. 33, 319–325. [26] Asadzadeh, M., Ahmad, S., Al Sweih, N., and Khan, Z. U. (2009) Rapid molecular differentiation and genotypic heterogeneity among Candida parapsilosis and Candida orthopsilosis strains isolated from clinical specimens in Kuwait. J. Med. Microbiol 58, 745–752. [27] Borman, A. M., Linton, C. J., Oliver, D., et al. (2009) Pyrosequencing analysis of 20 nucleotides of internal transcribed spacer 2 discriminates Candida parapsilosis, Candida metapsilosis, and Candida orthopsilosis. J. Clin. Microbiol. 47, 2307–2310. [28] Borst, A., Theelen, B., Reinders, E., Boekhout, T., Fluit, A. C., and Savelkoul, P. H. (2003) Use of amplified fragment length polymorphism analysis to identify medically important Candida Spp., including C. Dubliniensis. J. Clin. Microbiol. 41, 1357–1362. [29] Sabino, R., Sampaio, P., Rosado, L., Stevens, D. A., Clemons, K. V., and Pais, C. (2010) New polymorphic microsatellite markers able to distinguish


I

Black Lining: [ON]

I

Time: 14:10

I



among Candida parapsilosis Sensu Stricto isolates. J. Clin. Microbiol. 48, 1677–1682. [30] Tavanti, A., Hensgens, L. A., Ghelardi, E., Campa, M., and Senesi, S. (2007) Genotyping of Candida orthopsilosis clinical isolates by amplification fragment length polymorphism reveals genetic diversity among independent isolates and strain maintenance within patients. J. Clin. Microbiol. 45, 1455–1462. [31] Tay, S. T., Na, S. L., and Chong, J. (2009) Molecular differentiation and antifungal susceptibilities of Candida parapsilosis isolated from patients with bloodstream infections. J. Med. Microbiol. 58, 185–191. [32] Hall, T. A. (1999) Bioedit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/Nt. Nucl. Acids. Symp. Ser. 41, 95–98.

Stage:

Page: 7

[33] Holden, D. W., in Maresca and Kobayashi, G. S., Eds. (1994) DNA Mini Prep Method for Aspergillus fumigatus (and Other Filamentous Fungi). Molecular Biology of Pathogenic Fungi, A Laboratory Manual, Telos Press, New York, pp.3–4. [34] Jhonstone, A. (2005) Evaluation of Teaching, Higher Education Academyphysical Sciences Centre, Hull, UK. [35] Malago, W., Jr., Soares-Costa, A., and Henrique-Silva, F. (2009) DNA as genetic material: Revisiting classic experiments through a simple, practical class. Biochem. Mol. Biol. Educ. 37, 290–295. [36] Perlin, D. S. (2007) Resistance to echinocandin-class antifungal drugs. Drug Resist. Updat. 10, 121–130. [37] Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning - A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

7


I

Black Lining: [ON]

I

Time: 14:10

I


AQ4

AQ5


Stage:

Page: 8

AQ1: Please confirm that all author names are OK and are set with first name first, surname last. AQ2: Kindly provide the department name for all the affiliations. AQ3: Kindly provide names of all the authors for all the et al.-type references. AQ4: Kindly provide the initials of ‘‘Maresca’’ for Ref. 33. AQ5: Please note that Ref. 37 (original number 34) is not cited anywhere in the text. Kindly cite it at an appropriate place or delete from the list of references.

AQ1: All author names are OK. AQ2: María Verónica Vera Garate is the complete name of one of the co-authors. Thus her afiliation is Cátedra de Parasitología y Micología, Facultad de Bioquímica y Ciencias Biológicas, Universidad Nacional del Litoral, Santa Fe (CP 3000), Argentina. AQ3: Ref. 9: Diekema DJ, Messer SA, Boyken LB, Hollis RJ, Kroeger J, Tendolkar S, Pfaller MA. Ref. 10: Gomez-Lopez A, Alastruey-Izquierdo A, Rodriguez D, Almierante B, Pahissa A, Rodriguez-Tudela JL, Cuenca-Estrella M. Ref. 12: Moran GP, Sullivan DJ, Henman MC, McCreary CE, Harrington BJ, Shanley DB, Coleman DC. Ref. 15: Szabo Z, Szilagyi J, Tavanti A, Kardos G, Rozgonyi F, Bayegan S, Majoros L. Ref. 17: Varga I, Soczo G, Kardos G, Borbely A, Szabo Z, Kemeny-Beke A, Majoros L. Ref. 27: Borman AM, Linton CJ, Oliver D, Palmer MD, Szekely A, Odds FC, Johnson EM. AQ4: Maresca B. (it was added as a note in references section. AQ5: Ref. 37 was deleted.

ID: bharathi.s

I

Black Lining: [ON]

I

Time: 14:10

I
