Bisphenol A induced apoptosis and transcriptome ...

Acta Biochim Biophys Sin, 2017, 49(9), 780–791 doi: 10.1093/abbs/gmx075 Advance Access Publication Date: 15 July 2017 Original Article

Original Article

Bisphenol A induced apoptosis and transcriptome differences of spermatogonial stem cells in vitro Xiaowen Gong1,†, Hui Xie2,†, Xiaoyong Li2, Ji Wu2,3,*, and Yi Lin1,* 1

International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200240, China, 2Key Laboratory for the Genetics of Developmental & Neuropsychiatric Disorders (Ministry of Education), Bio-X Institutes, Shanghai Jiao Tong University, Shanghai 200240, China, and 3Key Laboratory of Fertility Preservation and Maintenance of Ministry of Education, Ningxia Medical University, Yinchuan 750004, China †

These authors contributed equally to this work. *Correspondence address. Tel: +86-21-64070434; Fax: +86-21-64073421; E-mail: [email protected] (Y.L.)/ [email protected] (J.W.) Received 24 February 2017; Editorial Decision 27 April 2017

Abstract Bisphenol A (BPA) is widely used as an industrial plasticizer, which is also an endocrine disruptor and considered to have adverse effects on reproduction. In male mammals, the long-term production of billions of spermatozoa relies on the regulated proliferation and differentiation of spermatogonial stem cells (SSCs). However, little is known about the effects of BPA on the viability of SSCs. To investigate the influence of BPA exposure on SSCs in vitro, we isolated SSCs from mouse and successfully established in vitro propagation of SSCs. After BPA treatment, we found that BPA reduced the viability of SSCs and induced SSC apoptosis. For revealing the transcriptome differences of the BPA-treated SSCs, we performed high-throughput RNA sequencing and found that 860 genes were differentially expressed among 18,272 observed genes. The gene ontology (GO) terms, regulation of programmed cell death and apoptotic process, were enriched in the differentially expressed genes (DEGs). Among the cluster of DEGs associated with the kyoto encyclopedia of genes and genomes (KEGG) apoptosis pathway, activating transcription factor 4 (Atf4) and DNA damage inducible transcript 3 (Ddit3) genes were significantly up-regulated in BPA-treated SSCs, which were proved by qPCR. Taken together, these findings suggest that BPA can increase the mRNA expression of pro-apoptosis genes and reduce the viability of SSCs by inducing apoptosis. Key words: spermatogonial stem cell, bisphenol A, RNA-Seq, cell viability, apoptosis

Introduction Bisphenol A (BPA), a high production volume chemical, is widely used in the manufacture of food packaging, industrial materials, and dental sealant. The ester bonds in these BPA-based polymers are subject to hydrolysis, resulting in leaching of BPA from consumer products and widespread exposure [1,2].

© Crown copyright 2017

Downloaded from https://academic.oup.com/abbs/article-abstract/49/9/780/3970810 by Shanghai Jiao Tong University user on 15 December 2017

BPA possesses weak estrogenic, anti-androgenic, and antithyroid activities, and it is a reproductive toxicant [2]. Several studies have demonstrated BPA-related effects on infertility, genital tract abnormalities, decreased sperm counts, and increased sperm DNA damage [3–5]. Gestational exposure to BPA links to offspring reproductive abnormalities and alters its sperm function and fertility via

780

781

Effects of BPA on spermatogonial stem cells down-regulation of tyrosine phosphorylation [6]. BPA induces modifications of fertility related proteins in spermatozoa, which is associated with increased reproductive health risk [7]. The spermatozoa of exposed males are incapable of proper sperm–oocyte binding, thereby affecting embryonic growth [8]. Besides that, BPA can impair spermatogenesis and induce meiotic abnormalities [9]. Spermatogenesis is a complex process of sperm production that is dependent upon the biological activities of spermatogonial stem cells (SSCs) and a unique microenvironment [10]. Octamer-binding protein 4 (Oct4) is expressed in cultured SSCs, which is a core transcription factor that regulates self-renewal and pluripotency of embryonic stem cells [11]. Promyelocytic leukemia zinc-finger (Plzf) has been suggested as a molecule important for SSC self-renewal. Ets-variant gene 5 (Etv5) is expressed in cultured SSCs, in addition to spermatogonia and sertoli cells within pup and adult testes, and has a role in male fertility [12]. Deleted in azoospermia-like (Dazl) is used as a germ cell marker in mice and required throughout germ cell development [13]. SSCs arise from gonocytes in the postnatal testis, which arise from primordial germ cells (PGCs) during fetal development [14]. They are restricted to spermatogenic lineage development and balance self-renewing and differentiating divisions to maintain spermatogenesis. Kanatsu-Shinohara established methods for long-term culture of SSCs from DBA/2 × C57BL/6 hybrid mice [15]. Mouse and rat SSCs in vitro have now been established in different laboratories [16]. After proliferating for long periods of time in culture, SSCs can develop into functional spermatozoa when transplanted back into the testes of an immunocompatible recipient [15,16]. In the past decade, this culture system has been used to identify key growth factors for the proliferation of mSSCs as well as the signaling pathways and the downstream target genes [17]. In mammalian testes, SSCs reside in the basal compartment of the seminiferous tubule, which is on the blood side of the blood–testis barrier. Sertoli cells and leydig cells are the major contributors to the SSC microenvironment [11]. BPA has been reported to affect both the steroid hormone-producing leydig cells and sertoli cells [18–21], but direct effects on SSCs and their transcriptomes remain poorly understood. In this study, we employed in vitro propagation of mouse SSCs to investigate the possible effects of BPA on SSCs and used an RNASeq method to reveal transcriptome changes in BPA-treated SSCs.

supplement (Invitrogen, Carlsbad, USA), 25 μg/ml insulin, 100 μg/ml transferrin, 60 mM putrescine, 30 nM sodiumm selenite, 6 mg/ml D(+)-glucose, 30 μg/ml pyruvic acid, 1 μl/ml DL-lactic acid (Sigma, St Louis, USA), 5 mg/ml bovine serum albumin (Sigma), 2 mM Lglutamine, 10 μM 2-mercaptoethanol (Sigma), 1× MEM vitamins solution (Invitrogen), 1× non-essential amino acid solution (Invitrogen), 2 mM L-glutamine (Invitrogen), 1× penicillin/streptomycin solution (Invitrogen), 0.1 mM ascorbic acid, 10 μg/ml d-biotin (Sigma), 20 ng/ml recombinant human epidermal growth factor (Invitrogen), 10 ng/ml human basic fibroblast growth factor (Invitrogen), 10 ng/ml recombinant human glial cell line-derived neurotrophic factor (Invitrogen) and 1% fetal bovine serum (Gibco). The medium was replaced every 2–3 days. For MEF preparation, C57BL/6J mouse embryos were minced, digested with trypsinEDTA (Invitrogen), and then cultured in DMEM containing 10% FBS supplemented with 2 mM glutamine, 100 u/ml penicillin and 100 μg/ml streptomycin (MEF culture medium).

Immunofluorescence Cultured SSCs were fixed with 4% paraformaldehyde (PFA). Before primary antibodies were applied, nonspecific binding was blocked with PBS containing 10% serum of the species from which the secondary antibody was collected. Thereafter, the cells were incubated overnight at 4°C with rabbit-anti-Oct4 (1:100; Santa Cruz Biotechnology, Santa Cruz, USA), mouse-anti-Plzf (1:100; Santa Cruz Biotechnology), or rabbit-anti-Etv5 (1:100; ABGENT, Suzhou, China) antibodies. After being washed with PBS, the cells were incubated with Rhodamine (TRITC)-conjugated goat anti-rabbit IgG(H+L) (Proteintech, Rosemont, USA) or Rhodamine (TRITC)-conjugated goat anti-mouse IgG(H+L) secondary antibodies (Proteintech) at 37°C for 30 min. Nuclei were stained with DAPI. Images were obtained with a DM2500 microscope (Leica, Buffalo Grove, USA).

Cell counting kit-8 assay

All procedures involving animals were approved by the Institutional Animal Care and Use Committee (IACUC) at Shanghai Jiao Tong University, Shanghai, China [Use Permit Number: SYXK (Shanghai) 2007-0025], and all experiments were carried out in accordance with the approved protocols. DBA/2 mice and C57BL/6 mice were purchased from the Shanghai Slac Laboratory Animal Co., Ltd (Shanghai, China).

To study the effects of BPA (99% purity; Sinopharm Chemical Reagent Co., Ltd, Shanghai, China) on SSCs in culture, cell counting kit-8 assay (CCK8 assay) was performed according to the manufacturer’s instructions. The BPA stock solution (1 M) was prepared using dimethyl sulfoxide (DMSO) as a solvent. The final BPA dilutions were prepared by adding the stock solution directly to SSC culture medium to obtain BPA final concentration of 50 μM and 100 μM, with total DMSO concentrations ranging from 0.005% (v/v) for 50 μM BPA to 0.01% (v/v) for 100 μM BPA. DMSO concentration was 0.01% (v/v) for the control (0 μM BPA), which induced no observable toxic effects on cells. Cultures were treated with different concentrations of BPA (0, 50, or 100 μM) for approximately 4 days. Absorbance was measured using an Infinite M1000 PRO microplate reader (TECAN, Männedorf, Switzerland) with an emission wavelength of 450 nm. Experiments were performed in triplicate.

Culture of spermatogonial stem cells

Cluster-forming activity assay

SSCs were isolated and cultured from 6-day-old male F1 progeny of DBA/2 × C57BL/6 mice as previously described [15,16]. SSC cultures remained genetically highly stable [22]. SSCs (> 10 passages) were used in the subsequent experiments. Briefly, SSCs were seeded on mitomycin C (MMC)-treated mouse embryonic fibroblast (MEF) feeder cells and cultured in SSC culture medium. The SSC culture medium consisted of StemPro-34 SFM supplemented with StemPro

Cluster-forming activity (CFA) assay was carried out as previously described [23]. SSCs were harvested from an established cluster culture and seeded at approximately 1 × 104 cells/cm2 in 96-well culture dishes. After incubation with or without different concentrations of BPA for approximately 4 days, the medium was changed to SSC culture medium. Clusters were visually counted at the 6th day or 12th day. Experiments were performed in triplicate.

Materials and Methods Animals


782

Effects of BPA on spermatogonial stem cells

TUNEL staining BPA was added to SSC culture medium at a concentration of 100 μM, and the cultures were grown for approximately 4 days. Paraformaldehyde (4%) was added to the cells for 25 min at room temperature, followed by incubation in 0.2% Triton X-100. TUNEL staining was performed to detect DNA fragmentation in apoptotic nuclei using terminal deoxynucleotidyl transferasemediated fluorescein-conjugated dUTP nick-end labeling technique with a TUNEL BrightGreen Apoptosis Detection Kit (Vazyme,

Nanjing, China) according to the manufacturer’s instructions. Images were obtained with the Leica DM2500 microscope.

Flow cytometry analysis For BPA-treated cells, BPA was added to SSC culture medium at a concentration of 100 μM, and the cultures were grown for approximately 4 days. Then the medium was changed to fresh SSC culture medium. On the 6th day, Annexin V/7-AAD staining was performed

Table 1. Sequence of primers used in RT-PCR or qPCR assay Gene

Forward primer (5′→3′)

Reverse primer (5′→3′)

Etv5 Oct4 Plzf Dazl Armc6 Ddit4 Id4 Prdx4 Cst3 Cox7c Ddit3 Atf4 Gapdh

CTGGGGAACGCTACGTCTAC CCCGGAAGAGAAAGCGAACT TTCAGCCTCAAGCACCAGTT GCACTCAGTCTTCATCAGCAAC TGAAGATGTGGCTAAGGCCG CAAGGCAAGAGCTGCCATAG CAGTGCGATATGAACGACTGC CTCAAACTGACTGACTATCGTGG AGGAGGCAGATGCCAATGAG TCGCAGCCACTATGAGGAGG AACAGAGGTCACACGCACAT GCCTGACTCTGCTGCTTACA GGTTGTCTCCTGCGACTTCA

CCAGGAGGTAAGCAGGGTTG GGAAAGGTGTCCCTGTAGCC GGGCAGTATTCCGTGCAGAT CTATCTTCTGCACATCCACGTC CACCCACGTTCTGGAGTCAG CCGGTACTTAGCGTCAGGG GACTTTCTTGTTGGGCGGGAT CGATCCCCAAAAGCGATGATTTC GGGCTGGTCATGGAAAGGA ATAAAGAAAGGTGCGGCAAACC ACTTTCCGCTCGTTCTCCTG AAGGCAGATTGTCTGGTGGG TAGGGCCTCTCTTGCTCAGT

Figure 1. Characterization of SSCs from 6-day-old mice (A) Representative morphology of SSCs after culture for 2, 5, or 8 days. (B) Representative morphology of SSCs at passage 0 (P0) and passage 15 (P15). (C) RT-PCR analysis of MEFs, SSCs, and 6-day testis tissues. M, 100 bp DNA markers. Gapdh is a sample loading control. (D) Immunofluorescence analysis of SSCs with antibodies against Etv5, Oct4, or Plzf. Negative control (N.C.) is using Rhodamine (TRITC)-conjugated goat anti-rabbit IgG(H+L) when the primary antibody was omitted. Scale bar: 50 μm.


783


Figure 2. Effects of BPA on SSC viability in vitro (A) Appearance of control SSCs and SSCs treated with the indicated concentration of BPA. Scale bar: 50 μm. (B) CCK8 assay of control SSCs and SSCs treated with the indicated concentrations of BPA. All cell viability levels were normalized to the control group. *P < 0.05, by Tukey’s HSD test. (C) A schematic representation of the experiment to analyze the effect of BPA on SSCs in vitro. Established clusters, cultured under standard conditions, were digested and plated in designed groups of culture. SSCs were initially incubated with BPA for the indicated days, producing clusters (CFA culture in the first round). These clusters were digested into single cells, re-plated on a feeder layer, and cultured for an additional 6 days under the standard cluster-inducing condition without BPA, generating clusters (CFA culture in the second round). In the control group, SSCs were cultured similarly to the BPA-treated group for two culture cycles, but BPA was not used. (D) The CFA assay of SSCs in the first round. SSCs were treated with or without BPA at the indicated concentrations for 4 days. All cluster numbers were counted on the 6th day and normalized to the control group (without BPA). *P < 0.05, by Tukey’s HSD test. (E) The CFA assay of SSCs in the second round. The clusters of SSCs in the first round were re-plated into a secondary culture and cultured in medium without BPA. The groups in the second round were named as ‘0 μM’, ‘50 μM’, and ‘100 μM’, respectively. In each group, the cluster numbers were counted on the 12th day and normalized to the cluster numbers at the 6th day. P > 0.05, by Tukey’s HSD test.

using an Annexin V Apoptosis Detection Kit APC (eBiosciences, California, USA) according to the manufacturer’s instructions. The data generated by FACSCalibur Flow Cytometry (BD Biosciences, New Jersey, USA) were analyzed by FlowJo (version 7.6.1). Experiments were performed in triplicate.


Transcriptome analysis For RNA preparation, SSCs were incubated with or without 100 μM BPA for approximately 4 days. Then SSCs were collected and processed with TRIzol (Invitrogen). Total RNA was isolated using a miRNeasy Mini Kit (Qiagen, Hilden, Germany), and further

784


Figure 3. BPA-induced SSC apoptosis (A) TUNEL staining images of controls and 100 μM BPA-treated SSCs. More TUNEL-positive cells (white arrows) were found in the BPA-treated group than in the control group. Scale bar: 50 μm. (B) Flow cytometry analysis of controls and 100 μM BPA-treated SSCs. (C) Quantification of flow cytometry analysis. *P < 0.05, by Tukey’s HSD test.

purified using an RNAClean XP Kit (Beckman Coulter, Brea, USA) and RNase-free DNase Set (Qiagen). Sequencing libraries were constructed using a TruSeq RNA Sample Pre Kit v2–Set B (Illumina, San Diego, USA) according to the manufacturer’s instructions. Constructed RNA-Seq libraries were sequenced on a HiSeq 2500 system (Illumina). Three biological replicates were used for each sample. RNA-Seq reads for each sample were first cleaned using Seqtk (https://github.com/lh3/seqtk) and then aligned to the mouse genome (mm10, Genome Reference Consortium Mouse Build 38) using TopHat 2.0.9 software [24]. The number of reads mapped to each of the Ensembl genes (release 85) was counted using the HTSeq python package [25]. Normalization was carried out using TMM (trimmed mean of M values) and FPKM (Fragments Per Kilobase of exon model per Million mapped reads) values were calculated by a Perl script. The gene lists of RNA-Seq datasets were analyzed by PCA (Principal Component Analysis) using the Strand NGS PCA tool (Agilent, Santa Clara, USA). The R package edgeR [26] was used for differential expression analysis. Enrichment analysis was implemented using a hypergeometric model to assess whether the number of identified differentially expressed genes (DEGs) was larger than expected. The gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG)


databases were incorporated for identifying predominant biological themes of a collection of genes [27]. P-values were adjusted for multiple comparisons, and q-values were also calculated for false-discovery rate (FDR) control.

Reverse transcription-PCR and quantitative real-time PCR Total RNA extraction from cultured SSCs or MEFs or testes was performed as previously described [28]. Reverse transcription was performed using Reverse Transcriptase M-MLV (RNase H-) (TaKaRa, Dalian, China) according to the manufacturer’s instructions. For reverse transcription-PCR (RT-PCR), reaction conditions were 95°C for 3 min, then 35 cycles of 95°C for 15 s, 60°C for 15 s and 72°C for 20 s, followed by 72°C for 1 min, using Taq polymerase. Quantitative real-time PCR (qPCR) was performed with a 7500 real-time PCR amplification system using SYBR Green PCR master mix (Roche, Basel, Switzerland). The relative levels of transcripts were calculated using the comparative ΔΔCT method within the 7500 System Software (ABI, Foster City, USA) and all of the gene expression levels were normalized to Gapdh. Primers employed are listed in Table 1.

785


Statistical analysis The data were analyzed by one-way ANOVA using R program (version 3.2.1), and Tukey’s test was used to locate differences. The data are expressed as the mean ± SEM.

Results Isolation and characterization of spermatogonial stem cells According to the established method [15,16], we isolated and cultured SSCs from 6-day-old DBA/2 × C57BL/6 F1 hybrid mice. SSCs on an MMC-treated MEF feeder layer formed typical colonies and SSCs were used successfully to re-establish cell culture after cryopreservation and thawing (Fig. 1A,B). To characterize SSCs, the expressions of Oct4, Plzf, Etv5, and Dazl in SSCs were confirmed using RT-PCR analysis (Fig. 1C). Immunofluorescence analysis confirmed the expression of Etv5, Oct4, and Plzf proteins (Fig. 1D). Collectively, these results suggested that these cultured SSCs exhibited behavior and markers consistent with previously reported morphology and germline lineage properties of SSCs [11,29].

Effects of BPA on spermatogonial stem cell viability in vitro Based on previous studies [30–32], the exposure scheme consisted of two different doses of BPA: 50 and 100 μM. BPA caused changes in the growth of SSCs: clump size was reduced, and SSCs became

detached from clumps (Fig. 2A). After assessing the effects of BPA at various concentrations (50 and 100 μM) on SSCs by CCK8 assay, we found that BPA treatment significantly suppressed the viability of SSCs (Fig. 2B). BPA reduced the number of SSCs, which indicated that proliferation rate of SSCs was inhibited by BPA (Supplementary Fig. S1). To further confirm the effects of BPA, we performed CFA assay as shown in Fig. 2C [23,33]. In the 1st round of CFA, on the 6th day, the number of SSC clusters (Day-6 values) was counted and a significant decrease of normalized cluster number was observed in SSC cultures exposed to 100 μM BPA (Fig. 2D). In the 2nd round of CFA, BPA treatment was withdrawn and SSCs were subcultured into new SSC culture medium. the number of SSC clusters (Day-12 values) was counted on the 12th day following initial treatment, and the data were normalized to the Day-6 values for each concentration. It was found that the normalized cluster numbers of different groups were not significantly different (P > 0.05, Tukey’s HSD test; Fig. 2E). This suggested that BPA did not decrease the ability of SSC proliferation, but likely reduced SSC survival.

BPA induces SSC apoptosis To determine whether BPA induces apoptosis of SSCs, TUNEL staining and flow cytometry analysis were carried out on BPA-treated SSCs. TUNEL staining revealed that SSCs treated with 100 μM BPA showed increased signal intensity (Fig. 3A). Semiquantitative analysis of TUNEL staining results indicated that the percentage of TUNEL-positive cells was significantly higher in BPA-treated SSCs (Supplementary Fig. S2, P < 0.05). This was confirmed by flow

Table 2. Alignment and quantification statistics in each RNA-Seq library sample Library

Raw reads

Q20 ratio

Cleaned reads

Mapped reads

Mapped unique reads

Mapping ratio

CON_1 CON_2 CON_3 BPA_1 BPA_2 BPA_3

57,719,308 41,205,040 42,296,794 44,455,584 62,913,252 64,466,380

96.40% 96.34% 95.65% 96.30% 96.84% 96.94%

52,232,162 37,507,235 37,989,993 39,080,580 55,952,159 58,011,011

45,736,015 32,166,144 33,483,754 33,896,980 49,987,741 51,950,966

43,227,533 30,252,048 31,756,210 32,173,602 48,228,815 49,912,222

82.76% 80.66% 83.59% 82.33% 86.20% 86.04%

Mapping ratio = mapped unique reads/cleaned reads; CON: untreated SSCs; BPA: BPA-treated SSCs.

Figure 4. RNA-Seq transcriptional profiling of BPA-treated SSCs and controls (A) Pie charts showing the composition and quantity of each reference gene type in the Ensembl genome browser for each RNA-Seq dataset. (B) Comparative analysis of reference gene expression levels in each RNA-Seq dataset. The left side scatter plots display the relationship between each gene expression pattern. The right side numbers are the Pearson’s correlation coefficients.


786 cytometry results. Of the untreated control cells, 1.750% was early stage apoptotic cells and 0.124% later stage apoptotic cells (Fig. 3B). In contrast, 3.950% and 0.385% of BPA-treated cells were early or later stage apoptotic cells, respectively (Fig. 3B). The percentage of SSCs in apoptosis was 1.874% for control cells and 4.335% for BPA-treated SSCs, respectively (Fig. 3B). Compared with the controls, the percentage of apoptotic SSCs was significantly higher in BPA-treated SSCs (Fig. 3C). Taken together, these results suggested that BPA induced SSC apoptosis.

Effects of BPA on spermatogonial stem cells mouse GRCm38/mm10 reference genome showed that 76.4%– 76.5% of transcripts associated with read encoded proteins in all profiles (Fig. 4A). The correlation coefficient between BPA-treated SSC transcriptome profiles was high (r = 0.92–0.93; Fig. 4B). The correlation value between control and BPA-treated datasets was 0.90–0.92 (Fig. 4B). The data has been deposited at the gene expression omnibus (GEO) database with accession No. GSE89551.

Differential gene expression between BPA-treated spermatogonial stem cells and controls Gene expression profiling for BPA-treated spermatogonial stem cells RNA-Seq was conducted to reveal transcriptome changes in BPAtreated SSCs. After data cleaning and quality control, our RNA-Seq analysis yielded 30.2–49.9 million unique aligned reads (Table 2), in which the mapping rates were 80.66%–86.20%. Alignment to the

After transcriptome analysis of BPA-treated SSCs or controls, 18,272 expressed genes (the data of gene expression can be found in GEO database, accession No. GSE89551) were identified. Furthermore, PCA demonstrated that the genes contained within transcriptome datasets were separated into two clusters. One was comprised of controls and the other was comprised of BPA-treated SSCs (Fig. 5A).

Figure 5. Differential gene expression profiles of BPA-treated SSCs and controls (A) PCA analysis. (B) Volcano plot of differentially expressed genes. Red and blue dots indicate genes with statistically significant changes in gene expression. (C) Heat-map showing expression profiles of DEGs identified by the volcano plot. The intensity increases from green to red. Con: Control; BPA: BPA-treated SSCs. (D) qPCR analysis. Expression levels are shown in log2 values.


787

Effects of BPA on spermatogonial stem cells Therefore, we conducted an analysis to identify DEGs that arose from BPA-treated SSCs. These genes were screened based on two parameters: a fold change (FC) of at least 2 between the two datasets and a statistical significance determined using a moderated t-test with a Benjamini–Hochberg FDR at P ≤ 0.05. Compared with the control, 860 DEGs were identified in BPA-treated SSCs. Among the 860 DEGs, 514 were increased and 346 were decreased (Fig. 5B,C). Quantitative PCR analysis was carried out according to MIQE guidelines [34] to validate RNA-Seq results by 6 randomly selected DEGs. As shown in Fig. 5D, the qPCR results showed that the

expression patterns of the selected genes (Armc6, Ddit4, Cox7c, Cst3, Prdx4, and Id4) in BPA-treated SSCs or controls were consistent with the measured FPKM values of these genes, and the sequencing results were correlated with the qPCR results.

GO and KEGG analysis Using a hypergeometric model, we performed GO (biological process) and KEGG analysis for the DEG datasets (Fig. 6). The clusterProfiler [27], an R package from bioconductor, was used for GO analysis.

Figure 6. Biological significance of expressed genes in BPA-treated SSCs (A) GO enrichment analysis of SSCs. The most highly enriched biological processes based on their respective gene counts are shown (q-value < 0.01). (B) Pathway enrichment analysis of different expression transcript lists in BPA-treated SSCs. The indicated enriched pathways observed in BPA-treated SSCs were determined (q-value < 0.7).


788


Figure 7. Differentially expressed genes in the apoptosis pathway (A) Apoptosis pathway view of DEGs in BPA-treated SSCs. Expression levels are shown in log2 values. (B) The mRNA expressions of Aft4 and Ddit3 determined by qPCR.

GO analysis revealed significant enrichment of specific GO terms among mRNAs differentially expressed in BPA-treated SSCs (Fig. 6A). Among 826 DEGs, 99 DEGs or 98 DEGs were associated with the GO terms regulation of programmed cell death or regulation of apoptotic process, respectively. KEGG analysis was also performed using the BioCarta program. A strong enrichment was observed for genes involved in apoptosis (Fig. 6B). Pathview package was used to map and render the DEG datasets on the apoptosis pathway graph. Among genes in the apoptosis pathway (Fig. 7A), Atf4, Ddit3, and several pro-apoptotic genes were highly expressed in BPA-treated


SSCs. Our qPCR results were consistent with those obtained by RNA-Seq and showed that the mRNA expressions of Atf4 and Ddit3 were up-regulated (Fig. 7B) in BPA-treated SSCs.

Discussion SSCs, comprising 1 in 3000 ~ 4000 cells of the adult mouse testes, are the only germline stem cells that support the extremely active spermatogenesis process [35,36]. Based on Kanatsu-Shinohara’s methods [15,16], we established long-term spermatogonial stem cell culture (Fig. 1A,B).

789

Effects of BPA on spermatogonial stem cells The expressions of those genes that are functionally related to stem cell renewal (Oct4, Etv5, and Plzf) and germ cells (Dazl) were detected in the established in vitro propagation of mouse SSCs (Fig. 1C,D). Cultures of mouse SSCs show a normal euploid karyotype after 139 passages (∼2 years of culture), indicating that they remain genetically highly stable even after prolonged exposure to in vitro culture conditions [22]. Therefore, SSCs (> 10 passages) were used in the subsequent experiments. BPA possesses weak estrogenic, anti-androgenic, and anti-thyroid activities, and it is a reproductive toxicant [2]. Spermatogenesis is dependent upon androgens, and alterations that impact the endocrine environment of the testes have the potential to adversely affect sperm production and quality. Both low- and high-dose BPA exposures during early postnatal development or around the time of puberty increased apoptosis and/or decreased spermatogenesis in male mice and rats [37–39]. Considering the toxicological importance of BPA, here we attempted to investigate whether several concentrations of BPA would affect SSC viability. It has been demonstrated that low dose of BPA (~0.01 μM) advances early embryonic development, whereas a comparatively higher dose (~100 μM) decreases the development rate of the embryo [30,31]. Similar adverse reproductive effects have been reported in multiple studies, but a few studies failed to reveal any adverse reproductive effects in rodent models [2]. These discrepancies may be related to a variety of factors, including dose, exposure route, internal dose, timing, and species. More recently, high concentration of BPA (~100 μM) was reported to negatively affect sperm motility, viability, mitochondrial functions in in vitro model of mouse spermatozoa [32]. Therefore, high concentrations of BPA (50 μM and 100 μM) were adopted in current study to clarify adverse effect levels of BPA in in vitro model of SSCs. High concentration of BPA (100 μM) reduced SSC viability (Fig. 2). SSCs on an MMC-treated MEF feeder layer formed typical colonies (Fig. 1A,B). In the definitive SSC activity assay, the establishment of colonies two months after spermatogonial transplantation qualitatively demonstrates SSC activity, while the number of colonies found in a recipient testis indicates the number of functional SSCs [40,41]. Likewise, in the CFA assay, the number of clusters indicates the relative SSC activity [23]. In the first round of CFA assay, normalized cluster number was significantly decreased following 100 μM BPA treatment (Fig. 2D). The clusters of SSCs were typically nonspherical, but rather appeared as globular three-dimensional structures attached to the feeder layer. To unmask SSC proliferation taking place inside clusters, we subcultured SSCs in each group without BPA treatment. In the second round of CFA assay, the normalized cluster number of each group was not significantly different (Fig. 2E). The results suggest that BPA did not suppress the ability of SSC proliferation, but likely reduced SSC survival. Furthermore, this suggested that the effects of BPA on SSCs were reversible, which was consistent with previous studies [42]. BPA was shown to induce the apoptosis of germ cells [43,44]. In in vitro model of SSCs, 100 μM BPA induced SSC apoptosis (Fig. 3). Histological analysis revealed that BPAtreated testes at postnatal Day 21 or 22 contained mostly spermatogonia and spermatocytes with markedly less round spermatids and the number of apoptotic germ cells was increased [43,44]. SSCs, the undifferentiated spermatogonia, were settled at the basal membrane and could differentiate into differentiated spermatogonia and undergo meiotic maturation into spermatocytes. Although histological analysis revealed apoptotic germ cells [43,44], these studies did not quantify apoptotic germ cells in each specfic spermatogonia developmental stage, such as undifferentiated spermatogonia and differentiated spermatogonia. Using the current model of BPA-treated SSCs, it is


hard to investigate whether the SSC population is more susceptible to apoptosis than the differentiated spermatogonia. Collectively, our findings support that BPA (~100 μM) reduces the viability of SSCs by inducing apoptosis. The concentration of BPA in human serum and tissues was ranging from zero to hundreds of nanomolar [1], far lower than the dose used in the study. The effects of BPA can be dependent on a variety of factors, such as dose, timing, and species. In in vitro model of SSCs, short-term exposure to high concentration of BPA induced apoptosis. In animal models, studies also suggest that BPA may be a testicular toxicant, but the data in humans are equivocal [2]. Further studies are needed to evaluate the effect of the ubiquitous and continuous exposure to BPA in mice or humans, using the model of long-term exposure to BPA. To reveal transcriptome changes in BPA-treated SSCs, we conducted RNA-Seq (Fig. 4). Totally 860 DEGs were identified between BPA-treated SSCs and controls (Fig. 5B,C). The DEGs in the KEGG apoptosis pathway may play a role in the mechanism of the effect of BPA on SSCs (Fig. 7A). Among these DEGs, the mRNA expressions of Atf4 and Ddit3 were higher in BPA-treated SSCs (Fig. 7). It has been reported that Atf4 is involved in farnesol activating apoptosis in human T lymphoblastic leukemia Molt4 cells [45] and Atf4 activation mediates apoptosis induced by selenite in Jurkat cells [46]. In future experiments, we will investigate whether silencing the gene expression of Atf4 can rescue the decreased cell viability or apoptosis in BPA-treated SSCs. Atf4 is a transcription factor and activates the expression of Ddit3 [47]. Under conditions of prolonged endoplasmic reticulum (ER) stress, apoptotic cell death ensues by Atf4/Ddit3-mediated induction of several pro-apoptotic genes and suppression of the synthesis of anti-apoptotic Bcl-2 proteins [48]. These indicated that the Atf4/Ddit3-mediated mitochondrial pathway might be involved in BPA-induced apoptosis of SSCs. As shown in Fig. 7A, the mRNA levels of apoptotic genes (Bax, Bcl-2, and caspase associated genes) in mitochondrial pathway were not differently expressed, which were detected by RNA-Seq. The protein levels of these apoptotic genes need to be determined. Therefore, further researches on the relationship among Atf4, Ddit3 and mitochondrial apoptosis pathway need to be carried out in future. Collectively, we found that 860 DEGs were differentially expressed in BPA-treated SSCs, in which apoptosis-related GO terms and pathways were enriched. Our results strongly indicate that BPA reduces SSC viability and induces SSC apoptosis. However, further studies are required to reveal the mechanism in BPA-induced apoptosis of SSCs and to better enrich our understanding of the effects of BPA on SSCs.

Supplementary Data Supplementary data is available at Acta Biochimica et Biophysica Sinica online.

Acknowledgment The authors would like to thank Junping Ao in the State Key laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute (Shanghai, China) for the technical assistance.

Funding This work was supported by the grants from the National Basic Research Program of China (Nos. 2013CB967401 and 2013CB967404), the National Nature Science Foundation of China (Nos. 81370675 and

790


81421061), and Shanghai Jiao Tong University Medicine-Engineering Fund (Nos. YG2014ZD04 and YG2014ZD08). 20.

References 1. Vandenberg LN, Hauser R, Marcus M, Olea N, Welshons WV. Human exposure to bisphenol A (BPA). Reprod Toxicol 2007, 24: 139–177. 2. Peretz J, Vrooman L, Ricke WA, Hunt PA, Ehrlich S, Hauser R, Padmanabhan V, et al. Bisphenol A and reproductive health: update of experimental and human evidence, 2007–2013. Environ Health Perspect 2014, 122: 775–786. 3. vom Saal FS, Cooke PS, Buchanan DL, Palanza P, Thayer KA, Nagel SC, Parmigiani S, et al. A physiologically based approach to the study of bisphenol A and other estrogenic chemicals on the size of reproductive organs, daily sperm production, and behavior. Toxicol Ind Health 1998, 14: 239–260. 4. Meeker JD, Ehrlich S, Toth TL, Wright DL, Calafat AM, Trisini AT, Ye X, et al. Semen quality and sperm DNA damage in relation to urinary bisphenol A among men from an infertility clinic. Reprod Toxicol 2010, 30: 532–539. 5. Tiwari D, Vanage G. Mutagenic effect of bisphenol A on adult rat male germ cells and their fertility. Reprod Toxicol 2013, 40: 60–68. 6. Rahman MS, Kwon WS, Karmakar PC, Yoon SJ, Ryu BY, Pang MG. Gestational exposure to bisphenol A affects the function and proteome profile of F1 spermatozoa in adult mice. Environ Health Perspect 2017, 125: 238–245. 7. Rahman MS, Kwon WS, Lee JS, Yoon SJ, Ryu BY, Pang MG. BisphenolA affects male fertility via fertility-related proteins in spermatozoa. Sci Rep 2015, 5: 9169. 8. Anway MD, Cupp AS, Uzumcu M, Skinner MK. Epigenetic transgenerational actions of endocrine disruptors and male fertility. Science 2005, 308: 1466–1469. 9. Liu C, Duan W, Zhang L, Xu S, Li R, Chen C, He M, et al. Bisphenol A exposure at an environmentally relevant dose induces meiotic abnormalities in adult male rats. Cell Tissue Res 2014, 355: 223–232. 10. Oatley JM, Brinster RL. Spermatogonial stem cells. Methods Enzymol 2006, 419: 259–282. 11. Oatley JM, Brinster RL. Regulation of spermatogonial stem cell selfrenewal in mammals. Annu Rev Cell Dev Biol 2008, 24: 263–286. 12. Oatley JM, Avarbock MR, Brinster RL. Glial cell line-derived neurotrophic factor regulation of genes essential for self-renewal of mouse spermatogonial stem cells is dependent on Src family kinase signaling. J Biol Chem 2007, 282: 25842–25851. 13. Fu XF, Cheng SF, Wang LQ, Yin S, De Felici M, Shen W. DAZ family proteins, key players for germ cell development. Int J Biol Sci 2015, 11: 1226–1235. 14. Phillips BT, Gassei K, Orwig KE. Spermatogonial stem cell regulation and spermatogenesis. Philos Trans R Soc Lond B Biol Sci 2010, 365: 1663–1678. 15. Kanatsu-Shinohara M, Ogonuki N, Inoue K, Miki H, Ogura A, Toyokuni S, Shinohara T. Long-term proliferation in culture and germline transmission of mouse male germline stem cells. Biol Reprod 2003, 69: 612–616. 16. Falciatori I, Lillard-Wetherell K, Wu Z, Hamra FK, Garbers DL. Deriving mouse spermatogonial stem cell lines. Methods Mol Biol 2008, 450: 181–192. 17. Takashima S, Kanatsu-Shinohara M, Tanaka T, Morimoto H, Inoue K, Ogonuki N, Jijiwa M, et al. Functional differences between GDNFdependent and FGF2-dependent mouse spermatogonial stem cell selfrenewal. Stem Cell Reports 2015, 4: 489–502. 18. Akingbemi BT, Sottas CM, Koulova AI, Klinefelter GR, Hardy MP. Inhibition of testicular steroidogenesis by the xenoestrogen bisphenol A is associated with reduced pituitary luteinizing hormone secretion and decreased steroidogenic enzyme gene expression in rat Leydig cells. Endocrinology 2004, 145: 592–603. 19. N’Tumba-Byn T, Moison D, Lacroix M, Lecureuil C, Lesage L, Prud’homme SM, Pozzi-Gaudin S, et al. Differential effects of bisphenol


21.

22.

23. 24. 25. 26.

27.

28.

29. 30.

31.

32.

33.

34.

35. 36.

37.

38.

39.

40.

41.

A and diethylstilbestrol on human, rat and mouse fetal leydig cell function. PLoS One 2012, 7: e51579. Salian S, Doshi T, Vanage G. Neonatal exposure of male rats to bisphenol A impairs fertility and expression of sertoli cell junctional proteins in the testis. Toxicology 2009, 265: 56–67. Vrooman LA, Oatley JM, Griswold JE, Hassold TJ, Hunt PA. Estrogenic exposure alters the spermatogonial stem cells in the developing testis, permanently reducing crossover levels in the adult. PLoS Genet 2015, 11: e1004949. Kanatsu-Shinohara M, Ogonuki N, Iwano T, Lee J, Kazuki Y, Inoue K, Miki H, et al. Genetic and epigenetic properties of mouse male germline stem cells during long-term culture. Development 2005, 132: 4155–4163. Yeh JR, Zhang X, Nagano MC. Establishment of a short-term in vitro assay for mouse spermatogonial stem cells. Biol Reprod 2007, 77: 897–904. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25: 1105–1111. Anders S, Pyl PT, Huber W. HTSeq—a Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31: 166–169. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26: 139–140. Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 2012, 16: 284–287. Zou K, Yuan Z, Yang Z, Luo H, Sun K, Zhou L, Xiang J, et al. Production of offspring from a germline stem cell line derived from neonatal ovaries. Nat Cell Biol 2009, 11: 631–636. de Rooij DG. Proliferation and differentiation of spermatogonial stem cells. Reproduction 2001, 121: 347–354. Takai Y, Tsutsumi O, Ikezuki Y, Hiroi H, Osuga Y, Momoeda M, Yano T, et al. Estrogen receptor-mediated effects of a xenoestrogen, bisphenol A, on preimplantation mouse embryos. Biochem Biophys Res Commun 2000, 270: 918–921. Takai Y, Tsutsumi O, Ikezuki Y, Kamei Y, Osuga Y, Yano T, Taketan Y. Preimplantation exposure to bisphenol A advances postnatal development. Reprod Toxicol 2001, 15: 71–74. Rahman MS, Kwon WS, Yoon SJ, Park YJ, Ryu BY, Pang MG. A novel approach to assessing bisphenol-A hazards using an in vitro model system. BMC Genomics 2016, 17: 577. Nagano MC, Yeh JR. The cluster-forming activity assay: a short-term in vitro method to analyze the activity of mouse spermatogonial stem cells. In Orwig KE, Hermann BP (eds). Male Germline Stem Cells: Developmental and Regenerative Potential. USA: Humana Press, 2011, 125–134. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 2009, 55: 611–622. de Rooij DG, Griswold MD. Questions about spermatogonia posed and answered since 2000. J Androl 2012, 33: 1085–1095. Tegelenbosch RA, de Rooij DG. A quantitative study of spermatogonial multiplication and stem cell renewal in the C3H/101 F1 hybrid mouse. Mutat Res 1993, 290: 193–200. Li YJ, Song TB, Cai YY, Zhou JS, Song X, Zhao X, Wu XL. Bisphenol A exposure induces apoptosis and upregulation of Fas/FasL and caspase-3 expression in the testes of mice. Toxicol Sci 2009, 108: 427–436. Liu C, Duan W, Li R, Xu S, Zhang L, Chen C, He M, et al. Exposure to bisphenol A disrupts meiotic progression during spermatogenesis in adult rats through estrogen-like activity. Cell Death Dis 2013, 4: e676. Qiu LL, Wang X, Zhang XH, Zhang Z, Gu J, Liu L, Wang Y, et al. Decreased androgen receptor expression may contribute to spermatogenesis failure in rats exposed to low concentration of bisphenol A. Toxicol Lett 2013, 219: 116–124. Nagano M, Avarbock MR, Brinster RL. Pattern and kinetics of mouse donor spermatogonial stem cell colonization in recipient testes. Biol Reprod 1999, 60: 1429–1436. Zhang X, Ebata KT, Nagano MC. Genetic analysis of the clonal origin of regenerating mouse spermatogenesis following transplantation. Biol Reprod 2003, 69: 1872–1878.

Effects of BPA on spermatogonial stem cells 42. Toyama Y, Yuasa S. Effects of neonatal administration of 17betaestradiol, beta-estradiol 3-benzoate, or bisphenol A on mouse and rat spermatogenesis. Reprod Toxicol 2004, 19: 181–188. 43. Urriola-Munoz P, Lagos-Cabre R, Moreno RD. A mechanism of male germ cell apoptosis induced by bisphenol-A and nonylphenol involving ADAM17 and p38 MAPK activation. PLoS One 2014, 9: e113793. 44. Xie M, Bu P, Li F, Lan S, Wu H, Yuan L, Wang Y. Neonatal bisphenol A exposure induces meiotic arrest and apoptosis of spermatogenic cells. Oncotarget 2016, 7: 10606–10615. 45. Joo JH, Ueda E, Bortner CD, Yang XP, Liao G, Jetten AM. Farnesol activates the intrinsic pathway of apoptosis and the ATF4-ATF3-CHOP


791 cascade of ER stress in human T lymphoblastic leukemia Molt4 cells. Biochem Pharmacol 2015, 97: 256–268. 46. Jiang Q, Li F, Shi K, Wu P, An J, Yang Y, Xu C. ATF4 activation by the p38MAPK-eIF4E axis mediates apoptosis and autophagy induced by selenite in Jurkat cells. FEBS Lett 2013, 587: 2420–2429. 47. Averous J, Bruhat A, Jousse C, Carraro V, Thiel G, Fafournoux P. Induction of CHOP expression by amino acid limitation requires both ATF4 expression and ATF2 phosphorylation. J Biol Chem 2004, 279: 5288–5297. 48. Rozpedek W, Pytel D, Mucha B, Leszczynska H, Diehl JA, Majsterek I. The role of the PERK/eIF2alpha/ATF4/CHOP signaling pathway in tumor progression during endoplasmic reticulum stress. Curr Mol Med 2016, 16: 533–544.