Boronic Acid Functionalized Au Nanoparticles for

Article Cite This: ACS Sens. 2018, 3, 929−935

pubs.acs.org/acssensors

Boronic Acid Functionalized Au Nanoparticles for Selective MicroRNA Signal Amplification in Fiber-Optic Surface Plasmon Resonance Sensing System Siyu Qian,† Ming Lin,† Wei Ji,*,‡ Huizhen Yuan,† Yang Zhang,† Zhenguo Jing,† Jianzhang Zhao,‡ Jean-François Masson,§ and Wei Peng*,† †

College of Physics and Optoelectronics Engineering and ‡State Key Laboratory of Fine Chemicals, Dalian University of Technology, Dalian, 116024, China § Department of Chemistry, Université de Montréal, Montréal, Québec H3C 3J7, Canada S Supporting Information *

ABSTRACT: MicroRNA (miRNA) regulates gene expression and plays a fundamental role in multiple biological processes. However, if both single-stranded RNA and DNA can bind with capture DNA on the sensing surface, selectively amplifying the complementary RNA signal is still challenging for researchers. Fiberoptic surface plasmon resonance (SPR) sensors are small, accurate, and convenient tools for monitoring biological interaction. In this paper, we present a high sensitivity microRNA detection technique using phenylboronic acid functionalized Au nanoparticles (PBA-AuNPs) in fiber-optic SPR sensing systems. Due to the inherent difficulty directly detecting the hybridized RNA on the sensing surface, the PBA-AuNPs were used to selectively amplify the signal of target miRNA. The result shows that the method has high selectivity and sensitivity for miRNA, with a detection limit at 2.7 × 10−13 M (0.27 pM). This PBA-AuNPs amplification strategy is universally applicable for RNA detection with various sensing technologies, such as surface-enhanced Raman spectroscopy and electrochemistry, among others. KEYWORDS: boronic acid, surface plasmon resonance (SPR), fiber-optic SPR sensors, microRNA detection, gold nanoparticles

N

complementary DNA from the surface of Au@PDA microtube, which lead to the fluorescence enhancement.17 Peng et al. proposed a rolling circle amplification (RCA) method for miRNA detection on electrode surface. The DNA tetrahedron decorated gold electrode was employed as the recognition interface. Then, hybridization between DNA tetrahedron, microRNA, and primer probe initiated RCA on the electrode surface. Silver nanoparticles attached to the PCA products provided a significant electrical signal.18 In most sandwich structures, complementary DNA was usually selected as a recognition unit to load on the enhancing object. The complex fabrication process of enhancing objects is inconvenient in realtime detection, because it needs to change the DNA sequence on the enhancing object for complementary pairing with different nucleic acid analytes. Thus, developing a simple and convenient method for highly sensitive and selective nucleic acid detection is still a challenge. SPR sensing is attractive for RNA detection. Due to the collective oscillation of electrons at the interface of metal/ dielectric, SPR sensing is capable of detecting refractive index changes around sensing surface.19 SPR sensing has the unique

ucleic acid detection is increasingly recognized as a valuable tool for fundamental studies not only in the biological and biomedical fields, but also for disease diagnosis and treatment.1,2 MicroRNA (miRNA) is a small noncoding sequence with 19 to 23 nucleotides that plays important roles in cell proliferation, differentiation,3,4 and tumors.5,6 For instance, Lethal-7 (Let-7) is one of the first discovered miRNA.7 Let-7a, a family member of Let-7, can suppress the tumor cell growth and metastasis, which have great potential for cancer therapy.8,9 Thus, developing a simple and convenient method for miRNA detection is essential for understanding the mechanism of gene regulation and disease therapy. In the past decades, different strategies have been proposed for nucleic acid detection, such as fluorescence,10 electrochemistry,11,12 surfaceenhanced Raman scattering,13 and surface plasmon resonance (SPR)14,15 among others. Despite these advances, efforts must still be deployed for improving nucleic acid sensing, specifically for improving the sensitivity and selectivity. Wang et al. used CdTe/CdS core−shell quantum dots for DNA and miRNA detection. With the addition of target nucleic acid sequence, the fluorescence intensity of quantum dots was quenched by an organic quencher via Förster resonance energy transfer.16 Zou et al. reported a novel two-step method to construct gold-nanorod functionalized polydiacetylene microtube for miRNA detection. The miRNA can displace the © 2018 American Chemical Society

Received: November 23, 2017 Accepted: May 9, 2018 Published: May 9, 2018 929

DOI: 10.1021/acssensors.7b00871 ACS Sens. 2018, 3, 929−935

Article

ACS Sensors

Figure 1. Schematic representation of miRNA detection by fiber-optic SPR sensing system: (I) Capture DNA/MCH modification on the sensing surface. (II) Single-stranded RNA or DNA hybrid on the sensing surface. (III) PBA-AuNPs selectively bind with RNA to amplify the signal.

research.28,29 While most boronic acid-based research has focused on the purification and detection of sugar or glycoprotein,30,31 the application of boronic acid in nucleic acid recognition is attractive despite not being widely reported. RNA can be selectively recognized by boronic acid through binding with the cis-diol group, which is lacking in DNA and thus imparts the selectivity of boronic acids for RNA in the presence of DNA. In this paper, the phenylboronic acid modified AuNPs were synthesized and used to selectively amplify the miRNA (Let-7a) signal in fiber-optic SPR sensing systems.

ability of being insensitive to electromagnetic interference, while also promoting sample integrity and avoiding contamination of the sample. Most of the commercial SPR instruments are based on Kretschmann prism configuration.20,21 The shortcomings of prism-based SPR instruments are complex optics and mechanical structure, making them more difficult to engineer for remote sensing. In contrast, fiber-optic SPR sensors with their compact size and simple structure are very convenient for implanting and indwelling sensing in vivo in clinical test and disease diagnosis.22 In most cases, the SPR sensing technique is usually applied to study the interaction of analytes with high molecular weight. The detection of small molecular weight analytes is still challenging, as these analytes cause slight refractive index changes that are more difficult to detect. In these cases, extrinsic labels should be utilized to enhance the SPR signal via formation of a sandwich structure.23 Au nanoparticles (AuNPs) with unique characteristics, such as high density, large dielectric constant, and good biocompatibility, are ideal materials for signal enhancement.24 However, classical AuNPs need to be modified by a unique nucleic acid with complementary sequences for specific nucleic acid detection and, thus, are not generally applicable. Each new assay design requires the reoptimization of AuNPs, which is time-consuming and costly. In order to develop a universal nanoparticle-based amplification strategy for RNA, one must exploit the ubiquitous ribose backbone of RNA. Boronic acid can specific bind with cis-diol groups and has been widely used in sensor technology,25,26 chromatography,27 and biological

■

EXPERIMENTAL SECTION

Materials. All the DNA and RNA single strand sequences were purchased from Sheng Gong Co. Ltd. (Shanghai, China). 6-Mercapto1-hexanol (MCH) and ethylenediaminetetraacetic acid (EDTA) were purchased from TCI. Diethyl pyrocarbonate (DEPC) was purchased from J&K Chemical. Water was treated with DEPC and autoclaved for 25 min before used. Fiber-Optic SPR Sensing System. The sensing fiber is multimode with core diameter of 400 μm and numerical aperture of 0.37, as described in previous studies.32 Briefly, the fiber was first cut into 7 cm pieces. The jacket and cladding were removed for 5 mm length in the center of the fiber as the sensing surface. Finally, a 2 nm Cr and 50 nm Au were sputtered on the sensing surface consecutively on the sensing region by ion beam sputtering deposition. The sensing part of the fiber was connected to the sensing system by two SMA905 connectors. In detection process, a halogen light source (HL-2000, Ocean Optics) was coupled to the fiber optic SPR 930


Article

ACS Sensors

Figure 2. Principle of PBA binds with RNA. Boronic acid can selectively recognize RNA through binding with cis-diol group in RNA unit. probe. Through total internal reflection, surface plasmons were excited at the interface of the metal layer. A resonance dip was found in the transmission spectrum of the SPR sensor, which can be measured by a spectrometer (HR4000, Ocean Optics). The signal was analyzed and processed in real time by a custom Labview program. Sensing Surface Modification. After sputtering the metal layer on the sensing surface, the fiber-optic SPR probe was immediately immersed in 1.0 μM HS-ssDNA and 1.0 μM MCH in 1.0 M KH2PO4 solution for 2 h. The probe was then transferred to 1 mM MCH aqueous solution for 1 h. The high concentration of MCH treatment can remove the physical adsorption of HS-ssDNA and block the unreacted surface, which is necessary to reduce the nonspecific binding.33 The sensing region was rinsed thoroughly with water and dried before hybridization. AuNPs Preparation and Modification with PBA. The AuNPs were synthesized according the method previously reported with slight modifications.34,35 Before the experiment, all the glassware was thoroughly washed in aqua regia (HCl:HNO3 = 3:1) for 2 h, then rinsed with deionized water and dried. In 250 mL round-bottom flasks, 1 mL of 1% HAuCl4 and 100 mL deionized water were mixed and heated to boiling under vigorous stirring. Then, 4 mL of 1% sodium citrate aqueous solution was rapidly added and boiling was continued for 15 min. During this time, the mixture solution gradually turned to red wine. The average diameter of AuNPs was 19 nm (Figure S1). The synthetic methods for m-mercapto alkylphenylboronic acid (referred to PBA) is reported previously (Figure S2, S3). For PBAAuNPs fabrication, a total of 10 μL 1 mM PBA in ethanol was added to 5 mL of the AuNPs with stirring for 2 h and kept at room temperature for 4 h before use. HS-ssDNA/MCH Monolayer and PBA-AuNPs Characterization. XPS served to verify the HS-ssDNA/MCH modification on optic-fiber. The elemental composition on the sensing surface was analyzed with an ESCALAB 250Xi (ThermoFisher) and Al Kα source with an energy step of 0.050 eV. The analysis was performed by scanning the sample 20 times. The XPS spectrum was calibrated by the C1s binding energy. Silicon wafers instead of fiber-optic were used for the HS-ssDNA/MCH monolayer characterization. Briefly, 2 nm Cr and 50 nm Au were subsequently sputtered on the silicon wafer surface. The sensing surface modification procedure is the same as described above for the fiber-optic sensor. For PBA-AuNPs characterization, nanoparticles were centrifuged, dropped on silicon wafer, and dried. The PBA-AuNPs on silicon wafer were characterized by attenuated total reflection (ATR) infrared spectrometer (Nicolet iN10 MX and iS10). Nucleic Acid Hybridization and Signal Amplification on the Sensing Surface. As shown in Figure 1, the hybridization process was performed in a hybridization buffer (10 mM phosphate buffer pH 7.0 with 0.3 M NaCl and 1 mM EDTA). The single-stranded RNA or DNA in hybridization buffer were incubated on sensing surface for 2 h. After the hybridization, the sensing region was thoroughly rinsed with

water. Then, the sensing surface was further incubated with PBAAuNPs for 30 min.

■

RESULTS AND DISCUSSION

Principle of miRNA Detection by PBA-AuNPs. We propose a novel approach for detection of miRNA by using PBA-AuNPs as a generally applicable signal amplification technique in RNA sensing, demonstrated here with fiber optic SPR sensing system. The capture single-stranded DNA (HS-ssDNA) was first immobilized on the sensing surface (Figure 1). The capture DNA can bind with the target RNA with a specific sequence through complementary pairing. Generally, RNA leads to a low signal response in SPR sensing system due to its low molecular weight. By contrast, AuNPs with high mass are able to induce a huge variation in refractive index after attaching on the sensing surface. The electromagnetic field coupling between the plasmonic AuNPs (localized surface plasmon resonance, LSPR) and propagating plasmons on the gold surface can further inducing signal amplifying in SPR sensing system.14,24 As shown in Figure 2, although DNA and RNA are similar compounds, a major difference in RNA as compared to DNA is the structure of the five carbon sugar. The sugar in DNA is deoxyribose that contains only one hydroxyl group. However, the sugar in RNA is ribose, which contains two hydroxyl groups (that is 1,2-cis-diol structure). PBA shows strong binding capacity with 1,2-cis-diol structure due to the formation of a cyclic boronate ester, but shows low binding capacity for onehydroxyl compounds.36 Accordingly, the PBA-AuNPs can preferentially bind with the captured RNA sequence to amplify the sensing signal. Characterization of the HS-ssDNA/MCH Monolayer and PBA-AuNPs. The HS-ssDNA/MCH monolayer was selfassembled on the gold film and was further characterized by XPS. As shown in Figure S-4, S2p spectrum exhibited two distinct peaks at 161.8 eV and 163.0 eV with 2:1 area ratio and splitting of 1.2 eV, which indicate thiol groups binding on the gold film through forming S−Au bond and there is no unbound thiol on the sensing surface.37 The peaks of N1s and P2p are unique signals for HS-ssDNA sequences, because the N and P elements only contain phosphate groups and nucleobase, respectively. The splitting peaks of O1s suggest that the O element must exist in at least two valence states, which can further validate that the HS-ssDNA exist on sensing surface. 931


Article

ACS Sensors Additionally, the PBA monolayer modified AuNPs dropped on the silicon wafer were characterized by ATR infrared spectrometer. Figure 3A shows the ATR infrared spectrum in

Figure 4. Let-7a hybridization and signal amplification. (A) Real time sensorgram of Let-7a (10−8 M) with the fiber-optic SPR sensor. I: Hybridization buffer. II: Let-7a in hybridization buffer. III: Water. IV: PBA-AuNPs in water. (B) Linear relationship between amplified signal and the logarithm of Let-7a concentration. Inset: the wavelength shift in the presence of PBA-AuNPs with different concentrations of Let-7a (from 0 M to 10−7 M).

Figure 3. ATR infrared spectrum of dried PBA-AuNPs on silicon wafer (A) 1000−1800 cm−1 wavenumber (B) 2740−3040 cm−1 wavenumber.

the regions from 1000 to 1800 cm−1. It indicates that an obvious B−O stretching band occurs at 1375 cm−1, which is in accordance with previously reported data.38 The wide peak from around 1500 to 1630 cm−1 can be attributed to the CC stretch in the aromatic ring. Figure 3 B shows four peaks in PBA-AuNPs from about 2800 to 2950 cm−1 which can be attributed to the CH2 antisymmetric and symmetric bands.39 The ATR infrared spectrum can confirm that PBA successfully loaded on the AuNPs. Let-7a Detection. The fiber-optic SPR sensor was used to monitor the sequence of steps leading to miRNA detection. As shown in Figure 4A, in process I, hybridization buffer was injected to make a steady baseline to guarantee that the fiberoptic sensing system is stable. In process II, the hybridization buffer contains target RNA sequence (Let-7a) on the sensing surface for complementary pairing for 2 h. Then, in process III, we injected pure water into the sensing system to remove all the ingredients. It should be pointed out that the hybrid RNA sequence could not be removed due to its interaction with capture DNA modified on the sensing surface. Finally, the PBAAuNPs solution was injected in order to amplify the sensing signal through binding with hybrid RNA. Obviously, the interferences in the sample can be removed in process III and cannot disturb the signal amplification by PBA-AuNPs in process IV. Figure 4A shows that the hybridization signal of Let-7a on the sensing surface was too weak to be detected directly. This may be attributed to the low concentration and low molecular

weight of Let-7a, which cannot produce a large refractive index change in the sensing region. By contrast, the PBA-AuNPs can amplify the signal significantly though binding with hybrid RNA on the sensing surface. The resonance wavelength shifted significantly within 10 min after adding PBA-AuNPs and gradually reached a plateau within 30 min. Figure 4B shows the plot of signal response versus the logarithm value of Let-7a concentration displayed a linear relationship in the range of 10−12 M to 10−7 M. The inset picture is the real-time sensorgram of Let-7a in each concentration at 0 M, 10−12 M, 10−11 M, 10−10 M, 10−9 M, 10−8 M, and 10−7 M. The limit of detection (LOD) was determined by signal-to-noise of 3 plus the background signal and obtained 2.7 × 10−13 M for Let-7a. We also tested the signal stability of PBA-AuNPs by probe Let-7a in 10−8 M for 8 times (Figure 5). It shows that the relative standard deviation (RSD) of the amplification signal by PBA-AuNPs is about 13.1%. Selectivity Measurement. Complementary DNA sequence and different kinds of single-stranded RNA including signal base mismatch, single base deletion, and random RNA sequence were used to test the selectivity of the sensing system (Table 1). The blank was performed with a PBA-AuNPs solution directly exposed to the sensing system in the absence of RNA and DNA. Figure 6 shows the selectivity of our proposed sensing system for Let-7a (complementary pairing), 932


Article

ACS Sensors

Figure 5. PBA-AuNPs amplification signal stability (Let-7a, 10−8 M).

DNA-1(complementary pairing), RNA-2 (single base mismatch), RNA-3 (single base deletion), and RNA-4 (random sequence). All the single-stranded nucleic acids were tested at 10−8 M. Figure 6A is the real-time sensorgram amplified by PBA-AuNPs. Both Let-7a and DNA-1 can be captured by HSssDNA on the sensing surface though complementary pairing. The PBA-AuNPs show obvious amplification signal (1.94 nm) to Let-7 through binding with the cis-diol group. Comparatively, the DNA-1 showed relatively low amplification signal (0.67 nm). This can be attributed to the low binding capacity between PBA and DNA due to the DNA’s deoxy structure. It should be noticed that the blank group, which the PBA-AuNPs directly expose to the HS-ssDNA on the sensing surface, shows only 0.07 nm wavelength shift. It suggests that PBA-AuNPs have very low background noise in Let-7a sensing. To compare with DNA-1 and blank groups, both of them are PBA-AuNPs interactions with DNA, but show different signal response. That may be attributed to several reasons. The PBA used in the research contains an alky chain with 11 carbons, which need more space to bind with nucleic acid, and the diameter of AuNPs (about 19 nm) is larger than the nucleic acid. If the distance between sensing surface and the PBA-AuNPs is too short, it may hinder the PBA-AuNPs recognition ability. This result may benefit optimization of the PBA-AuNPs system to improve the RNA detection in the future. The RNA-2 (single based mismatch sequence) and RNA-3 (single base mismatch) shows similarly low resonance (0.59 and 0.49 nm) when exposing to PBA-AuNPs (Figure 6B). The signal of RNA-4 is a little higher than the blank group, which may be attributed to some nonspecific adsorption of RNA-4 on the sensing surface. Besides, in order to test the generality of our proposed sensor, two other kinds of sequences were tested. The nucleic sequence and testing results are shown in Table S1 and Figure S-5. The complementary RNA and complementary DNA were detected at the concertation of 10−8 M. It

Figure 6. Signal selective enhancement by PBA-AuNPs: (A) Real-time signal response monitoring. (B) Selectivity of miRNA SPR sensors. Let-7a (complementary pairing), DNA-1(complementary pairing), RNA-2 (single base mismatch), RNA-3 (single base deletion); RNA-4 (random sequence), and Blank (none RNA or DNA). All the nucleic acids were tested at 10−8 M.

shows that the PBA-AuNPs perform the same in distinguishing RNA and DNA by selectively amplifying the complementary RNA sequence. It should be pointed out that the selectivity and sensitivity of our proposed miRNA sensor is realized according to the following two aspects: (1) Target Let-7a with specific sequence can be recognized and captured on the sensing surface by HSssDNA through the complementary paring. (2) PBA-AuNPs were utilized to further enhance the signal of target RNA selectively. To the best of our knowledge, few papers have reported the ability to distinguish DNA and RNA with the same sequence by one method. Most of the published research papers focus on detecting DNA or RNA; they do not have the ability to differentiate between them especially when both DNA and RNA can complementarily pair on the sensing surface. However, our proposed method can differentiate the RNA and DNA with the same sequence due to the unique characteristics of PBA-AuNPs. A comparison between our proposed method and previous work in SPR platforms is shown

Table 1. Single Strand DNA and RNA Sequences Used in the Sensing System sequence (5′3′) HS-ssDNA Let-7a DNA-1 RNA-2 RNA-3 RNA-4

HS-(CH2)6-TTTTTTAACTATACAAC UGAGGUAGUAGGUUGUAUAGUU ACTCCATCATCGTTGTATAGTT UGAGGUAGUAGGUUGUUUAGUU UGAGGUAGUAGGUUGU_UAGUU UUGUACUACACAAAAGUACUG 933

Capture DNA Complementary paring Complementary paring Single base mismatch Single base deletion Random sequence DOI: 10.1021/acssensors.7b00871 ACS Sens. 2018, 3, 929−935

Article

ACS Sensors

11474043, 21603021, 61505019). We also acknowledge the support from the Fundamental Research Funds for the Central Universities (DUT15RC(3)115).

in Table S-2. It is clear that the LOD of our proposed method is comparable to other reported methods. More importantly, our method can be used to distinguish the RNA and DNA with the same sequence, indicating that our proposed method has higher selectivity as compared with other reported methods. Besides, in many previous research studies, Au nanoparticles modified with complementary DNA are used to enhance the sensing signal. However, different complementary DNA sequences are required for the different target RNA sequences, which results in an optimization process to be repeated for each assay. It should be pointed out that the PBA-AuNPs is a very simple and convenient technique for miRNA signal amplification in fiber-optic SPR sensors. First, the PBA-AuNPs could differentiate DNA and RNA analytes by preferentially binding with cis-diol in the RNA unit. Second, the PBA-AuNPs will be generally applicable for RNA signal amplification. Third, the fiber-optic SPR sensor offers a small and portable instrument that has more potential applications in biological analysis and clinical diagnosis.

■

(1) Dong, H.; Lei, J.; Ding, L.; Wen, Y.; Ju, H.; Zhang, X. MicroRNA: Function, Detection, and Bioanalysis. Chem. Rev. 2013, 113 (8), 6207−6233. (2) Sidransky, D. Nucleic Acid-Based Methods for the Detection of Cancer. Science 1997, 278 (5340), 1054−1058. (3) Bartel, D. P. MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell 2004, 116 (2), 281−297. (4) Shenoy, A.; Blelloch, R. H. Regulation of microRNA function in somatic stem cell proliferation and differentiation. Nat. Rev. Mol. Cell Biol. 2014, 15 (9), 565−576. (5) Jin, M.; Zhang, T.; Liu, C.; Badeaux, M. A.; Liu, B.; Liu, R.; Jeter, C.; Chen, X.; Vlassov, A. V.; Tang, D. G. miRNA-128 Suppresses Prostate Cancer by Inhibiting BMI-1 to Inhibit Tumor-Initiating Cells. Cancer Res. 2014, 74 (15), 4183−4195. (6) Calin, G. A.; Croce, C. M. MicroRNA signatures in human cancers. Nat. Rev. Cancer 2006, 6 (11), 857−866. (7) Reinhart, B. J.; Slack, F. J.; Basson, M.; Pasquinelli, A. E.; Bettinger, J. C.; Rougvie, A. E.; Horvitz, H. R.; Ruvkun, G. The 21nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 2000, 403 (6772), 901−906. (8) Li, B.; Chen, P.; Chang, Y.; Qi, J.; Fu, H.; Guo, H. Let-7a inhibits tumor cell growth and metastasis by directly targeting RTKN in human colon cancer. Biochem. Biophys. Res. Commun. 2016, 478 (2), 739−745. (9) Lee, H.; Han, S.; Kwon, C. S.; Lee, D. Biogenesis and regulation of the let-7 miRNAs and their functional implications. Protein Cell 2016, 7 (2), 100−113. (10) Causa, F.; Aliberti, A.; Cusano, A. M.; Battista, E.; Netti, P. A. Supramolecular Spectrally Encoded Microgels with Double Strand Probes for Absolute and Direct miRNA Fluorescence Detection at High Sensitivity. J. Am. Chem. Soc. 2015, 137 (5), 1758−1761. (11) Torrente-Rodríguez, R. M.; Campuzano, S.; Montiel, V. R.-V.; Montoya, J. J.; Pingarrón, J. M. Sensitive electrochemical determination of miRNAs based on a sandwich assay onto magnetic microcarriers and hybridization chain reaction amplification. Biosens. Bioelectron. 2016, 86, 516−521. (12) Azimzadeh, M.; Rahaie, M.; Nasirizadeh, N.; Ashtari, K.; NaderiManesh, H. An electrochemical nanobiosensor for plasma miRNA155, based on graphene oxide and gold nanorod, for early detection of breast cancer. Biosens. Bioelectron. 2016, 77, 99−106. (13) Ye, L.-P.; Hu, J.; Liang, L.; Zhang, C.-y. Surface-enhanced Raman spectroscopy for simultaneous sensitive detection of multiple microRNAs in lung cancer cells. Chem. Commun. 2014, 50 (80), 11883−11886. (14) He, L.; Musick, M. D.; Nicewarner, S. R.; Salinas, F. G.; Benkovic, S. J.; Natan, M. J.; Keating, C. D. Colloidal Au-Enhanced Surface Plasmon Resonance for Ultrasensitive Detection of DNA Hybridization. J. Am. Chem. Soc. 2000, 122 (38), 9071−9077. (15) Goodrich, T. T.; Lee, H. J.; Corn, R. M. Direct Detection of Genomic DNA by Enzymatically Amplified SPR Imaging Measurements of RNA Microarrays. J. Am. Chem. Soc. 2004, 126 (13), 4086−7. (16) Su, S.; Fan, J.; Xue, B.; Yuwen, L.; Liu, X.; Pan, D.; Fan, C.; Wang, L. DNA-Conjugated Quantum Dot Nanoprobe for HighSensitivity Fluorescent Detection of DNA and micro-RNA. ACS Appl. Mater. Interfaces 2014, 6 (2), 1152−1157. (17) Zhu, Y.; Qiu, D.; Yang, G.; Wang, M.; Zhang, Q.; Wang, P.; Ming, H.; Zhang, D.; Yu, Y.; Zou, G.; Badugu, R.; Lakowicz, J. R. Selective and sensitive detection of MiRNA-21 based on gold-nanorod functionalized polydiacetylene microtube waveguide. Biosens. Bioelectron. 2016, 85, 198−204. (18) Miao, P.; Wang, B.; Meng, F.; Yin, J.; Tang, Y. Ultrasensitive Detection of MicroRNA through Rolling Circle Amplification on a

■

CONCLUSION In summary, we demonstrated a novel approach for selective detection of Let-7a from the amplification signal in the fiberoptic SPR sensing system with PBA-AuNPs to circumvent the issue of low response from the direct hybridization of RNA in SPR sensing. In this novel sensing scheme, PBA-AuNPs were used to enhance the SPR signal of target RNA by binding the cis-diol groups of RNA. The unique advantages of the PBAAuNPs system is the ability to differentiate RNA and DNA though selective amplification of the RNA signal. This work can be further investigated for developing and applying PBAAuNPs technique in various sensing platforms.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acssensors.7b00871. TEM images of AuNPs; Chemical structure and synthetic method of PBA; XPS spectra of HS-ssDNA/ MCH monolayer sensing surface; Selective enhancement by PBA-AuNPs; Nucleic acid sequences; Comparison of different amplification strategies for nucleic acid detection by SPR sensors (PDF)

■

REFERENCES

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (Wei Ji). *E-mail: [email protected] (Wei Peng). ORCID

Wei Ji: 0000-0001-6391-9768 Jianzhang Zhao: 0000-0002-5405-6398 Jean-François Masson: 0000-0002-0101-0468 Wei Peng: 0000-0002-0246-0698 Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This research was financially supported by National Nature Science Foundation of China (61520106013, 61727816, 934


Article

ACS Sensors DNA Tetrahedron Decorated Electrode. Bioconjugate Chem. 2015, 26 (3), 602−607. (19) Homola, J. Surface Plasmon Resonance Sensors for Detection of Chemical and Biological Species. Chem. Rev. 2008, 108 (2), 462−493. (20) Kretschmann, E.; Raether, H. Notizen: Radiative Decay of Non Radiative Surface Plasmons Excited by Light. Z. Naturforsch., A: Phys. Sci. 1968, 23 (12), 2135−2136. (21) Zhao, S. S.; Bukar, N.; Toulouse, J. L.; Pelechacz, D.; Robitaille, R.; Pelletier, J. N.; Masson, J.-F. Miniature multi-channel SPR instrument for methotrexate monitoring in clinical samples. Biosens. Bioelectron. 2015, 64, 664−670. (22) Caucheteur, C.; Guo, T.; Albert, J. Review of plasmonic fiber optic biochemical sensors: improving the limit of detection. Anal. Bioanal. Chem. 2015, 407 (14), 3883−3897. (23) Bai, Y.; Feng, F.; Zhao, L.; Wang, C.; Wang, H.; Tian, M.; Qin, J.; Duan, Y.; He, X. Aptamer/thrombin/aptamer-AuNPs sandwich enhanced surface plasmon resonance sensor for the detection of subnanomolar thrombin. Biosens. Bioelectron. 2013, 47, 265−270. (24) Szunerits, S.; Spadavecchia, J.; Boukherroub, R. Surface plasmon resonance: signal amplification using colloidal gold nanoparticles for enhanced sensitivity. Rev. Anal. Chem. 2014, 33, 153. (25) Nishiyabu, R.; Iizuka, S.; Minegishi, S.; Kitagishi, H.; Kubo, Y. Surface modification of a polyvinyl alcohol sponge with functionalized boronic acids to develop porous materials for multicolor emission, chemical sensing and 3D cell culture. Chem. Commun. 2017, 53 (25), 3563−3566. (26) Qian, S.; Liang, Y.; Ma, J.; Zhang, Y.; Zhao, J.; Peng, W. Boronic acid modified fiber optic SPR sensor and its application in saccharide detection. Sens. Actuators, B 2015, 220, 1217−1223. (27) Lin, Z.; Sun, L.; Liu, W.; Xia, Z.; Yang, H.; Chen, G. Synthesis of boronic acid-functionalized molecularly imprinted silica nanoparticles for glycoprotein recognition and enrichment. J. Mater. Chem. B 2014, 2 (6), 637−643. (28) Zhao, D.; Xu, J.-Q.; Yi, X.-Q.; Zhang, Q.; Cheng, S.-X.; Zhuo, R.-X.; Li, F. pH-Activated Targeting Drug Delivery System Based on the Selective Binding of Phenylboronic Acid. ACS Appl. Mater. Interfaces 2016, 8 (23), 14845−14854. (29) Dervisevic, M.; Senel, M.; Sagir, T.; Isik, S. Highly sensitive detection of cancer cells with an electrochemical cytosensor based on boronic acid functional polythiophene. Biosens. Bioelectron. 2017, 90, 6−12. (30) Zhang, X.; Wang, J.; He, X.; Chen, L.; Zhang, Y. Tailor-Made Boronic Acid Functionalized Magnetic Nanoparticles with a Tunable Polymer Shell-Assisted for the Selective Enrichment of Glycoproteins/ Glycopeptides. ACS Appl. Mater. Interfaces 2015, 7 (44), 24576− 24584. (31) Wu, X.; Li, Z.; Chen, X.-X.; Fossey, J. S.; James, T. D.; Jiang, Y.B. Selective sensing of saccharides using simple boronic acids and their aggregates. Chem. Soc. Rev. 2013, 42 (20), 8032−8048. (32) Masson, J. F.; Obando, L.; Beaudoin, S.; Booksh, K. Sensitive and real-time fiber-optic-based surface plasmon resonance sensors for myoglobin and cardiac troponin I. Talanta 2004, 62 (5), 865−870. (33) Herne, T. M.; Tarlov, M. J. Characterization of DNA Probes Immobilized on Gold Surfaces. J. Am. Chem. Soc. 1997, 119 (38), 8916−8920. (34) Grabar, K. C.; Freeman, R. G.; Hommer, M. B.; Natan, M. J. Preparation and Characterization of Au Colloid Monolayers. Anal. Chem. 1995, 67 (4), 735−743. (35) Bi, X.; Du, X.; Jiang, J.; Huang, X. Facile and Sensitive Glucose Sandwich Assay Using In Situ-Generated Raman Reporters. Anal. Chem. 2015, 87 (3), 2016−2021. (36) Li, D. J.; Chen, Y.; Liu, Z. Boronate affinity materials for separation and molecular recognition: structure, properties and applications. Chem. Soc. Rev. 2015, 44 (22), 8097−8123. (37) Castner, D. G.; Hinds, K.; Grainger, D. W. X-ray Photoelectron Spectroscopy Sulfur 2p Study of Organic Thiol and Disulfide Binding Interactions with Gold Surfaces. Langmuir 1996, 12 (21), 5083−5086. (38) Barriet, D.; Yam, C. M.; Shmakova, O. E.; Jamison, A. C.; Lee, T. R. 4-Mercaptophenylboronic Acid SAMs on Gold: Comparison

with SAMs Derived from Thiophenol, 4-Mercaptophenol, and 4Mercaptobenzoic Acid. Langmuir 2007, 23 (17), 8866−8875. (39) Park, J.-S.; Vo, A. N.; Barriet, D.; Shon, Y.-S.; Lee, T. R. Systematic Control of the Packing Density of Self-Assembled Monolayers Using Bidentate and Tridentate Chelating Alkanethiols. Langmuir 2005, 21 (7), 2902−2911.

935
