Brain Derived Neurotrophic Factor Gene (BDNF) - Springer Link

2 downloads 2 Views 167KB Size Report
Brain derived neurotrophic factor (BDNF) belongs to superfamily of closely related peptides— neurotrophins that play important role in establish ment of ...

ISSN 10227954, Russian Journal of Genetics, 2013, Vol. 49, No. 12, pp. 1250–1253. © Pleiades Publishing, Inc., 2013. Original Russian Text © Z.G. Kokaeva, T.O. Kochetkova, E.V. Afonchikova, N.S. Kondratyeva, E.A. Klimov, 2013, published in Genetika, 2013, Vol. 49, No. 12, pp. 1432–1435.

SHORT COMMUNICATIONS

BrainDerived Neurotrophic Factor Gene (BDNF) Polymorphism among Moscow Citizens1 Z. G. Kokaeva, T. O. Kochetkova, E. V. Afonchikova, N. S. Kondratyeva, and E. A. Klimov Department of Genetics, Lomonosov Moscow State University, Moscow, 119991 email: [email protected] Received February 5, 2013

Abstract—Recent studies showed that brainderived neurotrophic factor (BDNF) can participate in patho genesis of various CNS disorders, being connected with proliferation, differentiation, and survival of neu rons. In present study, analysis of occurrence rate was performed for three single nucleotide polymorphisms (SNPs) located in BDNF gene (rs6267 (A/G) allele A—0.265; rs2049046 (A/T) allele A—0.407; rs11030107 (A/G) allele A—0.872) in randomized selection of Moscow citizens. Linkage disequilibrium of rs6165 and rs2049046 loci was shown. Differences in allele frequencies in studied selection and populations of other regions were discovered. DOI: 10.1134/S1022795413120041 1

Brainderived neurotrophic factor (BDNF) belongs to superfamily of closely related peptides— neurotrophins that play important role in establish ment of plasticity in mature nervous system: they pro vide growth, development, and survival in neuronal populations. Particularly, BDNF participates in sur vival and differentiation of dopaminergic neurons, appears to be the trophic factor for serotoninergic neurons, and plays important role in synapse forma tion. Proteins of this family are synthesized as pre forms which can be cleaved intracellularly, forming mature secreted ligands. Mature neurotrophins selec tively bind to tyrosine kinase receptors which activate signaling pathways leading to differentiation or sur vival of neurons [1]. It is known that BDNF gene is localized in chromo some 11 locus p14.1 and has complex structure: 9 functional promoters and 11 exons. The sequence encoding functional part of the protein is in the last exon. Alternative promoters provide nine tissue and timespecific transcripts that encode inter alia differ ent leading sequences of preproprotein BDNF [2]. The gene is expressed in nociceptive sensory neurons and modulates functioning of metabotropic and iono tropic receptors of glutamate. Single nucleotide polymorphisms (SNPs) in BDNF gene in different populations were found to be associ ated with disorders generally common in big cities, such as autism [1], Alzheimer disease [3], anorexia and bulimia [4], depressive disorder [5], schizophrenia [6], etc. Currently, the possibility of BDNF participa tion in migraine pathogenesis is discussed [7]. 1 The article was translated by the authors.

One of most studied SNPs in BDNF gene is G/A substitution in 196 position of exon 8 (rs6265), which results in substitution in codon 66 of Val into Met ami noacid in 5' proBDNF domain. However, this substi tution does not affect the function of BDNF protein itself but leads to downregulated BDNFdependent secretion, dramatically altering intracellular traffick ing and folding of proBDNF. This may be connected with increased sensitivity to neuropsychiatric disor ders including depressions, anxiety, etc. [6–9]. Previously, it was shown that allele A may be asso ciated with memory dysfunction, disruption of hip pocampus activation, and hippocampus volume. Decreased secretion of BDNF in cultured neurons carrying allele A had been revealed, as well as that allele A affected intracellular distribution of BDNF and its depolarizationsensitive secretion [8]. Therefore, polymorphic locus rs6265 is one of best studied in BDNF gene, and its role in pathogenesis of several psychiatric disorders was shown in associative studies. At the same time, association of polymorphic loci rs2049046 and rs11030107 with functional activity of BDNF gene remains insufficiently explored. The aim of present study is the analysis of occur rence rate of three SNPs located in BDNF gene using PCR–RFLP method in randomized selection of Moscow citizens. Ethnicity of participants was not taken into account. In the study, DNA extracted from whole blood of volunteers living in Moscow was examined. Sample volume was 204 persons (100 males and 104 females aged from 18 to 57 years old). Blood sampling was held in Moscow blood transfusion station. Blood samples were kindly provided by Laboratory of Functional Genomics (Vavilov Institute of General Genetics,

1250

BRAINDERIVED NEUROTROPHIC FACTOR

1251

Table 1. The information on studied polymorphic loci Polymorphic locus

Localization

Oligonucleotide primers sequence

Tanneal, °C

Product length, bp

Restriction enzyme

rs6265 A/G

Exon 2

F: CAAAGTGTGACTTCAGATTGTCTG R: AGAATAAGACAGCAGTACCGTACTT

56

157

PspCI

rs2049046 A/T

3'UTR

F2: CAGGTGGGGCTTTGTCTTTCAAG R2: GCATGTTCTCCCTTTAGGGACAT

60

198

HinfI

F: GAGGACAAGGTGGCTTGGCCTA R: GGCCGAACTTTCTGGTCCTC

61

120

TaqI

rs11030107 A/G Intron 1

Table 2. Allele and genotype frequencies for BDNF gene SNP

Genotypes

Sample size (n)

Genotype frequency

Alleles

Allele frequency

AA

4

0.019 ± 0.005

A

0.265 ± 0.019

AG

100

0.490 ± 0.005

G

0.735 +± 0.019

GG

100

0.490 ± 0.005

AA

155

0.758 ± 0.006

A

0.871 ± 0.029

AG

46

0.227 ± 0.006

G

0.129 ± 0.029

GG

3

0.015 ± 0.006

AA

21

0.103 ± 0.009

A

0.409 ± 0.021

AT

125

0.613 ± 0.009

T

0.591 ± 0.021

TT

58

0.284 ± 0.009

rs6265

rs11030107

rs2049046

Table 3. The occurrence rate of polymorphic locus rs6265 (A/G) in BDNF gene Source

Population

A

G

Own data, n = 204

Russia

0.265

0.735

Marziniak et al. [7], n = 153

Germany

0.239

0.761

Karnik et al. [8], n = 116

USA (Washington, Europeans)

0.172

0.828

Goodyer et al. [9], n = 401

Great Britain

0.195

0.805

Lemos et al. [10], n = 287

Portugal

0.197

0.803

Huang et al. [3], n =128

USA (Texas, Georgia, Europeans)

0.136

0.864

DmitrzakWeglazz et al. [11], n = 585

Poland

0.188

0.812

Musil et al. [12], n = 445

Germany

0.207

0.793

Russian Academy of Sciences). DNA extraction was performed according to the manufacturer’s instruc tions (Magna™ DNA Prep 200 by Isogen Lab. Ltd., Moscow, Russia). PCR was performed according to the protocol provided by the manufacturer (GenePak™ PCR Core by Isogen Lab. Ltd., Moscow, Russia). Oligonucleotide primers were synthesized by DNA Synthesis, LLC (Moscow, Russia). The oligo nucleotide primers used in the study were designed manually. Annealing temperature for each pair of primers was empirically selected, based on the tempera ture calculated with SigmaGenosys Calculator software. RUSSIAN JOURNAL OF GENETICS

Vol. 49

No. 12

The information on studied SNPs, pairs of oligonucle otide primers, and restriction enzymes (SibEnzyme, Novosibirsk, Russia) is provided in Table 1. After treating PCR product contained polymor phic locus A/G (rs6265) with appropriate restriction enzyme, alleles A (157 bp) and G (116 and 41 bp) were identified. In case of SNP A/T (rs2049046), alleles A (163 bp and 35 bp) and T (198 bp) were identified. In case of SNP A/G (rs11030107) alleles A (120 bp) and G (96 and 24 bp) were identified. The restriction anal ysis was performed using 2.5% agarose gel (Helicon Ltd., Moscow, Russia) stained with ethidium bromide, 2013

1252

KOKAEVA et al.

Table 4. The occurrence rate of polymorphic locus rs2049046 (A/T) of BDNF gene Source

Population

A

T

0.409

0.591

Own data, n = 204

USA (Texas, Georgia, 0.519 Europeans)

0.481

SlofOp’t Landt et al. [14], Germany n = 607

0.524

0.476

Lemos et al. [10], n = 287

0.506

0.494

Middeldorp et al. [15], n = 1240

Own data, n = 204 Russia Huang et al. [3], n = 128

Lemos et al. [10], Portugal n = 287 Sand et al. [13], n = 240

Table 5. The occurrence rate of polymorphic locus rs11030107 (A/G) of BDNF gene

Germany

at field intensity of 4–5 V/cm, which was visualized in shortwave UV light using iuVCR gel documenting system. Statistical analysis of data was performed using standard approaches (Pearson distribution—χ2). Analysis on the joint inheritance of SNPs was per formed using Arlequin 3.5 and HaploView 4.2 soft ware. In present study, we have determined frequencies of genotypes and alleles in Moscow sample, and com pared those with frequencies of alleles provided in original research papers (Tables 2–5). The following values of genotype frequency were obtained for rs6265 locus: AA—0.020; AG—0.490; GG—0.490 (Table 2). The deviation from Hardy– Weinberg equilibrium was observed in distribution of genotype frequencies (χ2 = 8.49, p = 0.004). In Table 3, frequencies of A/G alleles (rs6265) are provided which were 0.265 for A and 0.735 for G. According to our data, frequencies of alleles in polymorphic locus rs6265 in Moscow region do not significantly differ from those on Portugal (χ2 = 6.29; р = 0.01) and Germany (χ2 = 0.63, р = 0.43), but dif fers from those in Great Britain (χ2 = 7.52; p = 0.006), Poland (χ2 = 10.80, р = 0.001), USA (Washington) (χ2 = 7.09, р = 0.008), USA (Texas) (χ2 = 15.25, р = 0.0001) [7–12]. For polymorphic locus rs2049046, genotype fre quencies were: AA—0.103; AT—0.613; TT—0.284 (Table 2). The distribution of genotype frequencies in studied group did not meet Hardy–Weinberg equilib rium (χ2 = 7.40; p = 0.007). Frequencies of A/T alleles (rs2049046) that were 0.409 for A and 0.591 for T are provided in Table 4. Statistical analysis revealed signif icant differences in frequencies of rs2049046 alleles in Moscow and Portugal (χ2 = 12.66; p = 0.0004), USA (Texas) (χ2 = 7.72; р = 0.006), and Germany (χ2 = 8.34, р = 0.004). The distribution of genotype frequencies for poly morphic locus rs11030107 (A/G) was AA—0.758; AG—0.227; GG—0.015 (Table 2). which corre sponded to Hardy–Weinberg equation (χ2 = 0.01; p =

Source

Population

A

G

0.871

0.129

0.730

0.270

Portugal

0.784

0.216

Netherlands

0.744

0.256

Russia

0.91). Frequencies of alleles A/G (rs11030107) that were 0.871 for A and 0.129 for G are provided in Table 5. These data significantly differ from results on Portu gal (χ2 = 12.72, р = 0.0004), Germany (χ2 = 7.04; p = 0.02), and Netherlands (χ2 = 12.13; р = 0.0004). We also performed the analysis of inheritance of studied SNPs (test for linkage disequilibrium). High χ2 value (5.365 at 1 degree of freedom; difference con sidered significant at p = 0.021, D' = 0.28, LOD = 0.94, R2 = 0.041) was obtained only for the pair of rs6265 and rs2049046 polymorphic loci. This allowed us to reject the hypothesis of independent inheritance and conclude mainly joint inheritance of the following allele combinations: rs6265A/rs2049046A and rs6265G / rs2049046T. Thus, we were first to determine the frequencies of three polymorphic loci in BDNF gene in randomized selection of Moscow citizens. Significant differences in allele frequencies between studied sample and other populations (samples were of comparable size) were found. Linkage disequilibrium of polymorphic vari ants of rs6265 and rs2049046 loci was shown. These data can be further used in associative studies. REFERENCES 1. Cheng, L., Ge, Q., Xiao, P., et al., Association study between BDNF gene polymorphisms and autism by threedimensional gelbased microarray, Int. J. Mol. Sci., 2009, vol. 10, no. 6, pp. 2487–2500. 2. Pruunsild, P., Kazantseva, A., Aid, T., et al., Dissecting the human BDNF locus: bidirectional transcription, complex splicing, and multiple promoters, Genomics, 2007, vol. 90, no. 3, pp. 397–406. 3. Huang, R., Huang, J., Cathcart, H., et al., Genetic variants in brainderived neurotrophic factor associated with Alzheimer’s disease, J. Med. Genet., 2007, vol. 44, no. 2, pp. 2659–2668. 4. Shugart, Y.Y., Chen, L., Day, I.N., et al., Two British women studies replicated the association between the Val66Met polymorphism in the brainderived neu rotrophic factor (BDNF) and BMI, Eur. J. Hum. Genet., 2009, vol. 17, no. 8, pp. 1050–1055.

RUSSIAN JOURNAL OF GENETICS

Vol. 49

No. 12

2013

BRAINDERIVED NEUROTROPHIC FACTOR 5. Zhang, K., Yang, C., Xu, Y., et al., Genetic association of the interaction between the BDNF and GSK3B genes and major depressive disorder in a Chinese population, J. Neural Transm., 2010, vol. 117, no. 3, pp. 393–401. 6. Chao, H.M., Kao, H.T., and Porton, B., BDNF Val66Met variant and age of onset in schizophrenia, Am. J. Med. Genet., B Neuropsychiatr. Genet., 2008, vol. 147, pp. 505–506. 7. Marziniak, M., Herzog, A., Mossner, R., and Sommer, C., Investigation of the functional brainderived neu rotrophic factor gene variant Val66Met in migraine, Neur. Transm., 2008, vol. 115, pp. 1321–1325. 8. Karnik, M.S., Wang, L., Barch, D.M., et al., BDNF polymorphism rs6265 and hippocampal structure and memory performance in healthy control subjects, Psy chiatry Res., 2010, pp. 1–5. 9. Goodyer, I.M., Croudace, T., Dudbridge, F., et al., Polymorphisms in BDNF (Val66Met) and 5HTTLPR, morning cortisol and subsequent depression in atrisk adolescents, Br. J. Psychiatry, 2010, vol. 197, no. 5, pp. 365–371. 10. Lemos, C., Mendonc, D., PereiraMonteiro, J., et al., BDNF and CGRP interaction: implications in migraine

RUSSIAN JOURNAL OF GENETICS

Vol. 49

No. 12

11.

12.

13.

14.

15.

1253

susceptibility, Cephalalgia, 2010, vol. 30, no. 11, pp. 1375–1382. DmitrzakW¸eglarz, M., Skibinska, M., Szczepank iewicz, A., et al., Association analysis of polymor phisms of the NTRK2 and BDNF genes with bipolar affective disorder in a Polish sample, Arch. Psychiatry Psychother., 2010, vol. 2, pp. 5–16. Musil, R., Zill, P., Seemuller, F., et al., No influence of brainderived neurotrophic factor (BDNF) polymor phisms on treatment response in a naturalistic sample of patients with major depression, Eur. Arch. Psychiatry Clin. Neurosci., 2012, pp. 1–8. Sand, P.G., Langguth, B., Schecklmann, M., et al., GDNF and BDNF gene interplay in chronic tinnitus, Int. J. Mol. Epidemiol. Genet., 2012, vol. 3, no. 3, pp. 245–251. SlofOp’t Landt, M.C.T., Meulenbelt, I., Bartels, M., et al., Association study in eating disorders: TPH2 asso ciates with anorexia nervosa and selfinduced vomiting, Genes Brain Behav., 2011, vol. 10, pp. 236–243. Middeldorp, C.M., SlofOp’t Landt, M.C.T., Med land, S.E., et al., Anxiety and depression in children and adults: influence of serotonergic and neurotrophic genes?, Genes Brain Behav., 2010, vol. 9, pp. 808–816.

2013

Suggest Documents