Candida albicans

3 downloads 18 Views 725KB Size Report
endocarditis (Michael et al,. 1983). The importance of C. albicans vaccines and ... (Rebell and Taplin, 1970) and the Normal physiological saline. (Leslie and ...

SCVMJ, XVII (2) 2012

223

The evaluation of the immune response against three Candida albicans vaccines by using ELISA Eman Abdeen; Tarabees, R.; Sabry, M.; Rasha Zahran and *Nayel , M. Department of Bacteriology, Mycology and Immunology, nd * Department of Animal medicine and Infectious diseases Faculty of Veterinary medicine, Sadat City, Minufyia University, Egypt. Abstract The Candida albicans infection is of minor veterinary significance, however, during the last years a considerable concern has been focused on the illness caused by these yeast. The use of ELISA has been introduced as a new diagnostic tool to evaluate the immune response in case of various diseases including the fungal infections via measuring the level of IgG. Herein, the aim of this study was to identify the C.albicans microscopically and by using PCR techniques. In addition, we have used three types of vaccines (heat killed C. albicans vaccine with adjuvant or with culture filtrate, or mixed vaccines (HK-CA) vaccine and (CFV)) and immune response (level of IgG) of rats was evaluated by ELISA. The data showed that, the immune response of rats was significantly increased after challenge in all three types of vaccines and there was no significant differences between level of immunity emerged by heat killed C. albicans vaccines and culture filtrate of C. albicans. While, immunization by mixed vaccine (HK-CA, CFV) showed significant increase in anti-Candida albicans than heat killed or culture filtrate alone especially after challenge with the virulent C. albicans strain. Introduction Genus Candida is composed by yeasts that live as commmensal on human and animals' microbiota. In general, they do not cause any damage to their hosts. However, due instability on chemical, physical and immunological defenses, these microorganisms can become pathogens. Candida species

infections are rare on Veterinary Medicine. However, in the last years, a considerable raise of illness caused by these yeasts has been related on varied animal species due to the highly use of antibiotics. There are several species of Candida including, C. albicans, C. tropicalis, C. pseudotropicalis, C. krusi with the C. albicans is

224 the most important one responsible for infectious diseases in animals (Brito et al., 2009) such as arthritis in horses and mastitis and abortion in cattle . The vaccines that stimulates the immune response whether humoral or cellular immunity or both have been introduced as a new tool for protection against fungal pathogens, with the humoral immunity is the predominant immune response against certain pathogenic fungi such as Candida albicans (Casadevall et al, 2002). Moreover, Antibodies probably play an important part in host defense against disseminated Candidasis (Matthews and Burnie, 1996). This suggested that humoral antibody may protect against C. albicans endocarditis, perhaps through inhibition of adhesion, a crucial early step in the pathogensis of endocarditis (Michael et al, 1983). The importance of C. albicans vaccines and how it stimulates the immune system has been reviewed in many literatures, previously in Cardenas et a (1999) and recently in Ibrahim et al (2006). Herein, this study was aimed mainly to identify C. albicans via microscopic examination and PCR. In addition, we have evaluated the immune response of three laboratory prepared vaccines via measuring the level

Eman Abdeen et al of IgG by ELISA. The data obtained from this study was promising; Immunized rats have showed higher level of IgG compared with non immunized rats. Materials and methods 1-Cultivation and determination of virulence factors of Candida albicans Samples for C. albicans were obtained from mastitic cases |(cow and buffalos). Candida albicans samples were firstly cultivated on Sabouraud,s dextrose agar medium and Rice agar medium (Refai et al, 1969) as a media for isolation and identification and then the samples stained with Lacto phenol cotton blue (Collee et al, 1996). Then, samples were cultivated on specific media for determination of virulence factors, e.g. media for determination of proteinase activity (Aoki et al, 1990) and media for determination of phospholipase production. Finally, samples were cultivated on sabouraud,s dextrose broth supplemented with bovine serum albumin 1% (Veterinary serum and Vaccine Research Institute (VSVRI) for stimulation of proteolytic enzymes to prepare C. albicans vaccine. Rabbit serum was used for demonstration of germ tube of C. albicans (Leslie and Frank, 1980) and the technique

SCVMJ, XVII (2) 2012 was carried out according to Koneman et al (1992). 2- PCR evaluation of C. albicans The samples collection and identification of different yeast isolates was performed according to Refai et al (1969). DNA was extracted from C. albicans isolates using Analytik jena kit® following the manufacturer instruction. Total chromosomal DNA isolated from C. albicans cells was subjected to PCR amplification with oligonucleotide primers targeting a 175 bp region as described previously by Mannarelli and Kurtzman (1998). The oligonucleotide primers (Biobasic inc.) used in the PCR reactions were: Forward 5' TGTTGCTCTCTCGGGGGCGGC CG 3' Reverse 5'AGATCATTATGCCAACATCC TAGGTTAAA 3' PCR amplification reaction mixtures consisted of 12.5 μl Master Mix, 1 μl forward primer, 1 μl reverse primer, 5.5 μl nuclease free water, 5 μl DNA. The PCR conditions were: Initial denaturation at 94°C for 5 min., and 35 cycles of 94◦C for1 min, 52°C for 1 min and 72 ◦C for 1min. Final extension at 72°C for 5 min. The PCR product was separated on agarose gel (0.9%) and stained with ethidium bromide.

225 Polymerase Chain Reaction for detection of the PLB1-specific region: Total chromosomal DNA isolated from C. albicans cells was subjected to PCR amplification with oligonucleotide primers targeting a 751 bp region representing the 59 half of the PLB1 gene, as described previously by (Mukherjee et al., 2001). The oligonucleotide primers (Biobasic inc.) used were: Forward 5' ATGATTTTGCATCATTTG 3' Reverse 5' AGTATCTGGAGCTCTACC 3' PCR amplification reaction mixtures consisted of 12.5 μl Master Mix, 1 μl Forward primer, 1 μl reverse primer, 5.5 μl nuclease free water, 5 μl DNA. The PCR conditions used was initial denaturation at 94°C for 5 min., and 35 cycles of 1 min at 94◦C, 47°C for 1 min and 72 ◦C for 1min. Final extension at 72°C for 5 min. The PCR product was separated on agarose gel (0.9%) and stained with ethidium bromide. 3. Solutions: In this study the KOH solution (Rebell and Taplin, 1970) and the Normal physiological saline (Leslie and Frank, 1980) were used. 3.1. Adjuvant (Montanide IMS 1113 N VG PR, Batch nr: T52531 was obtained from The Veterinary serum and Vaccine Research Institute (VSVRI). 4- Laboratory Animals:

226 For C. albicans vaccines: Twenty-Five white albino male rats weighted between 100150g. They feed on special rat feed and Divided into 5 groups (Table 1). All rats were subjected to challenge after 14 days post second vaccination. 5-Preparation of C. albicans cultures used for vaccines preparations: C. albicans were inoculated in Sabouraud,s dextrose broth supplemented with bovine serum albumin for 2 days at 280C, then centrifuged at 3000 rpm and the culture was then filtrated from yeast cell. 5.1. Heat killed C. albicans vaccine (HK.CA) with adjuvant: Yeast cells were washed twice in saline, counted in a 6 hemocytometer 10 / ml, then inactivated by heating at 80 0C for 30 minutes, and finally tested for purity and sterility for vaccine preparation (Bromuro et al, 2002). The yeast cells were then mixed with equal volume of adjuvant (montanide) and emulsified by repeated drawing and ejection, once emulsification took place; 2 ml of solution were given subcutaneously for each rat, while the control group received the same volume of only the adjuvant in a sterile saline (Campbell et al, 1970). 5-2- Culture filtrate vaccine (CFV):

Eman Abdeen et al The C. albicans culture filtrate was prepared as previously mentioned, then a part of the culture filtrate was heated at 1000C and a part inactivated with formalin (0.3%) then they all mixed together. 6- Preparation of C. albicans antigen for evaluation of the immune responses: 2 ml of fungus suspension were placed in a tube surrounded by ice. Then, the suspension was sonicated for 10 times 30 seconds each according to Sonicator model: Vibracell. Company: Sonics of materials 1NC. DANBURYCT.U.S.A. The supernatant was then taken and kept for evaluation of immune 7-Measurement of the immune response against the inoculated vaccines: Unheparinized blood samples were collected in a sterile wisserrman tubes directly from inner canthus of eye of rats, before immunization (zero time), one week post first immunization, and 14 days post second vaccination and after challenge. Serum was then separated and kept at -20oC till examined. The immune response of rats was examined prior vaccination (zero time), after first vaccination 7 days, at 14 days after second vaccination and after challenge within 7 days. 7-1-Evaluation of the humoral immune response:

SCVMJ, XVII (2) 2012 It was assessed by measuring anti- Candida albicans specific IgG antibodies using ELISA technique according to (Voller and Bidwell, 1986). 7-2Evaluation of the protective efficacy of the vaccines by Challenge test:

227 Within 14 days after booster dose of vaccine, each rats injected intraperitoneally with pathogenic dose of fresh culture of virulence C.albicans 5 Х 105 obtained from one of the positive C. albicans mastitic samples.

Table (1): Experimental design and immunization of rats for Candida albicans vaccines as shown follow: No of animals

Types of vaccine

Dose and rout

1

5 rats

Heat killed C. albicans with adjuvant

2 ml s/c( 1ml vaccine & 1ml adjuvant)

2

5 rats

Culture filtrate

0.5 ml s/c

3

5 rats

4

5 rats

Group

5 rats 5 HK= Heat Killed

Number of dose

twice within one week intervals

2 ml s/c of (Hk- CA) and .5 ml of CFV 2ml s/c Injection (1ml with One dose adjuvant & adjuvant 1ml saline) Control CFV=Culture filtrate vaccine Mixed vaccines

Results: Candida albicans: 1- Isolation and identification of C. albicans: All isolates of C. albicans were positive for chlamydospores on rice agar medium and for germ tube formation in rabbit serum as shown in photo (1 and 2).

Challenge (dose and rout)

I/P With 5 Х 10 5.

2- Proteolytic activity (proteinase enzyme) and phospholipase activity of C. albicans. The isolated positive C. albicans samples were tested for virulence factors (production of proteinase and phospholipase enzymes) and all the samples revealed positive result.

228 3-Identification of C. albicans by PCR In this study the PCR was used for the rapid detection of C. albicans yeasts. The PCR is based on a pair of universal primers. In this PCR system, the universal primer produces a 175 bp DNA fragment. As shown in figure (3). 4-Detection of phospholipase B (PLB1) gene of C. albicans by PCR: PCR was used for detecting phospholipase enzyme production as a rapid and more sensitive tool. As shown in the figure (4). The forward and reverse primer produces a 751 bp DNA fragment. 5- Immune response developed against the prepared vaccines 5-1Humoral immune response developed against heat killed Candida albicans (HKCA) vaccine with adjuvant The results illustrated in table (2) indicated that The mean optical density of representing antibodies titer of anti- C. albicans IgG in sera of rats artificially immunized with heat killed C. albicans vaccine with adjuvant was significantly increased to 1.84, 1.86, and 1.87, after first vaccination, post second vaccination, and after challenge respectively compared with 1.4 and 1.38 for control and control with adjuvant respectively. Of note, there are no significant differences in immunity level between first

Eman Abdeen et al and booster dose of vaccine (Table 2). 5-2Humoral immune response developed against culture filtrate of C. albicans vaccine. The mean optical density of anti- C. albicans IgG in sera of rats artificially immunized with culture filtrate was significantly increased 1.92, 1.72, and 1.91 after first vaccination, post second after challenge with the virulent C. albicans respectively compared with 1.4 and 1.38 for control group and control with adjuvant respectively. However, there are no significant differences in level immunity between first and booster dose of vaccine (Table 3). 5-3- Humoral immune response developed against mixed vaccine (heat killed C. albicans vaccine and culture filtrate): The mean optical density values of representing antibodies titer of anti- C.albicans IgG in sera of rats artificially immunized with (mixed vaccines) (HK-CA) vaccine & (CFV) was significantly increased (1.99) after first vaccination reached (1.83) after booster dose of vaccine and the level immunity of anti- C. albicans specific IgG was significantly increased reached to (2.69) after challenge compared with control and control with adjuvant (1.4, 1.38 respectively). Also statistical

SCVMJ, XVII (2) 2012 analysis showed that the level of IgG was significantly increased after challenge compared with first and booster dose of vaccination (Table 4). 5-4- ELISA mean of anti- C. albicans IgG in sera of rats immunized with different prepared vaccines The statistical analysis of the data presented showed that the level of immunity was increased after challenge in all three types of

229 vaccines with no significant differences between the level of immunity emerged by heat killed C. albicans vaccine and that of the culture filtrate of C. albicans. In contrast, rats immunized with mixed vaccine (HK-CA, CFV) showed significant increase in antiCandida albicans specific IgG compared with heat killed or culture filtrate alone especially after challenge with the virulent C. albicans strain (Table 5).

Photo (1): Terminal and intercalary chlamydospores of C. albicans on rice agar medium.

Photo (2): Germ tube formation of C. albicans in rabbit serum at 370C:

230

Eman Abdeen et al

Fig. (3): Amplification of 175bp by PCR for detection of C. albicans. Lane M: 1000 bp ladder, lane 1, 2, 3 and 5 showed positive samples.

Fig. (4): Amplification of 751bp by PCR for detection of phospholipase B (PLB1) gene. Lane M: 100 bp ladder, lane 2, 5 and 6 showed positive samples.

SCVMJ, XVII (2) 2012

231

Table (2): ELISA mean of representing antibodies titer of anti- C. albicans in sera of rats immunized with heat killed vaccine with adjuvant.

Control group after challenge

Control group with adjuvan t

Control group with adjuvant after challenge

post first vaccination

2 w. post second vaccination

After challeng e

Immunized group

Samples

(zero time)

Samples1

1.06

.670

.690

1.46

1.74

1.85

1.9

Samples 2

0.79

1.84

1.14

1.3

1.93

1.80

1.97

Samples 3

1.07

1.0

1.2

1.18

1.88

1.77

2.02

Samples 4

0.62

1.73

1.24

1.2

1.69

2.09

1.74

Samples 5

.750

1.77

1.23

1.8

1.96

1.80

1.72

Mean and Std.Error

.85±. 08907c0

1.4±. 23768b

1.1±. 10397cb

1.38±. 11430b

1.84±. 05320a

1.86±. 05843a

1.87± .06033a

*Mean having the same litter are not significantly different and different litters means significantly (p>0.05) Table (3): ELISA mean of representing antibodies titer of antiCandida albicans in sera of rats immunized with culture filtrate vaccine. Control group after challenge

Control group with adjuvant

Control group with adjuvant after challenge

Samples

(zero time)

Samples1

1.06

.670

.690

Samples 2

0.79

1.84

Samples 3

1.07

Samples 4

Immunized groups post first vaccination

2 w. post second vaccination

After challenge

1.46

1.86

1.84

1.86

1.14

1.3

2

1.7

1.65

1.0

1.2

1.18

1.83

1.7

1.72

0.62

1.73

1.24

1.2

2.02

1.60

Samples 5

.750

1.77

1.23

1.8

1.92

1.78

2.69

Mean and Std.Error

0.85±. 08907d

1.4± .23768cb

1.1±. 10397cd

1.38±. 11430cb

1.92±. 03736a

1.72±. 04069ab

1.91±. 19775a

*Mean having the same litter are not significantly different (p>0.05). Different litters means significantly

232

Eman Abdeen et al

Table (4) ELISA representing antibodies titer of anti- Candida albicans in sera of rats immunized with (mixed vaccines) HK-CA &CFV Control group with adjuvant

Control group with adjuvant after challenge

Samples

(zero time)

Control group after challenge

Samples1

1.06

.670

.690

Samples 2

0.79

1.84

Samples 3

1.07

Samples 4

Immunized group post first vaccination

2 w. post second vaccination

After challenge

1.46

1.84

2.02

2.67

1.14

1.3

2.24

1.74

2.97

1.0

1.2

1.18

2.12

1.83

2.66

0.62

1.73

1.24

1.2

1.84

1.79

2.43

Samples 5

.750

1.77

1.23

1.8

1.94

1.80

2.75

Mean and Std. Error

0.85± 08907d

1.4±. 23768c

1.1±. 10397cd

1.38±. 11430c

1.99±. 07960b

1.83±. 04823b

2.69±. 08681a

*Mean having the same litter are not significantly different and different litters means significantly (p>0.05). Table (5) ELISA mean of anti- Candida albicans in sera of rats immunized with different prepared vaccines in comparison with control and control with adjuvant. Types of group

zero time

1 w. post 2 w. post 2 1 weeks post first vaccination challenge vaccination

Heat killed vaccine with adjuvant

0.85 .08907d

1.84 .05320b

1.86 .05843b

1.87 .06033b

Culture filtrate vaccine

0.85 .08907d

1.92 .03736b

1.72 .04069b

1.91 .19775b

Heat killed vaccine with adjuvant &culture filtrate

0.85 .08907d

1.99 .07960b

1.83 .04823b

2.69 .08681a

Control group

0.85 .08907d

-

-

1.4 .23794c

Control group with adjuvant

0.85 .08907d

-

-

1.38 .11430c

*Mean having the same litter are not significantly different and different litters means significance (p>0.05).

SCVMJ, XVII (2) 2012 Discussion: The systemic infection of C. albicans is still of major concern regarding to the higher morbidity and mortality rates because of the difficulties in the treatment of this type of infection. In addition, the use of antifungal drugs as an only choice is still limited because of their toxicity and potential risk of the emergence of drug resistance (Vasquez and Sobel, 2003). Herein, we have isolated and identified C. albicans on Sabouraud,s dextrose agar and rice agar medium for chlamydospore formation (photo.1), and this agree with (Bhavan et al., 2010). In addition, the germ tube formation was detected (photo.2) which considered as presumptive identification test (Park and Lee, 2008). Moreover, the virulence of the C. albicans was confirmed by the production of proteinase activity, which facilitates their adhesion and tissue invasion and hence disease production (Mardegan et al., 2006). Similarly, the phospholipase activity which was considered as a determinant of C. albicans virulence factors was determined (Ibrahim et al., 1993). Interestingly, the stimulation of the proteinase production was enhanced by addition of bovine serum

233 albumin similar to that previously showed by (Lerner and Goldman, 1993). In this study the main aim was to elucidate the immune response of two prepared types of vaccines heat killed C. albicans vaccine (HK-CA) with adjuvant and culture filtrate vaccine (CFV). Wozniak and Fidel ,(2002), reported that the Candida vaccination induces IgM and IgG3 antibodies are protective in a mouse model of vaginitis and the Protection against fungal pathogens can theoretically be elicited by vaccines that stimulate humeral or cellular immunity or both (Casadevall and Perofski 2002). In addition, (Fujibayashi et al., 2009) who prepared a polyclonal anti-Candida albicans antibody in chicken egg yolk (anti-Candida albicans IgY) by immunization with the yeast form and found that antiC.albicans IgY significantly reduced the adherence of C.albicans to human oral epithelial cells and reduce the dissemination of Candida species. Hence, anti-C.albicans IgY may be considered as a prophylactic therapy. Therefore, we have assessed the immune response of two prepared vaccines via ELISA assessment of IgG. The data presented in table (2) showed that mean value of anti- C. albicans specific IgG in sera of rats

234 artificially immunized with heat killed C. albicans vaccine with adjuvant was significantly increased compared with control and control with adjuvant with no significant difference between first and booster dose of vaccine. These results are totally agree with that of (AbdelNoor et al., 2006) who found that egg-laying hen immunized with a mixture of heat killed Candida albicans yeast cells and germ tubes produce high level of IgY (egg yolk immunoglobulin) which protected mice against a lethal dose of Candida albicans. Moreover, IgY is considered as a prophylactic agent or possibly an adjunct to antifungal therapy and Mice immunized with heatinactivated whole yeast cell of Candida albicans developed intense specific humoral and cell-mediated immune response (Bromuro et al., 2002). Furthermore, (Zhang et al., 2009) observed that the IgG and IgA levels in murine serum were significantly increased after active immunization by S/C injection of heat inactivated Candida albicans spores. The data presented in table (3) showed that the levels of antiC. albicans specific IgG in sera of rats artificially immunized with culture filtrate was dramatically increased in all the periods of examination (post first vaccination, 2 weeks after

Eman Abdeen et al vaccination and after challenge with the virulent C. albicans) compared with control group and control with adjuvant. These results are consistent with the findings of (Schonheyder et al., 1983) who found that IgG Candida antibody levels were significantly higher against C. albicans culture filtrate. On the contrary, (Paul and Sobel 1994) demonstrated that the mice immunized subcutaneously with CCF-CFA (C.albicans culture filtrate antigens in complete Freund,s) produced a significant DTH reactivity in comparison with control negative mice. This is can be explained as the culture filtrate of C. albicans contained extra cellular proteinase and extracellular antigens which strongly stimulated the immune response. Regarding the rats immunized with mixed vaccines (HK-CA) vaccine & (CFV), the data showed that, the levels of anti- C. albicans IgG was notably increased to post first vaccination, at 2 weeks post second vaccination and after challenge when compared with control and control with adjuvant. Also, the level of IgG was significantly increased after challenge compared with that of first and booster dose of vaccination (Table 4). The data presented in table (5) showed that the level of immunity was increased after

SCVMJ, XVII (2) 2012 challenge in all three types of vaccines compared with control with no significant differences between level of immunity emerged by heat killed C. albicans vaccine and culture filtrate of C. albicans. Additionally, the best vaccine gives a higher immune response against C. albicans was the mixed vaccine (HK-CA&CFV).

Conclusion C. albicans was isolated and confirmed as a virulent strain (proteinase and phospholipase enzymes activity). Rats artificially immunized with heat killed C. albicans vaccine with adjuvant or with culture filtrate, or mixed vaccines (HK-CA) vaccine and (CFV) showed higher anti- C. albicans IgG in sera post first vaccination, 2 weeks post second vaccination and after challenge compared with control and control with adjuvant respectively with no significant difference in immunity level between first and booster dose of vaccine. The immune response of rats was significantly increased after challenge in all three types of vaccines and there was no significant differences between level of immunity emerged by heat killed C. albicans vaccines and culture filtrate of C. albicans. While, immunization

235 by mixed vaccine (HK-CA, CFV) showed significant increase in anti-Candida albicans than heat killed or culture filtrate alone especially after challenge with the virulent C. albicans strain. References Abdel-Noor, A.M.; Rahal, E.; Zeidan, J.A.; Halas, Y. A. and Sleiman, F. (2006): Preparation of anti-Candida albicans antibodies in an egg-laying hen and their protective efficacy in mice. J. Appl. Res., 6(1): 62-66. Aoki, S.; Ito, S.; Nakamura, Y. and Masuhara, T. (1990): Comparative pathogenesis of Wildtype strains and respiratory mutants of Candida albicans in mice. ZbI. Bakt., 273: 332-343. Bhavan, P.S.; Rajkumar, R.; Radhakrishnan, S.; Seenivasan, C. and Kannan, S. (2010): Culture and identification of Candida albicans from vaginal ulcer and separation of enolase on SDSPAGE. Intern. .J. Biology. 2(1): 84-93. Brito, E. H. S.; Fontenelle, R.O. S. ; Brilhante, R.S.N. ; Cordeiro, R. d.; Sidrim, J. J. C. and Rocha, M. F. G .(2009): Candidosis on veterinary medicine: a mycological, clinical and therapeutic approach. Cienc. Rural. 39 (9): 2655-2664. Bromuro, C. T., A.; Chiani, P.; Conti, S.; Polonelli, L. and Cassone, A. (2002). Interplay

236 between protective and inhibitory antibodies dictates the outcome of experimentally disseminated Candidasis in recipients of a Candida albicans vaccine. Infect. Immun., 5462-5470. Campbell, D.H.;Garvey, J.S.;Cremer, N.E. and Sussdorf, D.H. (1970): Methods in Immunology. W.A. Benjamin, Inc., New York. 156-157. Cardenas, F.L.; Cheng, E.; Mayeux, P.; Domer, J.E. and John, D.C. (1999): Effectiveness of a vaccine composed of Heat- killed Candida albicans and a noval Mucosal adjuvant, LT (R192G), against systemic Candidasis. Infection and Immunity. 826-833. Casadevall, A.; Feldmesser, M. and Pirofski, L. (2002): Induce humeral immunity and vaccination against major human fungal pathogens. Current opinion in Microlobilogy, 5: 386-391. Collee, J. G.; Duguid, J. P.; Fraser, A. G. ;Marmion, B. P.and Simmons, A. (1996): Mackie and McCartney Practical Medical Microbiology. 14thEd. The English Language Book Society and Churchill Living Stone Edinburgh and New York. Cutler, J. E. (1991): Putative virulence factors of Candida albicans. Annu Rev Microbiol.; 45:187–218. Fujibayashi, T.;Nakamura, M.; Tominaga, A.; Satoh,N.;

Eman Abdeen et al Kawarai, T.; Narisawa, N.; Shinozuka, O.; Watanabe, H.; Yamazaki, T. and Senpuku, H. (2009): Effects of IgY against Candida albicans and Candida spp. Adherence and Biofilm formation. Jpn. J. Infect. Dis., 62: 337-342. Ibrahim, A. S. ;Mirdod, F.; Filler, S. G.; Banno, Y.; Cole, G. T.; Kitajima, Y.; Edwards, J. E.; Nozawa, Jr. Y.; and Ghannoum, M. A. (1993): Evidence implicating Phospholipase as virulence factors of Candida albicans. Infect. Immun., 63 (5): 1993-1998. Ibrahim, A.S.; Spellberg, B. J.; Avanesian,V.; Fu. Y. and Edwards, J.E. (2006): The anticandida vaccine based on the recombinant N- Terminal Domain of Als1p is broadly active against disseminated Candidiasis. Infect. Immune., 74(5): 3039- 3041. Koneman, E. W.; Allen, S. D.; Janda, W. M.; Schrecken Berger, P. C. and Winn, J. W.C. (1992): Color Atlas and Text Book of Diagnostic Microbiology. 4th Ed. J. B. Lippincott Company, Philadelphia, USA. Lerner, C.G. and Goldman, R.C. (1993): Stimuli that induce production of Cadida albicans extracellular aspartyl proteinase . J. General. Microbiol., 139, 16431651. Leslie, H. and Frank, C. H. (1980): Practical Immunology. 2nd Ed. Department of Immunology.

SCVMJ, XVII (2) 2012 Mannarelli, B. M. and. Kurtzman, C.P. (1998). Rapid identification of Candida albicans and other human pathogenic yeasts by using short oligonucleoides in a PCR. J. Clin. Microbiol. 36: 1634164 Mardegan, R. D. C.; Foglio, M. A.; Goncalves, R. B. and Hofling, J. F. (2006): Candida albicans proteinases. Braz. J. Oral. Sci., 5(16): 944-952. -Matthews, R. and Burnie, J. (1996): Antibodies against Candida: Potential therapeutics? Trends in Microbiology. 4(9): 354-358. Merck, (1998): The Merck Veterinary Manual. Eighth Edition. Michael, S.W.; Calderone, R. A.;Brodeur, J.P.and Sande, M. A.(1983): Influence of preformed antibody on the pathogenesis of experimental Candida albicans endocarditis. Infect. Immun., 950955. Mukherjee, P. K.; Leidich, S. D.; Chandra, J.; Cole, G. T. and Ghannoum, M. A. (2001). Reintroduction of the PLB1 gene into Candida albicans restores virulence in vivo. Microbiology. 147(9): 2585- 2597. Park, B.J. and Lee, M.K. (2008): Appropriate condition of germ tube formation as presumptive identification test for Candida albicans. Korean. J. Med. Mycol., 13(1): 20-25.

237 Paul, L. F.; Lynch, M. E. and Sobel, J. D. (1994): Effects of Preinduced Candidaspecific systemic cell- mediated immunity on experimental vaginal candidasis. Infect. Immun., 1032-1038. Polak, A. (1992): Virulence of Candida albicans mutants. Mycoses, 35: 9-16. Rebell, G. and Taplin, D. (1970): Dermatophytes, their recognition and identification. Devised Edition. Refai, M.; Gobba, A. H. and Rieth, H. (1969): Monograph on yeasts. Diagnosis of disease and treatment. Egypt. Vet. Med. J. 16: 255-260. Schonheyder, H.; Johansen, J.A.; Hansen, C. M. and Stenderup, A.(1983): IgA and IgG serum antibodies to candida albicans in women of child- bearing age. Med. Mycol., (21): 223-231. Vasquez, J. A. and Sobel, J.D. (2003): Candidiasis. Clinical Mycolgy. Oxford, NY: 143-187. Voller, A. and Bidwell, D. (1986): Enzymes linked Immunosorbent Assay. In Manual of Clinical Laboratory Immunology, 3rd Ed. Rose, N.R.; Friedman, H. and Fahey, J. L. American Society for Microbiology. Washington, D.C., PP.99-109. Wozniak, K.L.; Wormley, F.L. JR. and Fidel, P.L.JR.(2002): Candida-specific antibodies during experimental vaginal candidiasis in

‫‪238‬‬

‫‪Eman Abdeen et al‬‬ ‫‪pathogenesis of Candida albicans‬‬ ‫‪keratitis.‬‬ ‫‪Investigative‬‬ ‫‪of‬‬ ‫‪Ophthalmology and Visual Science,‬‬ ‫‪50(6): 2653-2659.‬‬

‫‪70(10):‬‬

‫‪mice. Infect. Immun.,‬‬ ‫‪5790-5799.‬‬

‫;‪Zhang, H.; Cben, H.; Niu, J.‬‬ ‫‪Wang, Y. and Xie, L. (2009): Role‬‬ ‫‪of‬‬ ‫‪adaptive‬‬ ‫‪immunity‬‬ ‫‪in‬‬

‫الملخص العربى‬ ‫الكانديدا البيكانيز‪ :‬تم عزلها من حاالت إلتهاب ضرع من األبقار و تصنيفها علي المنابت الخاصة بها‬ ‫و اجراء إختبارات الضراوة مثل (فوسفوليبيز و بروتينيز ) و أيضا باستخدام تفاعل البلمرة المتسلسل‬ ‫‪ ,‬وتم تحضير اللقاحات مع إضافة ‪ bovine serum albumin‬و تم تحضير اللقاحات من العترة‬ ‫األكثر ضراوة وهي‪ :‬لقاح مستخلص الفطر ‪ CF‬و لقاح الميت بالحرارة واللقاح المختلط وفي هذه‬ ‫التجربة تم استخدام ‪ 52‬فأر تجارب مقسمة علي ‪ 2‬مجموعات كل منها تحتوي علي‪ 2‬فئران‬ ‫‪.‬المجموعة األولي ‪ :‬بها ‪ 2‬فئران تجارب وتم حقنها بلقاح الميت بالحرارة بمعدل جرعتين بينهما‬ ‫أسبوع بجرعة ‪5‬سم تحت الجلد‪.‬المجموعة الثانية ‪ :‬بها ‪ 2‬فئران تجارب وتم حقنها بلقاح مستخلص‬ ‫الفطر بجرعة ‪5‬سم تحت الجلد ‪.‬المجموعة الثالثة ‪ :‬بها ‪ 2‬فئران تجارب وتم حقنها باللقاح المختلط‬ ‫(مستخلص الفطرو الميت بالحرارة) وتم حقنها بمعدل جرعتين بينهما أسبوع ‪.‬المجموعة الرابعة ‪:‬‬ ‫بها ‪ 2‬فئران تجارب وتم حقنها بالمادة الحاملة فقط ‪.‬‬ ‫المجموعة الخامسة ‪ :‬بها ‪ 2‬فئران تجارب ولم تحقن باي تحصين وهي مجموعة قياسية‪ .‬وتم جمع‬ ‫عينات الدم لفصل السيرم (مصل الدم) للمجموعات الخمسة بعد كل جرعة من اللقاح ‪ .‬ثم احداث‬ ‫العدوي بعد ‪ 52‬يوم من الجرعة الثانية من اللقاح بالعترة عالية الضراوة‪ .‬وتم قياس األجسام‬ ‫المضادة لمرض الكانديدا البيكانز باستخدام اإلليزا و تبين من التحليل األحصائي للبيانات أن كل من‬ ‫المجموعات الثالث المحصنة أحدث استجابة مناعية عالية مقارنة بالمجموعات التي لم تحصن وأن‬ ‫مستوي المناعة ظل مرتفع حتي بعد إحداث العدوي‪ ,‬وأن المجموعة الثالثة المحصنة باللقاح المختلط‬ ‫هي األكثر استجابة مناعية خاصة بعد إحداث العدوي‪.‬‬