CAPN10 Alleles Are Associated with Polycystic Ovary Syndrome

2 downloads 6 Views 221KB Size Report
obesity, hirsutism, and amenorrhea are correlated with polycystic ovaries ... CYP19) have been tested using different linkage/association methods (6–8).

0013-7227/02/$15.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 87(8):3971–3976 Copyright © 2002 by The Endocrine Society

COMMENT CAPN10 Alleles Are Associated with Polycystic Ovary Syndrome ´ ARAGO ´ N, ALEJANDRO GONZALEZ, EDUARDO ABRIL, ALFREDO ROCA, MARIA JOSE ´ ´ MARIA JOSE FIGUEROA, PILAR VELARDE, JOSE LUIS ROYO, LUIS MIGUEL REAL, AND AGUSTI´N RUIZ Centro Avanzado de Fertilidad, Unidad de Reproduccio´n y Gene´tica Humana, Instituto Medico Serman, Jerez de la Frontera (A.G., E.A., A.Ro., M.J.A., M.J.F., P.V.), Ca´diz, Spain; Unidad Materno- Infantil, Hospital Virgen de las Montan˜as (A.G.), Villamartin, Ca´diz, Spain; and Departamento de Geno´mica Estructural, Neocodex, Parque Cientı´fico y Tecnolo´gico Isla de la Cartuja (J.L.R., L.M.R., A.Ru.), Sevilla, Spain Polycystic ovary syndrome (PCOS) is characterized by chronic anovulation infertility, hyperandrogenemia, and frequently insulin resistance. This study investigated whether polymorphisms in the CAPN10 gene are related with PCOS etiology. The allelic frequencies and genotypes of CAPN10 polymorphisms UCSNP-44, 43, 19, and 63 were determined in 55 well characterized women with polycystic ovaries and 93

I

N 1935, STEIN AND LEVENTHAL demonstrated that obesity, hirsutism, and amenorrhea are correlated with polycystic ovaries, identifying a novel syndrome named Stein-Leventhal or polycystic ovary syndrome (PCOS, MIM 184700). PCOS is a common endocrinopathy that is found in about 5–10% of women of reproductive age (1). Specifically in Spain, a prospective study reported an overall 6.5% prevalence of PCOS (2). Previous studies suggest that genetics factors play a major role in the etiology of PCOS (3). However, the mode of inheritance of PCOS remains unclear, and recent studies indicate that this disorder is a complex trait (4). This means that several genes are interacting with environmental factors to provoke the phenotype (5). Recent genetic studies have identified several genes within different metabolic pathways that could be involved in the pathogenesis of PCOS. Specifically, genes encoding for enzymes of the steroid hormone synthesis (CYP11a, CYP17, and CYP19) have been tested using different linkage/association methods (6 – 8). In addition, genes involved in the insulinsignaling pathway (9 –11), genes involved in gonadotropin action (12, 13), genes controlling body weight, APO E, and two dopamine receptor genes have been analyzed (14 –16). Most of these works have not been replicated extensively, and the molecular mechanism underlying the specific contribution of these genes to PCOS remains unknown (8). However, these works have pinpointed several metabolic routes that must contain polygenes involved in PCOS susceptibility. Depending on the series, PCOS is associated with a 2- to 7-fold risk of type 2 diabetes mellitus (T2DM; Refs. 17, 18). Abbreviations: PCOS, Polycystic ovary syndrome; SNP, single nucleotide polymorphism; T2DM, type 2 diabetes mellitus.

unrelated healthy controls using spectrofluorimetric analyses and real-time PCR. Our data indicate that CAPN10 UCSNP-44 allele is associated with PCOS in the Spanish population (P ⴝ 0.01). These results support a role of Calpain 10 gene in PCOS susceptibility in humans. (J Clin Endocrinol Metab 87: 3971–3976, 2002)

Previous epidemiological and genetic studies have revealed that PCOS and T2DM could share genetic susceptibility factors involved in both pathologies. Following this working hypothesis, several studies have demonstrated that loci involved in T2DM may play a role in PCOS pathogenesis (8 –10, 18, 19). A genomewide scan for T2DM genes in Mexican Americans localized NIDDM1, a susceptibility locus on chromosome 2 (20). Interestingly, it has been shown that NIDDM1 acts in concert with another locus located at chromosome 15 within a genomic region that contains the CYP19 gene (a candidate gene for PCOS) (21). Recently, the Calpain 10 gene (CAPN10), encoding a ubiquitous member of the calpain-like cysteine protease family, was positional cloned within NIDDM1 region (22). Association studies using intragenic markers of CAPN10 gene have revealed that CAPN10 alleles may contribute to genetic predisposition to T2DM in different populations (22, 23) and also could modify proinsulin processing and insulin secretion in nondiabetic patients (24). Although the precise role of Calpain 10 in T2DM remains unknown (25), UCSNP-43 polymorphism within intron 3 of CAPN10 gene seems to be associated with reduced muscle mRNA levels of CAPN10 and insulin resistance (26). The aim of the present study was to investigate the role of CAPN10, a T2DM locus, in PCOS patients. We decided to examine this hypothesis with an association study using a population-based series of patients with PCOS for the frequency of four intronic polymorphisms within CAPN10 (USCSNP-43, UCSNP-44, UCSNP-19, and UCSNP-63). Our results indicate that CAPN10 gene may play a role in PCOS susceptibility in humans.

3971

3972

J Clin Endocrinol Metab, August 2002, 87(8):3971–3976

Gonzalez et al. • Comments

Patients and Methods

methods reported here are fast and reliable, allowing rapid genotyping that makes epidemiological studies more suitable to perform.

The study population consisted of 55 unrelated women with PCOS. The ethnicity of all probands and women controls was Caucasian (white Europid). PCOS was defined by the presence of 1) amenorrhea and/or oligomenorrhea (menstrual cycles 35 d); 2) clinical hyperandrogenism: hirsutism following Ferriman and Galleway criteria, acne, alopecia; 3) biochemical hyperandrogenism: increased testosterone levels (3 nmol/liter); 4) bilateral polycystic ovaries on ultrasound scan: more than eight follicles of more than 2-mm diameter, increased volume of stroma, and increased ovarian volume (9 ml; Ref. 27); and 5) exclusion criteria: hyperprolactinemia, thyroid disorders, and nonclassic 21-hydroxylase deficiency (27). Selected probands were examined by one of the study investigators (A.G.). To estimate population frequencies of single nucleotide polymorphisms (SNPs) analyzed, 93 unselected healthy women from the same geographical region were genotyped in an anonymized fashion. The referral center for this study is the Centro Avanzado de Fertilidad (Jerez, Andalucia, Spain). Informed consent was obtained from all patients.

PCR conditions. Real-time PCR was performed in the LightCycler system (Roche Diagnostics, Mannheim, Germany) using reaction conditions previously published (28–30). PCR was performed to amplify the segments of the CAPN10 gene that flanks UCSNP-43/44 (intron 3), UCSNP-19 (intron 6), or UCSNP-63 (intron 13). Briefly, a final volume of 10 ␮l using 10 ng of genomic DNA, 1 mm each amplification primer, 4.4 mm MgCl2 , 0.2 mm each detection probe (when necessary), and 1 `ıl of LC Faststart DNA Master SYBR green I (Roche Applied Science; for UCSNP-19 or 1 `ıl) or LC Faststart DNA Master hybridization probes (Roche Applied Science) for UCSNP43/44 and -63. We used an initial denaturation step of 95 C for 7 min, followed by 40 cycles of 95 C for 0 sec, 66 C for 15 sec, and 72 C for 30 sec.

Patients

DNA extraction We obtained 5 ml of peripheral blood from all patients to isolate germline DNA from leukocytes. DNA extraction was performed according to standard procedures using Nucleospin Blood Kit (MachereyNagel, Du¨ ren, Germany). To perform PCRs, we prepared aliquots of DNA at a concentration of 5 ng/␮ l. The rest of the stock was cryopreserved at ⫺20 C.

Genotyping using real-time PCR Primers and probes. We designed and synthesized amplification primers and fluorescent detection probes for the PCRs of the Calpain 10 gene using the Oligo software (www.hgmp.mrc.ac.uk) following the manufacturer’s instructions. The DNA sequence used to carry out this study corresponds to the genomic sequence of the CAPN10 gene (GenBank accession no. AF158748). The selected primer pairs and detection probes are summarized in Table 1. Allelic frequency and genotype distribution of UCSNP-19, -43, -44, and -63 within CAPN10 gene were determined in 93 unselected women (Table 2). Our data indicate that the allele frequencies of UCSNP-44, -43, -19, and -63 in Spain are very similar to those reported for other European populations elsewhere (Refs. 22, 23; Table 2). Spectrofluorimetric

TABLE 1. Primers and probes used for genotyping CAPN10 markersa UCSNP-43/UCSNP-44 Primers 43F 43R Probes 43-Sensorb 43-Anchor UCSNP-19 Primers 19F 19R UCSNP-63 Primers 63F 63R Probes 63-Sensor 63-Anchor

5⬘ tccatagcttccacgcctcc 3⬘ 5⬘ aatcgtccaaccgctgcctc 3⬘ 5⬘ gCgaagtaaggcGtttgaag-Fl 3⬘ 5⬘ CY5-tgaggctaagccttgacttggtgagga-Ph 3⬘ 5⬘ caggcccagtttggttctcttc 3⬘ 5⬘ ctcccacaagcccaccct 3⬘ 5⬘ ctgacacttcactcggtcagag 3⬘ 5⬘ cttaggaagcttcttgagcctg 3⬘ 5⬘ tgacgggggtggagCgaggg-Fl 3⬘ 5⬘ CY5-tgggccgcgtctgtgcaggctcaagaag-Ph 3⬘

a Primer and internal probes used to amplify and detect genotypes of UCSNP-43, -44, -19, and -63 of the CAPN10 gene. Nucleotides in capitals within sensor probes represent the position sensitive for the wild-type and mutant alleles. Fl, Fluorescein; CY5, specific fluorochrome; Ph, phosphate at 3⬘.

Melting curves. The conditions to obtain optimal melting curves and spectrofluorimetric genotypes were 95 C for 0 sec, 50 C for 0 sec, and 95 C for 0 sec (with a temperature-transfer speed of 20 C/sec in each step, except the last step, in which the speed of temperature transfer was 0.2 C/sec). In the last step, a continuous fluorometric register was performed (F3/F1), fixing the gains of the system at 1, 15, and 250 on channels F1, F2, and F3, respectively, for UCSNP-43/44 and UCSNP-63. To detect UCSNP-19, the fluorometric register was performed at F1 channel, fixing the gains of the system at 5, 10, 10 in channels F1, F2, and F3, respectively. Genotype results using real time-PCR are shown in Fig. 1. To test the specificity of these assays, selected amplicons of different melting patterns were sequenced using an automated DNA sequencer (Beckman Coulter CEQ 2000XL, Beckman Coulter, Inc., Fullerton, CA; data not shown). For UCSNP-19 (32-bp insertion/deletion polymorphism), conventional 2% agarose electrophoresis was carried out (data not shown).

Statistical analysis Allelic frequencies between PCOS and controls where compared using standard ␹2 tests with Yate’s correction. To perform statistical analysis of genotypes, individuals heterozygous and homozygous for the p allele of each SNP where grouped (when necessary) to avoid values lower than 5 in cells. All statistical calculations where performed using Statcalc software (EpiInfo 5.1).

Results

We have investigated 55 unrelated cases of PCOS compared with control population for the frequency of polymorphic alleles at four loci within CAPN10 gene (UCSNP-44, UCSNP-43, UCSNP-19, and UCSNP-63). Of these loci, an elevated frequency of the respective polymorphic allele occurred at two polymorphisms in PCOS compared with women controls (Table 3). The associations were observed in UCSNP-44 (intron 3) and UCSNP-19 (intron 6). Among a total 110 PCOS chromosomes, 25 (22.7%) have the polymorphic variant C, and 85 (77.3%) have the wild-type T at UCSNP-44 locus. In contrast, in the Spanish population analyzed, we found 21 (11.3%) C polymorphic and 165 (88.7%) T wild-type alleles, respectively. The difference in allelic frequencies in this genetic marker between PCOS and controls was statistically significant (␹2 ⫽ 6.04; P ⫽ 0.01, with Yate’s correction). Moreover, for UCSNP-19, we also obtained a positive correlation: 52 of 110 (47.2%) PCOS alleles have the deleted allele of this polymorphic marker, compared with 64 of 186 (34.4%) control chromosomes (␹2 ⫽ 3.99; P ⫽ 0.045, with Yate’s correction). Interestingly, both polymorphic alleles UCSNP-44 (C) and UCSNP-19 (deleted), associated to PCOS phenotype in the present study, appear to be in linkage disequilibrium (23). Moreover, the C allele of UCSNP-44 has been associated very recently to T2DM in European populations (23). Genotype distributions for each polymorphism were also determined and compared between PCOS and healthy

Gonzalez et al. • Comments

J Clin Endocrinol Metab, August 2002, 87(8):3971–3976 3973

TABLE 2. Allele frequencies of CAPN10 markers in different populations Genetic markera

UCSNP-44 UCSNP-43 UCSNP-19 UCSNP-63

Chinaa

USAa

Mexican Americansa

Finlanda

Germanya

UKb

Spainc

na 0.06 0.38 0.31

na 0.19 0.40 0.06

0.06 0.27 0.41 0.23

na 0.323 0.28 0.03

na 0.29 0.29 0.04

0.15 0.25 0.39 0.07

0.11 0.24 0.34 0.08

na, Nonavailable. a According to Horikawa et al. (22). b According to Evans et al. (23). c Present work.

FIG. 1. Spectrofluorimetric analysis of CAPN10 markers using real-time PCR. Analysis of the fluorescence measured during melting curve determination in the LightCycler (Roche Applied Science). Each allele has a specific melting point. A, Detection of UCSNP-43 and -44 polymorphisms (melting points, UCSNP-43 allele, 54 C; UCSNP-44 allele, 64 C; wild-type allele, 59.5 C). B, Detection of UCSNP-19 polymorphism (melting points, deleted allele, 85.7 C; inserted allele, 86.8 C). C, Detection of UCSNP-63 polymorphism (melting points, UCSNP-63 allele, 62 C; wild-type, 69.5 C).

women (Table 3). All genotype frequencies are in accordance with Hardy-Weinberg equilibrium law (P 0.43). Again, when comparing genotypes observed in PCOS patients vs. those obtained in control genotypes, a significant association is also achieved for UCSNP-44 genotypes (␹2 ⫽ 5.99; P ⫽ 0.023, with Yate’s correction; for details, see Table 4).

Discussion

The genetic basis of PCOS is currently not well understood (31). However, it seems that the rule for most PCOS patients will be the coexistence of both environmental and genetic factors interacting in a complex fashion to provoke the PCOS

3974

J Clin Endocrinol Metab, August 2002, 87(8):3971–3976

Gonzalez et al. • Comments

TABLE 3. Association studies of CAPN10 alleles in PCOS Genetic markera

PCOS patients (n ⫽ 55, 110 chromosomes)

Spanish population (n ⫽ 93, 186 chromosomes)

T C

85 25

165 21

G A

81 29

140 46

Inserted Deleted

58 52

120 64

C T

95 13

167 15

Alleles

␹2 ⫽ 6.04, P ⫽ 0.01

UCSNP-44 UCSNP-43 UCSNP-19 UCSNP-63

a b

Statistical analysisb

␹2 ⫽ 0.03, P ⫽ 0.86 ␹2 ⫽ 3.99, P ⫽ 0.045 ␹2 ⫽ 0.73, P ⫽ 0.39

According to Horikawa et al. (22). ␹2 with Yate’s correction.

TABLE 4. Genotype analysis of CAPN10 polymorphisms in PCOS patients and Spanish population Genotypes observed in PCOS

UCSNP-44 TT TC CC UCSNP-43 GG GA AA UCSNP-19 Del/Del Del/Ins Ins/Ins UCSNP-63 CC CT TT

P value

Genotypes observed in control population

0.87a, 0.02b 34 17 4

0.97 75 15 3

1.0a, 0.97b 31 19 5

0.82 54 32 7

0.97a, 0.1b 13 26 16

0.43 15 34 43

1.0a, 0.71b 43 9 2

P valuea

1.0 76 15 0

Del, Deleted; Ins, inserted. ␹2 HWE: Hardy-Weinberg equilibrium, compares observed genotypes in a population versus those inferred with the Hardy-Weinberg law algorithm (p2⫹2pq⫹q2⫽1). b 2 ␹ PCOS vs. controls. a

phenotype (4). This etiology model is applied for almost all common diseases such schizophrenia, dementia, cardiovascular diseases, or diabetes mellitus (5). Recent studies have identified several CAPN10 alleles associated to T2DM susceptibility (22–24). Initially, the inheritance of a specific haplotype combination defined by three SNPs (UCSNP-43, -19, and -63) was found to be associated with an increased risk of T2DM in Mexican Americans (22). However, the examination of the contribution of CAPN10 alleles to the development of diabetes mellitus in Europeans revealed that UCSNP-44, rather than UCSNP-43, is associated to genetic predisposition to T2DM in Europids (23). Our data provide support for the involvement of CAPN10 UCSNP-44 as a determinant of risk for PCOS in Spanish population, suggesting that UCSNP-44 allele could be related to both pathologies. Our study provides a new candidate gene for PCOS that must be widely evaluated. Further studies in PCOS cohorts of other ethnicity and geographical location will be necessary to check our results. In this way,

it would be interesting to perform meta-analyses of our findings testing autosomal dominant PCOS families, sib pairs analyses, and new case-control studies; increasing PCOS sample; and testing family-based controls and/or population-based controls to evaluate, contrast and weight our findings. Moreover, it is interesting to evaluate the CAPN10 gene in other lipodystrophies observed in humans like the metabolic syndrome observed in hypertension, congenital lipodystrophies, or lipodystrophy related with antiretroviral treatments. Our study also provides a novel genetic evidence of the relationships between T2DM and PCOS, suggesting that both pathologies share clinical findings, biochemical pathways, and genetic risk factors (18, 32). It will be very interesting to perform association studies between some phenotypic characteristics of PCOS patients (i.e. ␤-cell function parameters, insulin resistance, family history of diabetes, hypertension or hyperinsulinemia) and CAPN10 haplotypes. However, due to small sample size available, we cannot perform these studies in the PCOS group. In this way, we are currently collecting 4-fold PCOS samples within our geographical region to perform phenotype-genotype correlation studies. We and others think that the discovery of molecular mechanisms underlying the link between T2DM and PCOS could provide a core of important proteins and functions very interesting for molecular diagnosis and drug development in PCOS (4, 31). In this way, physiological links between PCOS and insulin-signaling pathways have been reported at a molecular level, suggesting that IGF pathways are involved in ovarian steroidogenesis and follicle maturation (32, 33). It is well established that ovarian theca cells are stimulated via insulin-insulin receptor pathways and IGF-I to synthesize androgens and to perform apoptosis inhibition of growing follicles. On the other hand, a high bioavailability of IGF-II at ovarian granulose cell level provokes high levels of CYP19 aromatase, follicle growth, maturation, and an increased estradiol synthesis (34 –37). Recent studies suggest that an abnormal ratio of IGF-I/IGF-II at ovarian level could contribute to the development of ovarian cysts and hyperandrogenemia. Both symptoms are observed in PCOS patients (38, 39). Because the IGF-I/IGF-II ratio is strongly regulated via IGF binding proteins and unidentified proteases controlling IGF

Gonzalez et al. • Comments

J Clin Endocrinol Metab, August 2002, 87(8):3971–3976 3975

binding protein activities (40), it is tempting to speculate how CAPN10 protease could be related to the fine tuning of insulin-dependent biochemical pathways involved in ovarian physiology. Finally, Cox et al. (21) have reported a genetic interaction between CAPN10 and several genetic markers close to CYP19 aromatase locus in T2DM patients. Because CYP19 aromatase encodes a core protein involved in ovarian steroid synthesis, it will be interesting to analyze this phenomena in PCOS patients and its relation to androgen/estrogen synthesis in the ovary. Further association and functional studies are necessary to clarify the role of CAPN10 alleles in diabetes, PCOS, and ovarian physiology. In this way, expression analyses and other in vitro experiments in thecal and granulose cells of selected patients are under investigation. We believe that these new studies will help to elucidate the molecular mechanism of the new genetic association discovered. Acknowledgments We are deeply grateful to PCOS patients and controls for participation in this study. We are very grateful to Sonsoles Vidal, Mayte Pizarro, and Dr. Ana Bernal for patient and sample management. Received January 3, 2002. Accepted May 10, 2002. Address all correspondence and requests for reprints to: Dr. Alejandro Gonzalez, Centro Avanzado de Fertilidad, Unidad de Reproduccio´ n y Gene´ tica Humana, Instituto Medico Serman, 11405 Jerez de la Frontera, Ca´ diz, Spain. E-mail: [email protected] Neocodex has been partially funded by the Ministerio de Ciencia y Tecnologı´a (Grants IDE2000-0633, IDE2000-0705 and FIT-010000-2001-86).

References 1. Asteria C 2000 Identification of follistatin as a possible trait-causing gene in polycystic ovary syndrome. Eur J Endocrinol 143:467– 469 2. Asuncion M, Calvo RM, San Millan JL, Sancho J, Avila S, Escobar-Morreale HF 2000 A prospective study of the prevalence of the polycystic ovary syndrome in unselected Caucasian women from Spain. J Clin Endocrinol Metab 85:2434 –2438 3. Legro RS, Driscoll D, Strauss III JF, Fox J, Dunaif A 1998 Evidence for a genetic basis for hyperandrogenemia in polycystic ovary syndrome. Proc Natl Acad Sci USA 95:14956 –14960 4. Crosignani PG, Nicolosi AE 2001 Polycystic ovarian disease: heritability and heterogeneity. Hum Reprod Update 7:3–7 5. Weiss KM, Terwilliger JD 2000 How many diseases does it take to map a gene with SNPs? Nat Genet 26:151–157 6. Carey AH, Waterworth D, Patel K, White D, Little J, Novelli P, Franks S, Williamson R 1994 Polycystic ovaries and premature male pattern baldness are associated with one allele of the steroid metabolism gene CYP17. Hum Mol Genet 3:1873–1876 7. Gharani N, Waterworth DM, Batty S, White D, Gilling-Smith C, Conway GS, McCarthy M, Franks S, Williamson R 1997 Association of the steroid synthesis gene CYP11a with polycystic ovary syndrome and hyperandrogenism. Hum Mol Genet 6:397– 402 8. Urbanek M, Legro RS, Driscoll DA, Azziz R, Ehrmann DA, Norman RJ, Strauss III JF, Spielman RS, Dunaif A 1999 Thirty-seven candidate genes for polycystic ovary syndrome: strongest evidence for linkage is with follistatin. Proc Natl Acad Sci USA 96:8573– 8578 9. McKeigue P, Wild S 1997 Association of insulin gene VNTR polymorphism with polycystic ovary syndrome. Lancet 349:1771–1772 10. Waterworth DM, Bennett ST, Gharani N, McCarthy MI, Hague S, Batty S, Conway GS, White D, Todd JA, Franks S, Williamson R 1997 Linkage and association of insulin gene VNTR regulatory polymorphism with polycystic ovary syndrome. Lancet 349:986 –990 11. Talbot JA, Bicknell EJ, Rajkhowa M, Krook A, O’Rahilly S, Clayton RN 1996 Molecular scanning of the insulin receptor gene in women with polycystic ovarian syndrome. J Clin Endocrinol Metab 81:1979 –1983 12. Elter K, Erel CT, Cine N, Ozbek U, Hacihanefioglu B, Ertungealp E 1999 Role of the mutations Trp8fArg and Ile15fThr of the human luteinizing hormone ␤-subunit in women with polycystic ovary syndrome. Fertil Steril 71:425– 430

13. Conway GS, Conway E, Walker C, Hoppner W, Gromoll J, Simoni M 1999 Mutation screening and isoform prevalence of the follicle stimulating hormone receptor gene in women with premature ovarian failure, resistant ovary syndrome and polycystic ovary syndrome. Clin Endocrinol 51:97–99 14. Kahsar-Miller M, Boots LR, Azziz R 1999 Dopamine D3 receptor polymorphism is not associated with the polycystic ovary syndrome. Fertil Steril 71:436 – 438 15. Legro RS, Dietz GW, Comings DE, Lobo RA, Kovacs BW 1994 Association of dopamine D2 receptor gene haplotypes with anovulation and fecundity in female Hispanics. Hum Reprod 9:1271–1275 16. Heinonen S, Korhonen S, Hippelainen M, Hiltunen M, Mannermaa A, Saarikoski S 2001 Apolipoprotein E alleles in women with polycystic ovary syndrome. Fertil Steril 75:878 – 880 17. Dunaif A 1995 Hyperandrogenic anovulation (PCOS): a unique disorder of insulin action associated with an increased risk of non-insulin-dependent diabetes mellitus. Am J Med 98:33S–39S 18. Colilla S, Cox NJ, Ehrmann DA 2001 Heritability of insulin secretion and insulin action in women with polycystic ovary syndrome and their first degree relatives. J Clin Endocrinol Metab 86:2027–2031 19. Eaves IA, Bennett ST, Forster P, Ferber KM, Ehrmann D, Wilson AJ, Bhattacharyya S, Ziegler AG, Brinkmann B, Todd JA 1999 Transmission ratio distortion at the INS-IGF2 VNTR. Nat Genet 22:324 –325 20. Hanis CL, Boerwinkle E, Chakraborty R, Ellsworth DL, Concannon P, Stirling B, Morrison VA, Wapelhorst B, Spielman RS, Gogolin-Ewens KJ, Shepard JM, Williams SR, Risch N, Hinds D, Iwasaki N, Ogata M, Omori Y, Petzold C, Rietzch H, Schroder HE, Schulze J, Cox NJ, Menzel S, Boriraj VV, Chen X, Lim LR, Lindner T, Mereu LE, Wang Y-Q, Xiang K, Yamagata K, Yang Y, Bell GI 1996 A genome-wide search for human non-insulindependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nat Genet 13:161–166 21. Cox NJ, Frigge M, Nicolae DL, Concannon P, Hanis CL, Bell GI, Kong A 1999 Loci on chromosomes 2 (NIDDM1) and 15 interact to increase susceptibility to diabetes in Mexican Americans. Nat Genet 21:213–215 22. Horikawa Y, Oda N, Cox NJ, Li X, Orho-Melander M, Hara M, Hinokio Y, Lindner TH, Mashima H, Schwarz PE, del Bosque-Plata L, Horikawa Y, Oda Y, Yoshiuchi I, Colilla S, Polonsky KS, Wei S, Concannon P, Iwasaki N, Schulze J, Baier LJ, Bogardus C, Groop L, Boerwinkle E, Hanis CL, Bell GI 2000 Genetic variation in the gene encoding calpain-10 is associated with type 2 diabetes mellitus. Nat Genet 26:163–175 23. Evans JC, Frayling TM, Cassell PG, Saker PJ, Hitman GA, Walker M, Levy JC, O’Rahilly S, Rao PV, Bennett AJ, Jones EC, Menzel S, Prestwich P, Simecek N, Wishart M, Dhillon R, Fletcher C, Millward A, Demaine A, Wilkin T, Horikawa Y, Cox NJ, Bell GI, Ellard S, McCarthy MI, Hattersley AT 2001 Studies of association between the gene for calpain-10 and type 2 diabetes mellitus in the United Kingdom. Am J Hum Genet 69:544 –552 24. Stumvoll M, Fritsche A, Madaus A, Stefan N, Weisser M, Machicao F, Haring H 2001 Functional significance of the UCSNP-43 polymorphism in the CAPN10 gene for proinsulin processing and insulin secretion in nondiabetic Germans. Diabetes 50:2161–2163 25. Permutt MA, Bernal-Mizrachi E, Inoue H 2000 Calpain 10: the first positional cloning of a gene for type 2 diabetes? J Clin Invest 106:819 – 821 26. Baier LJ, Permana PA, Yang X, Pratley RE, Hanson RL, Shen GQ, Mott D, Knowler WC, Cox NJ, Horikawa Y, Oda N, Bell GI, Bogardus C 2000 A calpain-10 gene polymorphism is associated with reduced muscle mRNA levels and insulin resistance. J Clin Invest 106:R69 –R73 27. Zawadzky JK, Dunaif A 1992 Diagnostic criteria for polycystic ovary syndrome: towards a rational approach. In: Dunaif A, Givens JR, Haseltine F, Merrian GR, eds. Polycystic ovary syndrome. Boston: Blackwell; 377–384 28. Royo JL, Ruiz A, Borrego S, Rubio A, Sanchez B, Nunez-Roldan A, Lissen E, Antinolo G 2001 Fluorescence resonance energy transfer analysis of CCRV64I and SDF1-3⬘a polymorphisms: prevalence in southern Spain HIV type 1⫹ cohort and noninfected population. AIDS Res Hum Retroviruses 17:663– 666 29. Real LM, Gayoso AJ, Olivera M, Caruz A, Ruiz A, Gayoso F 2001 Detection of nucleotide c985 A3 G mutation of medium-chain acyl-CoA dehydrogenase gene by real-time PCR. Clin Chem 47:958 –959 30. Ruiz A, Antinolo G, Marcos I, Borrego S 2001 Novel technique for scanning of codon 634 of the RET protooncogene with fluorescence resonance energy transfer and real-time PCR in patients with medullary thyroid carcinoma. Clin Chem 47:1939 –1944 31. Franks S, White D, Gilling-Smith C, Carey A, Waterworth D, Williamson R 1996 Hypersecretion of androgens by polycystic ovaries: the role of genetic factors in the regulation of cytochrome P450c17 ␣. Baillieres Clin Endocrinol Metab 10:193–203 32. Herna´ndez ER, Hurwitz A, Vera A, Pellicer A, Adashi EY, LeRoith D, Roberts Jr CT 1992 Expression of the genes encoding the insulin-like growth factors and their receptors in human ovary. J Clin Endocrinol Metab 74: 419 – 425 33. Zhou J, Bondy C 1993 Anatomy of the human ovarian insulin-lilke growth factor system. Biol Reprod 48:467– 470 34. El-Roeiy A, Chen X, Roberts VJ, Shimasakai S, Ling N, LeRoith D, Roberts Jr CT, Yen SS 1994 Expression of the genes encoding the insulin-like growth factors, the IGF and insulin receptors, and IGF-binding proteins-1– 6 and the

3976

J Clin Endocrinol Metab, August 2002, 87(8):3971–3976

localization of their gene products in normal and polycystic ovary syndrome ovaries. J Clin Endocrinol Metab 78:1488 –1496 35. Steinkampf MP, Mendelson CR, Simpson ER 1988 Effects of epidermal growth factor and insulin-like factor I on the levels of mRNA encoding aromatase cytochrome P-450 of human ovarian granulosa cells. Mol Cell Endocrinol 59:93–98 36. Hsueh AJW, Billig H, Tsafriri A 1994 Ovarian follicle atresia: a hormonally controlled apoptotic process. Endocr Rev 15:707–724 37. San Roma´ n GA, Magoffin DA 1993 Insulin-like growth factor binding proteins in healthy and atretic follicles during natural menstrual cycles. J Clin Endocrinol Metab 76:625– 632

Gonzalez et al. • Comments

38. Schuller AGP, Lindenbergh-Kortleve DJ, Pache TD, Zwarthoff EC, Fauser BC, Drop SL 1993 Insulin-like growth factor binding protein-2, 28 kDa and 24 kDa IGF-BP levels are decreased in fluid of dominant follicles, obtained from normal and polycystic ovaries. Regul Pept 48:157–163 39. Cataldo NA 1997 Insulin-like growth factor binding proteins: do they play a role in polycystic ovary syndrome? Semin Reprod Endocrinol 15: 123–136 40. Mason HD, Cwyfan-Hughes SC, Heinrich G, Franks S, Holly JM 1996 Insulin-like growth factor-I (IGF-I), IGF-II, IGF binding protein (IGFBP) and IGFBP proteases are produced theca and stroma of normal and PCOS human ovaries. J Clin Endocrinol Metab 81:276 –284

Foundation for Advanced Education in the Sciences October 23–27, 2002 Bethesda, Maryland Organizers: Derek LeRoith, M.D., Ph.D.; Stephen J. Marx, M.D.; Lynette Nieman, M.D.; and Nicholas J. Sarlis, M.D., Ph.D. The purpose of this course is to provide an up-to-date, state-of-the-art review of clinical endocrinology, emphasizing pathophysiology, diagnosis, and treatment. The course objectives are two-fold: to encourage an organized, efficient and cost-effective approach to the clinical, laboratory, and radiologic diagnosis of endocrine disease, with emphasis on recent advances; and to stimulate awareness of new approaches to treatment, including the indications, risks, and benefits relative to alternative therapies. The course is intented both for physicians who are preparing for the endocrinology subspecialty board examination and for physicians certified in endocrinology who wish to remain abreast of recent advances in the field. Tuition for the course is $700.00 for physicians and $375.00 for residents and fellows who verify their status. For reasonable accommodations and additional information, please visit www.faes.org or contact Stephanie Hollis, Phone (301) 496-7975, E-mail [email protected] The NIH/FAES is accredited by the Accreditation Council for Continuing Medical Education to sponsor continuing medical education for physicians. The NIH/FAES designates this educational activity for a maximum of 43.5 hours in category 1 credit toward the AMA Physician’s Recognition Award. Each physician should claim only those hours of credit actually spent in the educational activity.

Suggest Documents