Changes in Leydig Cell Gene Expression During Development in the ...

BIOLOGY OF REPRODUCTION 66, 966–975 (2002)

Changes in Leydig Cell Gene Expression During Development in the Mouse1 P.J. O’Shaughnessy,2 L. Willerton, and P.J. Baker Division of Veterinary Physiology and Pharmacology, Department of Veterinary Preclinical Studies, University of Glasgow Veterinary School, Glasgow G61 1QH, United Kingdom ABSTRACT

development of the adult Leydig cell population. The role of gonadotropins, for example, is unclear. In hypogonadal mice, which lack circulating gonadotropins, the rise in Leydig cell number associated with the differentiation of the adult population does not occur [1]. There is further evidence, however, based on developmental timing in the rat testis, that adult Leydig cell differentiation can occur without LH [2]. Other factors are also likely to be involved, such as Desert Hedgehog (Dhh) and platelet-derived growth factor-A (PDGF-A), both of which appear to be required for Leydig cell precursor survival, differentiation, or both [3, 4]. Lack of understanding about development of the adult Leydig cell population stems to some extent from our need to characterize the normal developmental profile of the cells and to identify markers of adult Leydig cell differentiation. The development of real-time polymerase chain reaction (PCR) now means that we have a rapid, sensitive, and accurate method for measuring changes in expression of Leydig cell-specific mRNA species. The aim of this study was to examine the developmental pattern of mRNA species known to be expressed in mouse Leydig cells, with the intentions of partially characterizing the phenotype of the cells and of identifying markers of adult Leydig cell differentiation. The 18 mRNA species examined in this study were chosen because they have been reported to be expressed within the Leydig cell, and sufficient sequence data was available to design primers and probes for real-time PCR. The mRNA species examined, and reference to their expression within the Leydig cell appears in Table 1. A second criteria that was applied to selection of mRNA species was that, within the testis, expression should be limited primarily, if not solely, to the Leydig cells. In the adult animal this applies to most mRNA species studied here, the known exception being GST5-5, which is also expressed in spermatids [5]. There have been few developmental studies, however, of changes in mRNA levels, and it is possible that the main sites of expression may change with age, as has been shown previously for 17b-HSD III and PGD-synthetase [6, 7]. For these reasons, studies reported here have been carried out using isolated testicular interstitial webs to remove possible tubular expression of mRNA species.

Developmental changes in the expression of 18 Leydig cellspecific mRNA species were measured by real-time polymerase chain reaction to partially characterize the developmental phenotype of the cells in the mouse and to identify markers of adult Leydig cell differentiation. Testicular interstitial webs were isolated from mice between birth and adulthood. Five developmental patterns of gene expression were observed. Group 1 contained mRNA species encoding P450 side chain cleavage (P450scc), P450c17, relaxin-like factor (RLF), glutathione S-transferase 5-5 (GST5-5), StAR protein, LH receptor, and epoxide hydrolase (EH); group 2 contained 3b-hydroxysteroid dehydrogenase (3b-HSD) VI, 17b-hydroxysteroid dehydrogenase (17bHSD) III, vascular cell adhesion molecule 1, estrogen sulfotransferase, and prostaglandin D (PGD)-synthetase; group 3 contained patched and thrombospondin 2 (TSP2); group 4 contained 5a-reductase 1 and 3a-hydroxysteroid dehydrogenase; group 5 contained sulfonylurea receptor 2 and 3b-HSD I. Group 1 contained genes that were expressed in fetal and adult Leydig cells and which increased in expression around puberty toward a maximum in the adult. Group 2 contained genes expressed only in the adult Leydig cell population. Group 3 contained genes with predominant fetal/neonatal expression in the interstitial tissue. Group 4 contained genes with a peak of expression around puberty, whereas genes in group 5 show little developmental change in expression. Highest mRNA levels in descending order were RLF, P450c17, EH, 17b-HSD III, PGD-synthetase, GST5-5, and P450scc. Results identify five genes expressed in the mouse adult Leydig cell population, but not in the fetal population, and one gene (TSP2) that may be expressed only in the fetal Leydig cell population. The developmental pattern of gene expression suggests that three distinct phases of adult Leydig cell differentiation occur.

developmental biology, gene regulation, Leydig cells, testis, testosterone

INTRODUCTION

Two populations of Leydig cells arise in the course of testis development. The ‘‘fetal’’ population arises soon after testis differentiation, at about 12.5 days postcoitum in the mouse, and is essential for masculinization of the fetus. The second, ‘‘adult’’ population, arises after birth in the mouse, and testosterone secretion by this population acts to induce male behavior, secondary sexual characteristics, and fertility. Currently, little is known about factors that regulate

MATERIALS AND METHODS

Grant support: BBSRC and Wellcome Trust. L.W. was supported by a scholarship from the University of Glasgow. 2 Correspondence: P.J. O’Shaughnessy, Division of Veterinary Physiology and Pharmacology, University of Glasgow Veterinary School, Bearsden Rd., Glasgow G61 1QH, UK. FAX: 141 330 5797; e-mail: [email protected] 1

Animals and Tissue Preparation Normal mice were bred at the University of Glasgow Veterinary School and maintained as required under United Kingdom Home Office regulations. The mice used were derived from F1 hybrids of C3H/HeH and 101/H strains. The day of birth was designated as Day 1, and animals were killed on Days 1, 5, 10, 15, 20, 25, 30, and 40, whereas adult animals were 90–180 days old. Testes were removed and either stored whole in liquid nitrogen, or interstitial tissue was prepared by mechanical separation from seminiferous tubules as previously described [6]. Interstitial tissue webs were stored frozen in liquid nitrogen until used for RNA extraction. Testis volume was determined as described previously [1].

Received: 10 July 2001. First decision: 31 August 2001. Accepted: 1 November 2001. Q 2002 by the Society for the Study of Reproduction, Inc. ISSN: 0006-3363. http://www.biolreprod.org

966

967

LEYDIG CELL DEVELOPMENT TABLE 1. Gene

GenBank

b-actin

X03672

Wbscr1

AF139987

18S

X00686

Luciferase* P450scc (P450 side chain cleavage)

AF195119

3b-HSD 1 (3b-hydroxysteroid dehydrogenase I)

NMp008293

3b-HSD VI (3b-hydroxysteroid dehydrogenase VI)

NMp013821

P450c17 (P450 17a-hydroxylase)

NMp007809

17b-HSD III (17b-hydroxysteroid dehydrogenase III)

U66827

5a-reductase I

ESTs‡

StAR (steroidogenic acute regulatory protein)

L36062

PGD-synthetase (prostaglandin D-synthetase)

AB006361

SUR2 (sulfonylurea receptor 2)

AF003531

EST (estrogen sulfotransferase)

S78182

RLF (relaxin-like factor)

NMp013564

GST 5-5 (glutathione S-transferase 5-5)

J04696

LH-R (luteinizing hormone-receptor)

M81310

EH (epoxide hydrolase)

NMp010145

VCAM1 (vascular cell adhesion molecule 1)

M84487

Ptc (patched)

NMp008957

TSP2 (thrombospondin 2)

NMp011581

3a-HSD (3a-hydroxysteroid dehydrogenase)

ESTs‡

Primer/ probe§

Sequence (59 → 39)

F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P F R P

GCTTCTTTGCAGCTCCTTCGT ATATCGTCATCCATGGCGAAC CCGGTCCACACCCGCCACC CTGCAATGTCCACACGAAGTG TCCCTGAAGGAGGCTCTGACT CCGGTCACCCAAGAGTGCACCG CCATTCGAACGTCTGCCCTAT GTCACCCGTGGTCACCATG AACTTTCGATGGTAGTCGCCGTGCC TCGAAGTATTCCGCGTACGTG GCCCTGGTTCCTGGAACAA TGTTCACCTCGATATGTGCATCTGTAAAAGCA CCAGTGTCCCCATGCTCAAC TGCATGGTCCTTCCAGGTCT TGCCTCCAGACTTCTTTCGACTCCTCAGA CTCAGTTCTTAGGCTTCAGCAATTAC CCAAAGGCAGGATATGATTTAGGA TTTCACTTAGAACTTAGTATTGCTTTTATTTCCCCCTTCA TTTTTTTGAGGTATTGACAAGTATTTATTG TCCCCATTCAGAGCATGTATAGC TCTTCCATTGGGTTTCATAAAGCAAGTAGAATTTTC GATCTAAGAAGCGCTCAGGCA GGGCACTGCATCACGATAAA AAACCGATCTGGCTGGTCCCATTCA GCCAACTCAAATGAATAGGCTTTC TGGGACAATGGGCAGTGAT CGATGCCATCGCCTGCTCCG GCGCTAGTCTACCTGGAGGGT GAAGAGCCCACCATCTGGAG TCCTGGCTTTCGTGGCCTTCGTG CCGGAGCAGAGTGGTGTCA CAGTGGATGAAGCACCATGC CAGAGCTGAACACGGCCCCACC GGGAATCCCAAGAGACCCAG GCTCTGAGCAAATGGCTGC AGGACCAAACCCATCCACAGCATGC GGTTGGTGCTGCGGTCA TCCGCCAGCTTCGTGG TGTGCTCCTTGCACCAATTCAGTACTTCA AAAGGGAATTATAGGAGACTGGAAGAA TGCTGCTTGTAGTGCTCATCAA CACTTCCCAGAAGCCCTGAGGGAGA CAGCAAGACCTGTTGGGTCTG ATTAAGGACGCACCGCCTG TCCCCACTGAAGGAGCACAGGGC GGAGGAATGTACTAGACCCGAGAA CCAAGGCAGCACACAGACAG CCCCGGCCTGGCCTGAGAGATTA GACCAAAAGCTGAGGCTGAGA CAATGTGGCCATCAGGGTAGA TGCCATCCCAATTATGCTCGGAGGA GGACATCCACTTCATCCACGT AGCAAGGGCTTTGGAGTGC AAACCTCCCCAGCTGCCCTCAGG GTTGGGAAGCCGGTCACA GGTCACCCTTGAACAGATCAATC TGTTTGGCTCCAGACATTTACCCAGTTTACA GCCTGGCAGAGGACTTACGT GGGAAGCACCTTTTGAGTGG AGGTGGTTCATCAAAGTGTCGCCCC GTCCGGACTCTATGGCATGAC TGTGAATCAGGTGCCACCTG CCAAAAACATTGGCTGGAAAGACTACACTGC GGAAAACTGTTGGCTGAAGCA CCAGTCCGGCATCTTTACACTT TGGCCTCCCATGTGTCACAGAGATCC

* Derived from sequence of mRNA provided by Promega (Madison, WI). † Reference to expression of gene within the Leydig cell. ‡ Based on ESTs (see Materials and Methods). § F, Forward primer; R, reverse primer; P, probe.

Reference†

[46] [21] [21] [47] [6] [33] [48] [7] [45] [25] [38] [5] [49] [44] [50] [27] [28] [34]

968

O’SHAUGHNESSY ET AL.

RNA Extraction and Reverse Transcription

RESULTS

Total RNA was extracted from interstitial webs using Trizol (Life Technologies, Paisley, U.K.) and residual genomic DNA was removed by DNase treatment (DNA-free, Ambion Inc., supplied by AMS Biotechnology, Abbingdon, U.K.). This is because the TaqMan primers were not specifically designed to produce an amplicon spanning an intron/exon boundary. Total RNA was extracted from whole testes as described for interstitial tissue webs with the exception that 5 ng of luciferase mRNA (Promega U.K., Southampton, U.K.) was added to each testis at the start of the RNA extraction to act as an external control. RNA from both types of tissue was reverse transcribed using random hexamers and Moloney murine leukemia virus reverse transcriptase (Superscript II, Life Technologies) as described previously [8, 9].

Internal PCR Control

Real-Time PCR Background. For quantification of specific mRNA content of tissues, a real-time PCR approach was used, which utilized the TaqMan PCR method. A review of real-time PCR methodology has recently been published [10]. Briefly, the TaqMan assay uses the 59-nuclease activity of the DNA polymerase to cleave a specific probe that hybridizes to the target amplicon during the annealing/extension phase of the PCR. Each probe contains a fluorescent dye reporter at the 59 end and a quencher dye at the 39 end, which will normally inhibit the reporter emission. Cleavage of the probe therefore separates the reporter and quencher dyes, resulting in increased fluorescent emission of the reporter, which is monitored by a suitable detector. The probe also provides an added degree of specificity to the assay. To measure cDNA levels the threshold cycle at which fluorescence is first detected above baseline is used, and a standard curve is drawn between starting RNA/cDNA concentrations and the threshold cycle. In studies reported here, mRNA levels are expressed relative to an internal control (see Results) and arbitrary standards were generated by serial dilutions of cDNA generated from adult testis interstitial tissue. Primers and probes. Primers and probes for use in the TaqMan method were designed using Primer Express (Applied Biosystems, Warrington, U.K.) and are listed in Table 1. For most mRNA species sequence information came from characterized mouse cDNAs submitted to GenBank. The exceptions were 5a-reductase 1 and 3a-HSD, for which no characterized mouse cDNAs were available. To obtain a sequence with which to design TaqMan primers/probes for mouse 5a-reductase 1 and 3a-HSD mouse, expressed sequence tags (ESTs) were identified through a basic local alignment search using rat 5a-reductase 1 (J05035) and 3a-HSD (D17310), and pile-ups were generated. The mouse ESTs used to generate the pile up were BE533699, BF165069, BE292197, AW114073, AW491466, and BF158810 for 5a-reductase 1; and AI225643, AI881993, AI987623, AI663368, and AI048883 for 3a-HSD. The LH receptor undergoes extensive alternate splicing [11, 12] and the localization of the TaqMan primers/probes will determine which isoform is detected. In this study the primer/probe combination was localized to exon 11, which contains the transmembrane and intracellular domains. The VCAM1 primary transcript also undergoes alternate splicing [13], and probes were designed that would amplify the full-length transcript only. Real-time PCRs were carried out in a 25 ml volume using a 96-well plate format. Components for real-time PCR were purchased from Oswel Ltd (Southampton, U.K.) apart from primers and probes, which came from MWG Biotech (Milton Keynes, U.K.). Each PCR well contained 13 reaction buffer (with passive reference), 5 mM MgCl2, 200 mM dNTPs, 300 nM each primer, 200 nM probe, and 0.02 U/ml enzyme (Hot GoldStar). Reactions were carried out and fluorescence was detected on a GeneAmp 5700 system (Applied Biosystems, Warrington, Cheshire, U.K.). For each sample, a replicate was run omitting the reverse transcription step, and a template-negative control was run for each primer/probe combination. For each 96-well plate, standard curves were included for each mRNA species being measured to ensure that amplification efficiencies were not significantly different.

Assay for Testosterone The testosterone content of testes was measured by radioimmunoassay after extraction with ethanol as described previously [14].

Statistical Analysis Results were analyzed by ANOVA followed by the Fisher test. Data for intratesticular testosterone levels showed heterogeneity of variance and were normalized by logarithmic transformation before analysis.

In humans, the KIAA0038 gene (GenBank accession number D26068; Unigene cluster Hs.180900) codes for a putative translation initiation factor and is ubiquitously expressed. This gene also appears to show the least variability of expression between tissues compared with other ubiquitous genes [15]. The mouse homologue of KIAA0038 is the Wbscr1 (Williams-Beuren syndrome chromosome region1) gene, and we used real-time PCR to compare expression of Wbscr1, b-actin, and 18S relative to an external control (luciferase). To characterize amplification of Wbscr1, b-actin, 18S, and luciferase cDNA, standard curves were prepared using serial dilutions of an arbitrary sample of cDNA, and the threshold cycle at which amplification was first detectable above background was plotted against the relative cDNA concentration (Fig. 1A). The slope of the curve is inversely proportional to the efficiency of the reaction with a slope of 21.4427 equivalent to 100% efficiency. To be able to compare Wbscr1, b-actin, and 18S directly to luciferase, it is necessary to show that the curves are not significantly nonparallel (i.e., that the amplification efficiencies are not significantly different) and this was tested using two-factor ANOVA. For probes used in this study the efficiencies of the PCR reactions were similar (97.5% to 98.9%) (Fig. 1A), and the interaction factor from ANOVA was not significant. The ratio of Wbscr1, b-actin, and 18S cDNA to luciferase cDNA was therefore calculated from the difference between the threshold cycle values (DCt). Expression of the three ubiquitous genes was determined relative to the external standard (luciferase) in whole testes from three different ages of mice (5 days, 20 days, and adult). These values were then corrected for testis volume (Fig. 1B). Results show that b-actin mRNA levels varied significantly during development of the testis. In contrast, there was no significant variation in Wbscr1 or 18S expression at the different ages, although variation between animals was high, particularly for 18S. Testosterone Levels During Development

Levels of intratesticular testosterone declined after birth to a nadir around Days 10–20. Thereafter, testosterone levels increased more than 16-fold between Days 25 and 30, and then showed a further doubling up to adulthood (Fig. 2). Expression of Leydig Cell mRNA Species in Isolated Testicular Interstitial Tissue

Expression levels of 18 different mRNA species were measured in isolated interstitial tissue from mice of different ages using Wbscr1 as an internal control. Results have been organized to group genes showing a similar developmental pattern of expression. Group 1 – P450 scc, P450c17, RLF, GST5-5, StAR, LH Receptor, and EH

In this group, levels of mRNA per testis were relatively low at birth but began to increase around Day 20, reaching a maximum in the adult animal (Fig. 3). Expression levels varied across the mRNA species in this group with levels of RLF, P450c17, and EH mRNA the highest of the 18 different mRNA species examined in this study. In contrast,

LEYDIG CELL DEVELOPMENT

969

FIG. 2. Intratesticular testosterone concentrations during development in the mouse. The mean 6 SEM for 4–20 animals in each group. Groups with different letter superscripts are significantly different. (P , 0.05).

[3, 4]. Expression levels of 17b-HSD III and PGD were high (at least in the adult), whereas levels of EST and VCAM1 were relatively low. Expression of VCAM1 was also highly variable between animals, with undetectable levels found in some animals up to Day 30. Group 3 – Ptc and TSP2

The expression levels of both members of this group were highest in neonatal interstitial tissue, and then declined between 10 and 25 days, and remained low throughout puberty and in the adult animal (Fig. 5). Group 4 – 5 a-Reductase 1 and 3a-HSD FIG. 1. Real-time PCR amplification of luciferase and ubiquitous genes in mouse testicular tissue. A) Standard curves prepared by serial dilutions of adult testis cDNA. The log of the relative template concentration was plotted against the threshold cycle (Ct) and regression analysis was used to generate the best-fit line. Results from duplicate amplifications of luciferase (m), 18S (l), Wbscr1 (m), and b-actin (.) cDNA are shown. Amplification efficiencies can be determined from the slope of the lines (see Results). B) Cumulative data showing 18S, Wbscr1, and b-actin mRNA levels relative to luciferase in whole testes from mice of different ages. Mean 6 SEM from three animals in each group is shown. Using ANOVA, there was no difference between ages in 18S or Wbscr1, but there was a significant difference between ages in b-actin levels. Note that the scale for 18S is 1000 times the scale of Wbscr1 and b-actin.

The expression pattern of these two mRNA species was characterized by a decrease in mRNA levels after birth, followed by an apparent peak of expression around 25 days, with low levels of mRNA in the adult (Fig. 6). This is particularly clear for 5a-reductase 1. Expression levels overall were low. Group 5 – 3 bHSD I and SUR2

In this group, expression levels of mRNA were low and there was little clear developmental pattern (Fig. 7). DISCUSSION

levels of LH receptor and StAR protein mRNA were significantly lower. Group 2 – 3 b-HSD VI, 17b-HSD III, VCAM1, EST, and PGD-Synthetase

The expression pattern of this group of genes was characterized by the absence or low levels of mRNA in the interstitial tissue up to 10 days, followed in most cases by detectable expression on Day 15, which increased to a maximum in the adult animal (Fig. 4). Both 17b-HSD III and PGD mRNA species were detectable in the interstitial tissue before Day 10, but in each case we have shown previously that this is due to contamination of the isolated interstitial tissue with cells from the seminiferous tubules

In most studies of mRNA expression, a housekeeping gene such as b-actin, GAPDH, or 18S is used as an internal standard to correct for differences in total mRNA levels between samples. In developmental studies of the testis problems arise because not only is there an overall change in the total mRNA content as the tissue grows, but there is also a dramatic change in the proportion of different cell types in the testis as spermatogenesis progresses. An internal standard can be useful only under these conditions if it is expressed equally in all cells at all stages of development, which is probably not the case for the commonly used standards [15, 16]. Recent analysis of SAGE data from human tissues by Velculescu et al. [15] have indicated that the human KIAA0038 gene is ubiquitously expressed and shows the least variability between tissues. In this study,

970


FIG. 3. Expression of RLF, P450c17, EH, GST5-5, P450scc StAR, and LH receptor mRNA levels during development in mouse testis interstitial tissue. The mean 6 SEM of three or four animals in each group is shown. Groups with different letter superscripts are significantly different (P , 0.05).

expression of Wbscr1, the mouse homologue of KIAA0038, did not show significant variation with age in the testis, indicating that it can be used as an internal control. Of the three standards tested in this study, b-actin would appear to be the least suitable due to significant variation in expression during development, whereas 18S expression had a high variability between animals. For many studies using whole tissues, the best solution would be to use an external control such as luciferase [7]. In this study, however, the

interstitial compartments of the testes were isolated from the seminiferous tubules, and this process will lead to variable loss of interstitial tissue between samples. Under these circumstances it is necessary to use an internal control. After birth, intratesticular testosterone levels declined from around Day 5 to reach a nadir between 10 and 20 days, before rising again around Day 25. This decline in testosterone mirrors the steroidogenic activity of the testes as measured using in vitro studies [17, 18], although the


971 FIG. 4. Expression of 17b-HSD III, PGDsynthetase, 3b-HSD VI, VCAM1, and EST mRNA levels during development in mouse testis interstitial tissue. The mean 6 SEM of three or four animals in each group is shown. Groups with different superscripts are significantly different (P , 0.05). There was no significant difference between groups expressing VCAM1 (i.e., older than 10 days).

maximum capacity in vitro (in response to LH) begins to increase earlier, before Day 25 [18], which indicates a lack of LH support in vivo during early puberty. The underlying cause of the decline in steroidogenesis after birth is not clear. In the mouse the testes are populated by fetal Leydig cells at the time of birth, and these cells become LH-dependent at this time [19]. It is unlikely that there is a significant drop in circulating LH between birth and 10 days, because pituitary levels of LH rise after birth [19] and circulating levels of LH reflect pituitary levels in the normal animal [20]. Whatever the underlying cause, the decline in androgen production after birth in the mouse testis coincides with the initial differentiation of the adult Leydig cell population, which starts around Day 10 [21, 22]. Adult Leydig cell number increases rapidly in the mouse after initial differentiation, and by Day 20 numbers are 16-fold higher than at Day 5, and about half the number in the adult testis [1, 23]. These newly formed Leydig cells appear to be steroidogenically inactive because androgen levels remain low until after Day 25, although this may be partly due to lack of LH support as described above. The developmental pattern of expression of the 18

mRNA species examined in this study can be divided broadly into 5 groups. The expression pattern of the first group (P450c17, P450scc, RLF, GST5-5, EH, StAR, and LH receptor) remains fairly stable after birth but shows a pubertal rise in expression, generally around Day 20, which precedes the increase in androgen levels. The developmental profile of mRNA levels indicates that these genes are all expressed in the fetal Leydig cells and the increase in expression around 20 days occurs after the initial differentiation of the adult Leydig cell population, which starts around Day 10. The early rise in adult Leydig cell number before puberty is reported by Hardy et al. [24] to be due largely to precursor differentiation rather than proliferation of preexisting Leydig cells. This would suggest that expression of this group of genes by the Leydig cell is regulated to occur some time after initial differentiation of the cells. It is noticeable that most of the genes known to be required for androgen synthesis fall within this group (cyp11a1 [encoding P450scc], cyp17 [encoding P450c17], StAR, and LH Receptor) and that their expression is therefore a prerequisite for Leydig cell function. The second group of mRNA species (EST, 17b-HSD III,

972


FIG. 5. Expression of Ptc and TRB2 mRNA levels during development in mouse testis interstitial tissue. The mean 6 SEM of three or four animals in each group is shown. Groups with different letter superscripts are significantly different (P , 0.05).

3bHSD VI, VCAM1, and PGD) contain those that are not expressed by the fetal Leydig cells and appear only in the adult Leydig cell population (this study and [6, 7, 21, 25]). Low levels of 17b-HSD III and PGD mRNA expression before Day 10 can be explained by tubular contamination of the interstitial compartments used in this study because these two genes are expressed in the tubules at this time [6, 7]. The two mRNA species in this group that encode steroidogenic enzymes (17b-HSD III and 3b-HSD VI) show changes in expression levels after Day 15, which resemble those seen in the first group described above. This means that the developmental expression pattern of each of the genes required for androgen synthesis is similar after adult Leydig cell differentiation. In contrast, expression of EST and PGD is delayed and starts to show a significant increase in the adult Leydig cell only at the end of puberty around Days 30–40. The expression pattern of mRNA species in group 3 (Ptc and TSP2) is what may be expected from genes expressed in the fetal Leydig cell population but not in the adult population. The fate of the fetal Leydig cell population after puberty has been a source of debate for a number of years [26], although recent studies on the Dhh-null mouse support the hypothesis that the cells remain in the testis but are eclipsed by development of the much greater adult population [3]. Thus, as the interstitial tissue develops and total cell numbers increase, the expression of fetal Leydig cell genes will decline relative to the internal control as is seen with both Ptc and TSP2. Nevertheless, it is now not clear whether Ptc is expressed in the fetal Leydig cell population. Earlier studies had indicated that Ptc was expressed in the fetal interstitial tissue and probably in the Leydig cells [27], but more recent work has suggested that Ptc is expressed in the peritubular cells with Leydig cell expression uncertain [3]. Measurement of TSP2 was included in this study because of an earlier report showing immunohistochemical expression in the adult Leydig cell [28]. The pattern of FIG. 6. Expression of 3a-HSD and 5a-reductase 1 mRNA levels during development in mouse testis interstitial tissue. The mean 6 SEM of three or four animals in each group is shown. Groups with different letter superscripts are significantly different (P , 0.05).

mRNA expression is much more clearly consistent, however, with a fetal Leydig cell origin for this matricellular protein. The mRNA species in group 4 (3a-HSD and 5a-reductase 1) both show an apparent peak of activity between 20 and 30 days as androgen levels in the testis are increasing to adult levels. The 5a-reductase enzyme is responsible for reduction of testosterone to dihydrotestostosterone (DHT), whereas 3a-HSD and 3b-HSD enzymes metabolize DHT further to 5a-androstane 3a (or 3b), 17b diol, which is a significantly less-potent androgen. It has been shown in several species including mice [29, 30] that there is a peak of 5a-reductase enzyme activity around puberty, which would correlate with changes in mRNA levels observed here. Similarly, in the rat a peak of 5a-reductase activity occurs around puberty [31, 32], which correlates with levels of type 1 mRNA [33]. It has been shown previously that the peak of 3a-HSD enzyme activity in rat Leydig cells is during the pubertal period [34], which would correlate with mRNA levels reported here. Developmental changes in the activity of these enzymes will serve to regulate testicular DHT levels [34]. The two mRNA species in group 5 (3b-HSD I and SUR 2) show fairly low levels of expression overall with little convincing change in expression during development. The 3b-HSD I enzyme is the only 3b-HSD isoform expressed in the testis during fetal development, and is therefore essential for androgen production during this critical period [19]. As the adult Leydig cell population develops after Day 10, levels of 3b-HSD VI mRNA increase to become the dominant species in the adult testis (this study and [21]). The sulphonylurea receptor SUR2 has been shown previously to be highly expressed within steroidogenic cells of the rat, including the Leydig cells [35]. In this study, SUR2 was clearly expressed in mouse interstitial tissue, although levels of expression were not particularly high and there was little developmental pattern to the expression.

973


FIG. 7. Expression of 3b-HSD I and SUR2 mRNA levels during development in mouse testis interstitial tissue. The mean 6 SEM of three or four animals in each group is shown. There was no significant difference between groups in either mRNA species shown in this figure.

The data on mRNA expression levels described here indicate that there are probably three functional stages during Leydig cell development: 1) an early stage, which must act to induce Leydig cell differentiation and will involve early genes not measured here, 2) a second stage that may begin shortly after initial differentiation but that requires 20–30 days for completion, and 3) a third stage, which is characterized by an increase in gene expression toward the end of puberty. The first stage will include those genes triggered by the initial stimulus to adult Leydig cell differentiation and which lead to morphological changes in the precursor cells. These morphological changes must occur early because one of the first signs of adult Leydig cell differentiation is the marked increase in morphologically identifiable Leydig cells between Days 10 and 20 [1]. This is before marked changes in expression of other genes such as those encoding the steroidogenic enzymes. The second stage of Leydig cell development includes all of the genes in group 1 along with 17b-HSD III and 3b-HSD VI from group 2. It is likely that this second stage of development begins shortly after initial Leydig cell differentiation because it has been shown that expression of 3b-HSD VI can first be detected in the adult Leydig cell population around the time that cell numbers begin to increase [1, 21], while RLF can be detected before a change in cell number is seen [22]. The third stage of development, which is characterized by genes for EST and PGD, probably also begins shortly after Leydig cell differentiation because expression is detectable at low levels on Day 15. Normal expression of these genes is delayed, however, until after puberty, when a marked increase in activity occurs as the animal develops into adulthood. This hypothesis is consistent with, and develops further, a previously described biphasic model of adult Leydig cell development [36, 37]. It is likely that the first stage in both models is the same but that the second stage can be subdivided by data presented here. Control of each of these developmental processes within the adult Leydig cell population is not known. It is likely that each of the stages is at least partly dependent upon the gonadotropins and, in particular, LH, although Ariyaratne et al. [2] have suggested that the initial stages of adult Leydig cell differentiation may be independent of LH. The identification of adult Leydig cell-specific genes enables us to test this hypothesis directly using appropriate mutant and transgenic animals. In interstitial tissue from the adult animal, the highest levels of mRNA were from genes encoding (in descending order) RLF, P450c17, EH, 17b-HSD III, PGD-synthetase, GST5-5, and P450scc. It has been reported previously that levels of RLF mRNA in the adult mouse Leydig cell are

very high [38, 39], although the function of this factor in the adult animal remains uncertain. The only known function of RLF in the male is in the fetal period when it is essential for normal testicular descent [40, 41]. High levels of expression of P450c17, 17b-HSD III, and P450scc in the Leydig cell are to be expected because these are key enzymes in the biosynthesis of testosterone. It is interesting, however, to compare the relative expression of these mRNA species, including both isoforms of 3b-HSD (which show relatively low levels of expression), with enzyme activity in the adult mouse testis reported previously [42]. Highest levels of enzyme activity in the normal testis are for 3b-HSD and 17-ketosteroid reductase (coded by the 17b-HSD III gene), which both show twice the activity of 17a-hydroxylase (coded by the cyp17 gene) and 250 times the activity of cholesterol side-chain cleavage (coded by the cyp11a1 gene). It is clear, therefore, that regulation of the activity of these enzymes in the Leydig cell is due to posttranscriptional events. It has been previously reported that testicular steroidogenic capacity correlates strongly with P450scc protein levels in different strains of mice [43], suggesting that control takes place at the level of protein synthesis or degradation. High levels of EH and GST5-5 protein in the testicular interstitial tissue have been reported previously [5, 44] and this study confirms that mRNA expression levels are also high. These enzymes protect cells by detoxifying electrophilic compounds and show high levels in other steroidogenic tissues [45], suggesting a specific role in the steroidogenic process and, perhaps, also in protecting the testis from xenobiotic attack. This study has examined the developmental expression pattern of 18 genes known to be expressed in the Leydig cell. Results suggest that three phases of adult Leydig cell differentiation occur with development of most known functions associated with the Leydig cells occurring during the second phase. In addition, from results reported here and from previous studies we can now identify five genes that are expressed in the adult Leydig cell population but not in the fetal population. We have also identified at least one candidate gene that may be expressed only in the fetal population. This information can be used to study mechanisms that regulate differentiation and development of the adult Leydig cell population. ACKNOWLEDGMENT We are grateful for technical assistance from Gary Jackson.

REFERENCES 1. Baker PJ, O’Shaughnessy PJ. Role of gonadotrophins in regulating numbers of Leydig cells and Sertoli cells during fetal and postnatal development in mice. Reproduction 2001; 122:227–234.

974


2. Ariyaratne HB, Mendis-Handagama SM, Hales DB, Mason JI. Studies of the onset of Leydig precursor cell differentiation in the prepubertal rat testis. Biol Reprod 2000; 63:165–171. 3. Clark AM, Garland KK, Russell LD. Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biol Reprod 2000; 63:1825–1838. 4. Gnessi L, Basciani S, Mariani S, Arizzi M, Spera G, Wang C, Bondjers C, Karlsson L, Betsholtz C. Leydig cell loss and spermatogenic arrest in platelet-derived growth factor (PDGF)-A-deficient mice. J Cell Biol 2000; 149:1019–1026. 5. Papp S, Robaire B, Hermo L. Immunocytochemical localization of the Ya, Yc, Yb1, and Yb2 subunits of glutathione S-transferases in the testis and epididymis of adult rats. Microsc Res Tech 1995; 30:1– 23. 6. O’Shaughnessy PJ, Baker PJ, Heikkila M, Vainio S, McMahon AP. Localization of 17b-hydroxysteroid dehydrogenase/17-ketosteroid reductase isoform expression in the developing mouse testis—androstenedione is the major androgen secreted by fetal/neonatal Leydig cells. Endocrinology 2000; 141:2631–2637. 7. Baker PJ, O’Shaughnessy PJ. Expression of prostaglandin D synthetase during development in the mouse testis. Reproduction 2001; 122: 553–559. 8. O’Shaughnessy PJ, Murphy L. Cytochrome P-450 17a-hydroxylase protein and mRNA in the testis of the testicular feminized (Tfm) mouse. J Mol Endocrinol 1993; 11:77–82. 9. O’Shaughnessy PJ, Marsh P, Dudley K. Follicle-stimulating hormone receptor mRNA in the mouse ovary during post-natal development in the normal mouse and in the adult hypogonadal (hpg) mouse: structure of alternate transcripts. Mol Cell Endocrinol 1994; 101:197–201. 10. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000; 25:169–193. 11. Koo YB, Ji IH, Ji TH. Characterization of different sizes of rat luteinizing hormone/chorionic gonadotropin receptor messenger ribonucleic acids. Endocrinology 1994; 134:19–26. 12. O’Shaughnessy PJ, McLelland D, McBride MW. Regulation of luteinizing hormone-receptor and follicle-stimulating hormone receptor messenger ribonucleic acid levels during development in the neonatal mouse ovary. Biol Reprod 1997; 57:602–608. 13. Kumar AG, Dai XY, Kozak CA, Mims MP, Gotto AM, Ballantyne CM. Murine VCAM-1. Molecular cloning, mapping, and analysis of a truncated form. J Immunol 1994; 153:4088–4098. 14. O’Shaughnessy PJ, Sheffield JW. Effect of testosterone on testicular steroidogenesis in the hypogonadal (hpg) mouse. J Steroid Biochem 1990; 35:729–734. 15. Velculescu VE, Madden SL, Zhang L, Lash AE, Yu J, Rago C, Lal A, Wang CJ, Beaudry GA, Ciriello KM, Cook BP, Dufault MR, Ferguson AT, Gao Y, He TC, Hermeking H, Hiraldo SK, Hwang PM, Lopez MA, Luderer HF, Mathews B, Petroziello JM, Polyak K, Zawel L, Kinzler KW. Analysis of human transcriptomes. Nat Genet 1999; 23:387–388. 16. Medhurst AD, Harrison DC, Read SJ, Campbell CA, Robbins MJ, Pangalos MN. The use of TaqMan RT-PCR assays for semiquantitative analysis of gene expression in CNS tissues and disease models. J Neurosci Methods 2000; 98:9–20. 17. Anakwe OO, Moger WH. Ontogeny of rodent testicular androgen production in response to isoproterenol and luteinizing hormone in vitro. Biol Reprod 1984; 30:1142–1152. 18. O’Shaughnessy PJ, Sheffield JW. Effect of temperature and the role of testicular descent on postnatal testicular androgen production in the mouse. J Reprod Fertil 1991; 91:357–364. 19. O’Shaughnessy PJ, Baker P, Sohnius U, Haavisto A-M, Charlton HM, Huhtaniemi I. Fetal development of Leydig cell activity in the mouse is independent of pituitary gonadotroph function. Endocrinology 1998; 139:1141–1146. 20. El Gehani F, Zhang FP, Pakarinen P, Rannikko A, Huhtaniemi I. Gonadotropin-independent regulation of steroidogenesis in the fetal rat testis. Biol Reprod 1998; 58:116–123. 21. Baker PJ, Sha JA, McBride MW, Peng L, Payne AH, O’Shaughnessy PJ. Expression of 3b-hydroxysteriod dehydrogenase type I and VI isoforms in the mouse testis during development. Eur J Biochem 1999; 260:911–916. 22. Nef S, Shipman T, Parada LF. A molecular basis for estrogen-induced cryptorchidism. Dev Biol 2000; 224:354–361. 23. Vergouwen RPFA, Huiskamp R, Bas RJ, Roepers-Gajadien HL, Da-

24. 25. 26. 27. 28. 29. 30. 31. 32. 33.

34.

35.

36.

37.

38.

39.

40. 41.

42.

43.

44.

45.

46.

47.

vids JAG, de Rooij DG. Postnatal development of testicular populations in mice. J Reprod Fertil 1993; 99:479–485. Hardy MP, Zirkin BR, Ewing LL. Kinetic studies on the development of the adult population of Leydig cells in testes of the pubertal rat. Endocrinology 1989; 124:762–770. Song WC, Qian Y, Sun X, Negishi M. Cellular localization and regulation of expression of testicular estrogen sulfotransferase. Endocrinology 1997; 138:5006–5012. Kerr JB, Knell CM. The fate of fetal Leydig-cells during the development of the fetal and postnatal rat testis. Development 1988; 103: 535–544. Bitgood MJ, Shen L, McMahon AP. Sertoli cell signaling by Desert hedgehog regulates the male germline. Curr Biol 1996; 6:298–304. Kyriakides TR, Zhu YH, Yang Z, Bornstein P. The distribution of the matricellular protein thrombospondin 2 in tissues of embryonic and adult mice. J Histochem Cytochem 1998; 46:1007–1015. Sheffield JW, O’Shaughnessy PJ. Testicular steroid metabolism during development in the normal and hypogonadal mouse. J Endocrinol 1988; 119:257–264. Chase DJ, Payne AH. Changes in Leydig cell function during sexual maturation in the mouse. Biol Reprod 1983; 29:1194–1200. Ficher M, Steinberger E. In vitro progesterone metabolism by rat testicular tissue at different stages of development. Acta Endocrinol 1971; 68:285–292. Chase DJ, Payne AH. Changes in distribution and androgen production of Leydig cells of two populations during sexual maturation in the rat. Endocrinology 1983; 112:29–34. Viger RS, Robaire B. Steady state steroid 5a-reductase messenger ribonucleic acid levels and immunocytochemical localization of the type 1 protein in the rat testis during postnatal development. Endocrinology 1995; 136:5409–5415. Ge RS, Hardy DO, Catterall JF, Hardy MP. Opposing changes in 3ahydroxysteroid dehydrogenase oxidative and reductive activities in rat leydig cells during pubertal development. Biol Reprod 1999; 60:855– 860. Yanase H, Mowa CN, Inagaki N, Seino S, Iwanaga T. Cellular distribution of sulfonylurea receptor 2 mRNA in the ovary and testis of rats. Biomed Res Tokyo 1998; 19:199–204. Teerds KJ. Regeneration of Leydig cells after depletion by EDS: a model for postnatal Leydig cell renewal. In: Payne AH, Hardy MP, Russell LD (eds.), The Leydig Cell. Vienna, IL: Cache River Press; 1996: 203–220. Habert R, Lejeune H, Saez JM. Origin, differentiation and regulation of fetal and adult Leydig cells. Mol Cell Endocrinol 2001; 179:47– 74. Pusch W, Balvers M, Ivell R. Molecular cloning and expression of the relaxin-like factor from the mouse testis. Endocrinology 1996; 137:3009–3013. Zimmermann S, Steding G, Emmen J, Brinkmann A, Nayernia K, Holstein AF, Engel W, Adham IM. Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol 1999; 13:681– 691. Nef S, Parada LF. Cryptorchidism in mice mutant for Insl3. Nat Genet 1999; 22:295–299. Zimmermann S, Schoettler P, Engel W, Adham IM. Mouse Leydig insulin-like (Ley I-L) gene: structure and expression during testis and ovary development. Mol Reprod Dev 1997; 47:30–38. Nolan CJ, Payne AH. Genotype at the P450scc locus determines differences in the amount of P450scc protein and maximal testosterone production in mouse Leydig cells. Mol Endocrinol 1990; 4:1459– 1464. O’Shaughnessy PJ. Steroidogenic enzyme-activity in the hypogonadal (hpg) mouse testis and effect of treatment with luteinizing-hormone. J Steroid Biochem Mol Biol 1991; 39:921–928. Ishii-Ohba H, Guengerich FP, Baron J. Localization of epoxide-metabolizing enzymes in rat testis. Biochim Biophys Acta 1984; 802: 326–334. Rabahi F, Brule S, Sirois J, Beckers JF, Silversides DW, Lussier JG. High expression of bovine alpha glutathione S-transferase (GSTA1, GSTA2) subunits is mainly associated with steroidogenically active cells and regulated by gonadotropins in bovine ovarian follicles. Endocrinology 1999; 140:3507–3517. Ikeda Y, Shen WH, Ingraham HA, Parker KL. Developmental expression of mouse steroidogenic factor-1, an essential regulator of the steroid hydroxylases. Mol Endocrinol 1994; 8:654–662. Le Goascogne C, Sananes N, Gouezou M, Takemori S, Kominami S,

LEYDIG CELL DEVELOPMENT Baulieu EE, Robel P. Immunoreactive cytochrome-p-450 17-alpha in rat and guinea-pig gonads, adrenal-glands and brain. J Reprod Fertil 1991; 93:609–622. 48. Stocco DM, Clark BJ. Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 1996; 17:221–244. 49. Huhtaniemi I. Ontogeny of the luteinizing hormone action in the male.

975

In: Payne AH, Hardy MP, Russell LD (eds.), The Leydig Cell. Vienna, IL: Cache River Press; 1996: 365–382. 50. Sainio-Pollanen S, Sundstrom J, Erkkila S, Hanninen A, Vainiopaa M, Martikainen M, Salminen E, Verajankorva E, Antola H, Nikula H, Simell O, Pollanen P. CD106 (VCAM-1) in testicular immunoregulation. J Reprod Immunol 1997; 33:221–238.