MICROBIAL DRUG RESISTANCE Volume 20, Number 1, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/mdr.2013.0085
Characterization of Carbapenem Nonsusceptible Pseudomonas aeruginosa in Denmark: A Nationwide, Prospective Study Frank Hansen,1 Helle Krogh Johansen,2 Claus Østergaard,3 Magnus Arpi,4 Dennis Schrøder Hansen,5 Pia Littauer,6 Anette Holm,7 Ole Heltberg,8 Helga Schumacher,9 Kurt Fuursted,10 Mari-Ann Domar Lykke,11 Birgitte Tønning,12 Anette M. Hammerum,1 and Ulrik Stenz Justesen13
From January 1st 2011 through June 30th 2011, 116 nonreplicate, noncystic fibrosis-related Pseudomonas aeruginosa isolates with reduced carbapenem susceptibility were collected from 12 out of 13 Danish departments of clinical microbiology. The presence of acquired b-lactamases was assessed with combination tablet-diffusion methodology and polymerase chain reaction. In addition, antimicrobial susceptibility testing, an efflux pump inhibitor assay, and pulsed-field gel electrophoresis (PFGE) were performed. Isolates producing acquired blactamases were further investigated by serotyping and multi locus sequence typing. Eight isolates produced the metallo-b-lactamase (MBL) VIM-2, and one isolate produced OXA-10 and VEB-1-like extended-spectrum betalactamase (ESBL). Phenotypic indications of derepressed AmpC and efflux pump were seen in 56 and 43 isolates, respectively. Overall, the results indicate that mutational factors related to permeability—often combined with derepressed, chromosomal AmpC—is the main factor behind carbapenem nonsusceptibility in Danish P. aeruginosa isolates. The ESBL producer and all the VIM producers belonged to international clones. PFGE revealed that most of the isolates were unrelated, but clonal spread was seen; the 116 isolates distributed in 97 PFGE types, with the largest cluster consisting of 4 isolates (including three isolates from the same hospital with 100% similarity). Thirty-two isolates were pair-wise related, while the remaining isolates were clonally unrelated, as were all nine ESBL/MBL producers. This opportunistic pathogen’s armament of carbapenem resistance mechanisms has, in most studies, been primarily shown to arise from chromosomal mutations, leading to reduced permeability of antimicrobial agents.18 Loss or alteration of the outer membrane porin channel oprD affects the ability of carbapenems to reach their target penicillin-binding proteins in the cell membrane, as oprD is the preferred pathway through the outer membrane of P. aeruginosa for this drug class. Loss of oprD in itself increases imipenem (IMI) minimum inhibitory concentrations (MICs) into the intermediate or
Introduction
I
n the task of combating infections caused by resistant Pseudomonas aeruginosa, especially in the intensive care units, carbapenems represent one of the most important groups of antibiotics available for appropriate treatment. It is, therefore of concern, when carbapenem resistance occurs, as this phenomenon leaves the clinicians a difficult therapeutic challenge. For the critically ill patients, morbidity and mortality are affected.17,35
1
Statens Serum Institut, Copenhagen, Denmark. Department of Clinical Microbiology, Rigshospitalet, Copenhagen, Denmark. 3 Department of Clinical Microbiology, Aalborg Sygehus, Aalborg, Denmark. 4 Department of Clinical Microbiology, Herlev Hospital, Herlev, Denmark. 5 Department of Clinical Microbiology, Hillerød Sygehus, Hillerød, Denmark. 6 Department of Clinical Microbiology, Hvidovre Hospital, Hvidovre, Denmark. 7 Department of Clinical Microbiology, Vejle Hospital, Vejle, Denmark. 8 Department of Clinical Microbiology, Slagelse Sygehus, Slagelse, Denmark. 9 Department of Clinical Microbiology, Regionshospitalet Herning, Herning, Denmark. 10 Department of Clinical Microbiology, Aarhus University Hospital, Aarhus, Denmark. 11 Department of Clinical Microbiology, Sydvestjysk Sygehus Esbjerg, Esbjerg, Denmark. 12 Department of Clinical Microbiology, Regionshospitalet Viborg, Viborg, Denmark. 13 Department of Clinical Microbiology, Odense University Hospital, Odense, Denmark. 2
22
DANISH CARBAPENEM NONSUSCEPTIBLE P. AERUGINOSA resistance category, while resistance toward meropenem (MEM) and doripenem requires additional mechanisms.27 Several efflux pump systems involved in antimicrobial resistance have been described for P. aeruginosa, and especially the mexAB-oprM-, mexCD-oprJ- and mexXY-tripartite efflux pump systems belonging to the resistance-nodulation-division family target and extrude carbapenems (except IMI which is not a efflux pump substrate due to the lack of a hydrophobic side chain as found in MEM at position 239). In addition to these mechanisms, coincident up-regulated expression/derepression of chromosomal AmpC b-lactamases often acts to enhance the level of carbapenem resistance.27 Lastly, acquisition of transferable DNA elements, such as plasmids encoding carbapenemases, can trigger the potentially highest grade of carbapenem resistance. The genetic environment of these plasmids often comprises genes, encoding resistance to other families of antibiotics, extending the spectra of resistance.20 Several European studies during the last decade2,3,22,28,36–38 set the target to clarify the different aspects—for example, epidemiology, mechanisms of resistance, and clinical impact—of the carbapenem resistance situation in their countries/regions, but not in Denmark. Data from the European Antimicrobial Resistance Surveillance Network (EARS-Net) demonstrated low levels, 1% to < 5%, of reduced susceptibility or resistance in invasive P. aeruginosa isolates from Denmark in 2009 and 2010 compared with other European countries. (http://ecdc.europa.eu/en/activities/surveillance/EARS-Net/database/Pages/database.aspx). However, P. aeruginosa isolates harboring metallo-b-lactamases (MBLs) were beginning to emerge and Danish departments of clinical microbiology were reporting increasing numbers of isolates with reduced susceptibility or resistance to the carbapenems. We, therefore, initiated a prospective study in Denmark to elucidate the epidemiology and mechanisms of carbapenem resistance in P. aeruginosa. Materials and Methods Strain collection Twelve out of 13 Danish departments of clinical microbiology (serving 95% of the population) participated in the study. Participants forwarded all isolated P. aeruginosa, intermediate or resistant (nonsusceptible), as defined by the European Committee on Antimicrobial Susceptibility Testing (EUCAST), to doripenem (MIC > 1 mg/ml), IMI (MIC > 4 mg/ml, or MEM (MIC > 2 mg/ml), to Statens Serum Institut (Copenhagen, Denmark) for further investigations. The participating departments of clinical microbiology had different routines for antimicrobial susceptibility testing and for some sample categories, P. aeruginosa were not tested for carbapenem susceptibility. Therefore, P. aeruginosa from these sample categories were not a part of the study, and for this reason it was not possible to perform an actual prevalence study of carbapenem nonsusceptible P. aeruginosa isolates. Isolates from the respiratory tract in patients with cystic fibrosis or environmental samples were excluded. The collection period was 6 months, from January 1st 2011 through June 30th 2011, and resulted in a strain collection of 116, nonreplicate, consecutive carbapenem nonsusceptible P. aeruginosa. The majority of the isolates were from the lower respiratory tract (39%) and the urinary tract (39%), with the remaining isolates being from
23 Table 1. ROSCO Neosensitabs Used for b-Lactamase Detection Detection of
ESBL CAZ/CLA (30/10 mg) FEP/CLA (30/10 mg)
AmpC/KPC
MBL
CAZ/CLOX (30/750 mg)
MEM/DPA (10/1,000 mg) IMI/EDTA (10/750 mg)
CAZ/APBA (30/600 mg) MEM/CLOX (10/750 mg) MEM/APBA (10/600 mg)
CLA, clavulanic acid; CLOX, cloxacillin; APBA, amino-phenylboronic acid; DPA, dipicolinic acid; MBL, metallo-b-lactamase; CAZ, ceftazidime; FEP, cefepime; MEM, meropenem; IMI, imipenem; ESBL, extended-spectrum beta-lactamase.
wounds/skin (10%), the bloodstream (5%), and the gastrointestinal tract (2%). Phenotypic screening for acquired b-lactamases The presence of acquired b-lactamases was assessed using a combination tablet assay with Neosensitabs (ROSCO, Taastrup, Denmark), determining the zone of inhibition (ZOI) differences between ceftazidime (CAZ) 30 mg, cefepime (FEP) 30 mg, MEM 10 mg, IMI 10 mg, and b-lactamase-specific inhibitors as listed in Table 1. The combination tablet assay was performed using EUCAST Disk Diffusion Test Methodology15; also, ZOI for doripenem was determined. A positive result in any of these tests (ZOI difference of ‡ 5, ‡ 7 mm for IMI/EDTA-IMI), between b-lactam and blactamase inhibitor, qualified the isolate for further genotypic investigation. In addition, a general resistance profile against noncarbapenem, anti-pseudomonal antibiotics was established with EUCAST Disk Diffusion Test Methodology. Tested agents included piperacillin/tazobactam, ticarcillin/ clavulanic acid, CAZ, FEP, aztreonam, ciprofloxacin, gentamicin, amikacin, and tobramycin. For fosfomycin and colistin, agar dilution and microbroth dilution were performed, respectively, according to Clinical and Laboratory Standards Institute (CLSI) guidelines.4 Efflux pump inhibition assay The occurrence of increased efflux pump activity was assessed using a microbroth dilution assay following general CLSI guidelines for microbroth dilution,4 targeting the MIC of MEM – 40 mg phenyl-arginin-b-naphtylamide (PAbN)/ ml.18 Since results from a phenotypic carbapenem-PAbN synergy method such as this may not always correlate unambiguously to transcriptional gene expression analysis with quantitative reverse transcription (RT)-polymerase chain reaction (PCR) methods, the results obtained here should be considered indicative rather than definitive. Genotypic testing of acquired b-lactamases in referred isolates All isolates with positive, phenotypic screening results were tested with PCR for the presence of acquired b-lactamases blaPER, blaVEB, blaGES, blaBEL, blaOXA-2 gr., blaOXA-10 gr.,
30 14 26 40 34 0 0 0 0 0 50 43 23 82 60 10 0 0 10 8 10 29 13 24 16 10 0 0 18 11 50 29 0 43 29 40 29 0 43 34 10 29 0 50 30 70 100 10 88 66 40 29 6 62 44
Colistin Ciprofloxacin Gentamicin Amikacin Tobramycin Aztreonam FEP
Established using the EUCAST Clinical Breakpoint Table v. 2.0. a Percentage of isolates with MIC values above the EUCAST epidemiological wild type cut-off MIC of 128 mg/ml. b At least one of the two drugs being I. I, intermediate resistant; S, susceptible; R, resistant.
Table 2 shows the rates of in vitro nonsusceptibility against noncarbapenem anti-pseudomonal agents. With a basis in the MEM-IMI S-I-R grouping of the study isolates used by Giske and colleagues,18 co-resistance could be summarized as follows. All isolates (n = 10), with intermediate resistance to MEM and/or IMI, were susceptible to doripenem and CAZ (except for one isolate). Nonsusceptibility was seen for FEP (n = 4), ciprofloxacin (n = 5), and ticarcillin/clavulanic acid (n = 7) in this group. Isolates resistant to MEM and susceptible/intermediate to IMI (n = 7) were resistant to ticarcillin/clavulanic acid but
MEM I/S and/or IMI I/Sb (10) MEM I/R and IMI S (7) MEM I/S and IMI R (31) MEM R and IMI R (68) Total (116)
Co-resistance
CAZ
On the basis of the primary b-lactamase screening with the combination tablet assay, 51 MBL- and 31 extendedspectrum beta-lactamase (ESBL)-screening positive isolates were demonstrated. The isolates were processed further with PCR assays, which revealed the presence of eight VIM positive isolates and one VEB/OXA-10 group positive isolate. Sequencing analysis specified the VIM diagnosis to VIM-2 for all eight isolates, and the ESBLs were determined to be VEB-1 and OXA-10. Deduced from cloxacillin (CLOX) and/or amino-phenylboronic acid (APBA) synergy with either CAZ or MEM, derepressed, chromosomal AmpC activity, was identified in 56 isolates. Increased efflux pump activity was phenotypically apparent in 43 isolates (18 isolates displaying a two-fold MIC reduction in the presence of the efflux pump inhibition, and 25 isolates with MIC reductions ‡ 3-fold).
Ticarcillin/ clavulanic acid
Results
Piperacillin/ tazobactam
The clonal correlations of all 116 isolates were investigated with pulsed-field gel electrophoresis (PFGE), using Spe I as restriction enzyme as previously described.21 PFGE band patterns were evaluated using Gel Doc XR (Bio-Rad Laboratories, Marnes la Coquette, France). The acquired b-lactamase-positive isolates were further characterized with multi-locus sequence typing (MLST) as described by Curran et al.,6 and serotyping, using monoclonal antibodies (Bio-Rad) according to the manufacturer’s instructions.
MEM/IMI SIR-group (n)
Molecular typing
Table 2. Rates of In Vitro Nonsusceptibility (%) Against Noncarbapenem Antipseudomonal Agents in 116 Danish Carbapenem Nonsusceptible Pseudomonas aeruginosa Isolates
blaKPC, blaIMP, blaSPM, blaVIM, blaGIM, blaSIM, and blaNDM. PCR was performed using Qiagen Multiplex PCR kit (Qiagen, Hilden, Germany) using primers and conditions previously described 1,7,12,19 with blaNDM-specific primers (forward 5¢ GAAGCTGAGCACCGCATTAG 3¢ and reverse 5¢ TGCGGGCCGTATGAGTGATT 3¢) added to the multiplex PCR assay described by Ellington et al.12 DNA from b-lactamase positive PCR products was purified using NucleoFast 96 PCR plates (Macherey-Nagel, Du¨ren, Germany) and forwarded to Macrogen (Seoul, Korea) for sequencing. After completion, the raw sequence data were analyzed with CLC DNA Workbench 6.1 software (Aarhus, Denmark). Finally, assembled DNA sequences were entered in the NCBI BLAST database (available from www.ncbi.nlm.nih.gov/BLAST/ Blast.cgi?CMD = Web&PAGE_TYPE = BlastHome) in search of homologue entries.
HANSEN ET AL. Fosfomycina
24
DANISH CARBAPENEM NONSUSCEPTIBLE P. AERUGINOSA susceptible to aminoglycosides. Three isolates were ciprofloxacin resistant. In the IMI resistant/MEM intermediate/susceptible isolates (n = 31; assumed to be related, mainly due to porin alterations), other drug classes were relatively sparingly affected, with resistance rates of 6%, 10%, and 19% toward ticarcillin/clavulanic acid, piperacillin/tazobactam, and ciprofloxacin, respectively. The isolates in this group were susceptible to CAZ, FEP and aminoglycosides. The group of isolates with resistance to both IMI and MEM (n = 68; VIM and VEB/OXA producers included) comprised 31 efflux pump inhibition assay-positive isolates. Ciprofloxacin nonsusceptibility was seen in 25 (81%) of these 31 isolates. In total, 56/68 (82%) isolates were ciprofloxacin nonsusceptible in this group. Apart from the nine isolates with acquired b-lactamases, aminoglycosides retained in vitro activity in most isolates. Nonsusceptibility rates for gentamicin, tobramycin, and amikacin were 7%, 5%, and 12%, respectively. Of the eight VIM-2 producers, one and two isolates were resistant to aztreonam and gentamicin, respectively. In addition, seven isolates had fosfomycin MICs above the EUCAST epidemiological wild-type cut-off MIC of 128 mg/ml. No isolates were resistant to colistin. Molecular typing of the eight VIM producers (summarized in Table 3) revealed a dominance of serotype O12/ multi locus sequence type ST111 (part of CC111), with six out of eight (75%) isolates matching this profile. The remaining two VIM producers were serotype O6, but belonged to different MLSTs, ST233, and ST654, respectively. Serotype O12 was also seen in the VEB-1/OXA-10 producer that belonged to ST244. A total of 97 PFGE types were determined (using a cut-off value of ‡ 80% similarity), of which the largest cluster consisted of four isolates. Thirty-two isolates were pair-wise related, while the remaining isolates were clonally unrelated, as were all nine isolates with acquired b-lactamases. A dendrogram with the PFGE results are presented in Figure 1. Discussion This study was not designed as an incidence or prevalence study, as not all isolates were screened for carbapenem susceptibility at the participating departments of clinical microbiology. The study clearly demonstrates that carbapenem nonsusceptible P. aeruginosa is present in Denmark in isolates of
25
different origin. Even though carbapenem resistance in P. aeruginosa from bloodstream infections has not increased significantly from year to year in the period 2007–2011, an increasing trend can be observed for the period 2007–2011 in Denmark.8,9,11,14 The ability of MBL-producing P. aeruginosa to reach highlevel endemicity in certain settings has, indeed, been established,5 and in these cases, MBLs can outpace loss of oprD and up-regulated efflux pumps as leading factors causing reduced carbapenem susceptibility; distinct clones even unfolding their potential for causing outbreaks.25,40 However, considering the overall results, it can be concluded that mutation-related, rather than enzymatic, mechanisms drive carbapenem nonsusceptibility in the isolates from our study. Phenotypic CAZ- or FEP synergy with clavulanic acid were seen in 31 isolates, but only VEB-1 and OXA-10 in one isolate could be genotypically confirmed. Presence of PSE/ CARB enzymes (which is also inhibited with clavulanic acid)—not searched for in this study—could be a possible explaining factor for this high number of apparently false ESBL positives. Some GES variants may not be efficiently inhibited by clavulanic acid,10 for which reason selected, clavulanic acid noninteractive isolates were also tested for GES, but no positives were found. Besides the VEB-1/OXA10 producer, only one other isolate was positive with both CAZ – CLAV and FEP – CLAV. Early detection of MBLs in order to prevent spread is important,41 but it has been shown that MBL inhibitors alone can have a permeabilizing effect on the outer membrane of P. aeruginosa, which can lead to specificity problems with the combination tablet-testing approach.31 False-positive MBL tests were detected in 60 isolates (six isolates false positive with MEM/DPA-MEM only, 25 isolates false positive with IMI/ EDTA-IMI only, and 29 isolates false positive with both tests). Using CAZ resistance as an adjacent predictor of MBL activity, specificity was improved, but still left 18 isolates as false positives; further inclusion of piperacillin/tazobactam resistance as a predictor decreased the number of false MBL positives to 4. Despite the wider availability of advanced technology for carbapenemase detection (e.g., mass spectrometry or DNA microarray based assays), reliable phenotypic tools for detection of this resistance mechanism in P. aeruginosa are still much needed in most laboratories. Some recent publications have addressed this unsolved issue; after the completion of the laboratory part of this study, Pasteran et al. proposed a new approach to the Modified Hodge Test, substituting
Table 3. Overview of Molecular Typing Results for the Isolates with Acquired b-Lactamases Sample ID Psa-43 Psa-49 Psa-53 Psa-60 Psa-72 Psa-89 Psa-116 Psa-122 Psa-50
DCM
Specimen
Hospitalized abroad
Acquired b-lactamase
Serotype
MLST
Hvidovre Herlev Viborg Slagelse Skejby Rigshosp Skejby Skejby OUH
Urine (catheter) Urine (catheter) Tracheal secret Urine (catheter) Expectorated sputum Urine Expectorated sputum Urine Tracheal secret
No No No No No No No Yes; Thailand No
VIM-2 VIM-2 VIM-2 VIM-2 VIM-2 VIM-2 VIM-2 VIM-2 VEB-1-like/OXA-10
O12 O12 O12 O6 O12 O12 O12 O6 O12
ST111 ST111 ST111 ST233 ST111 ST111 ST111 ST654 ST244
Clonal cluster
PFGE type
CC111 CC111 CC111 CC233 CC111 CC111 CC111
17 18 50 95 10 49 2 31 6
CC244
PFGE, pulsed-field gel electrophoresis; MLST, multi-locus sequence typing; DCM, Department of Clinical Microbiology.
FIG. 1. Pulsed-field gel electrophoresis dendrogram illustrating the clonal relatedness of the study isolates (% homology). DCM, Department of Clinical Microbiology.
26
DANISH CARBAPENEM NONSUSCEPTIBLE P. AERUGINOSA Escherichia coli ATCC 25922 with the SHV-18 producing Klebsiella pneumonia ATCC 700603 as indicator strain.34 According to the author, this raised sensitivity and specificity to 100% and 97%, respectively. A tablet combination containing IMI/DPA is now commercially available; initial studies (unpublished observations) seem to prove this combination superior to the ones used for this study, yet still performing with sub-optimal positive predictive value. Based on the definitions proposed by ECDC,29 62 (53%) of the isolates could be categorized as multidrug resistant; whereas 17 isolates (15%) could be regarded as extensively drug resistant, although all isolates were susceptible to colistin. Susceptibility to aminoglycosides was also high. However, colistin (due to lack of optimal dosage guidance for treatment of critically ill patients and considerations of nephrotoxicity) is usually considered inferior to other antipseudomonal drugs30 and aminoglycosides are often not appropriate as monotherapy and these multidrug-resistant and extensively drug resistant P. aeruginosa isolates still remain a difficult therapeutic challenge. There were no common combinations of resistance to the noncarbapenem anti-pseudomonal agents, as the 116 isolates displayed a mosaic of resistance to the different agents. It should also be noted that the lately marketed (and in Denmark negligible administered) doripenem appeared to be less affected by the resistance mechanisms present in the study isolates than both IMI and MEM, with nonsusceptibility rates of 69%, 99%, and 98%, respectively (excluding the eight MBL producers). This seems to be in accordance with the observations and conclusions from the ‘‘Spanish Comparative Activity of Carbapenem Testing’’ (COMPACT) surveillance study36 (with a study design comparable to our), in which the authors conclude that their results ‘‘support further the potential advantage of doripenem, compared with the other available carbapenems.’’ Similar conclusions have been inferred from studies from Italy,16 Turkey,26 and the Asia-Pacific regional COMPACT II program.23 PFGE revealed a relatively nonclonal nature of the relatedness of the carbapenem nonsusceptible P. aeruginosa isolates, but clonal clusters could be seen; a total of 97 PFGE types were determined, of which the largest cluster consisted of four isolates with 100% similarity. However, only two of the patients (synchronously admitted to the same ward) with these isolates were epidemiologically related. Thirty-two isolates were pair-wise related; while the remaining isolates were clonally unrelated, as were all nine isolates with acquired b-lactamases. All the VIM-producing isolates in this study belonged to international clones. They were dominated by serotype O12 and the multi-locus sequence type ST111, which was a part of the internationally dominant clonal cluster CC111. The remaining two VIM producers (both serotype O6) belonged to the international clones ST233 (CC233) and ST654 (associated with KPC producers in Argentina and IMP producers in Singapore24,33), and the VEB-1-like/OXA-10 producer belonged to ST244/serotype O12 (previously reported from a PER-1 outbreak in Poland and recently from a Bulgarian study, in which the isolates quit interestingly also produced VEB-1/OXA-1013,42). Overall, the MLST/serotype profiles of these Danish VIM producers were consistent with earlier findings (incidentally, including an isolate imported from Denmark) in Swedish and Norwegian MBL producers col-
27
lected between 1999 and 2007.38 Only one of the nine isolates with acquired b-lactamases (the O6/ST654 VIM-2 producer) was confirmed to be travel associated, as the patient before local hospital admission in Denmark had been hospitalized in Thailand. It should be assumed that the remaining eight isolates represent nonindex cases, reflecting transmissions at later stages. The Danish situation is not a result of the spread of a single clone and can probably not be improved by hygienic measures alone. Some studies have shown that ciprofloxacin treatment is an independent risk factor for the acquisition of multi-drug resistant P. aeruginosa.32 Although a causal relationship between ciprofloxacin treatment and the development of carbapenem nonsusceptibility in P. aeruginosa has not been demonstrated, efflux pumps—such as mexABOprM, mexCD-OprJ, and mexXY—affect both quinolones and carbapenems (19). In this study, 60% of the isolates were resistant to ciprofloxacin (Table 2). In conclusion, carbapenem nonsusceptible P. aeruginosa is found in Denmark but more seldom than in other countries connected to the EARS-Net. It appears that reduced permeability of the outer cell membrane and/or increased efflux pump activity, often in combination with overexpression of chromosomal AmpC, is the most frequent mechanism. PFGE revealed a relatively nonclonal nature of the relatedness of the study isolates, but a small clonal cluster was demonstrated. Therefore, the current efforts to prevent spreading of these strains in Danish hospitals seem to be successful. However, the occurrence of eight VIM-2-producing isolates, all belonging to international, widespread clones, from six different departments of clinical microbiology, underlines the necessity of the ongoing efforts to detect and confirm isolates with a potential for spread of acquired b-lactamases. In addition, international high-risk clones of P. aeruginosa (e.g., ST111, ST175, and ST235), resistant to not only carbapenems, but also multidrug resistant or extensively drug resistant, have been reported worldwide and need to be detected as well. Acknowledgments Ulla Rydahl Johansen, Rigshospitalet, is thanked for technical assistance. Ørjan Samuelsen and Christian Giske are thanked for initial advising on the study design. This work was supported by the SSAC Foundation Board (Research grant number SLS-170021) and is a part of DANMAP (www.danmap.org). H.K.J. was supported by a clinical research stipend from the Novo Nordisk Foundation. Disclosure Statement No competing financial interests exist. References 1. Bogaerts, P., C. Bauraing, A. Deplano, and Y. Glupczynski. 2007. Emergence and dissemination of BEL-1-producing Pseudomonas aeruginosa isolates in Belgium. Antimicrob. Agents. Chemother. 51:1584–1585. 2. Cabot, G., A.A. Ocampo-Sosa, F. Tubau, M.D. Macia, C. Rodrı´guez, B. Moya, et al. 2011. Overexpression of AmpC and efflux pumps in Pseudomonas aeruginosa isolates from bloodstream infections: prevalence and impact on resistance
28
3.
4.
5.
6.
7.
8. 9.
10.
11.
12.
13.
14. 15. 16.
17.
18.
19.
HANSEN ET AL. in a Spanish multicenter study. Antimicrob. Agents. Chemother. 55:1906–1911. Cholley, P., M. Thouverez, D. Hocquet, N. van der MeeMarquet, D. Talon, and X. Bertrand. 2011. Most multidrugresistant Pseudomonas aeruginosa isolates from hospitals in eastern France belong to a few clonal types. J. Clin. Microbiol. 49:2578–2583. CLSI. 2012. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard—Ninth Edition. Cornaglia, G., H. Giamarellou, and G.M. Rossolini. 2011. Metallo-b-lactamases: a last frontier for b-lactams? Lancet Infect. Dis. 11:381–393. Curran, B., D. Jonas, H. Grundmann, T. Pitt, and C.G. Dowson. 2004. Development of a multilocus sequence typing scheme for the opportunistic pathogen Pseudomonas aeruginosa. J. Clin. Microbiol. 42:5644–5649. Dallenne, C., A. Da Costa, D. Decre´, C. Favier, and G. Arlet. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important betalactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65:490–495. DANMAP. 2007. September 2008 ISSN 1600–2032. DANMAP. 2011. Use of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from food animals, food and humans in Denmark. ISSN. 1600–2032. Delbru¨ck, H., P. Bogaerts, M.B. Kupper, R. Rezende de Castro, S. Bennink, Y. Glupczynski, et al. 2012. Kinetic and crystallographic studies of extended-spectrum GES-11, GES12, and GES-14 b-lactamases. Antimicrob. Agents. Chemother. 56:5618–5625. ECDC. 2012. Antimicrobial resistance surveillance in Europe 2011. Annual Report of the European Antimicrobial Resistance Network (EARS-Net). Stockholm: ECDC. Ellington, M.J., J. Kistler, D.M. Livermore, and N. Woodford. 2007. Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J. Antimicrob. Chemother. 59:321–322. Empel, J., K. Filczak, A. Mro´wka, W. Hryniewicz, D.M. Livermore, and M. Gniadkowski. 2007. Outbreak of Pseudomonas aeruginosa infections with PER-1 extended-spectrum beta-lactamase in Warsaw, Poland: further evidence for an international clonal complex. J. Clin. Microbiol. 45:2829– 2834. Erratum DANMAP. 2011. EUCAST. 2012. Antimicrobial susceptibility testing EUCAST disk diffusion method. Fera, M.T., and S. Zummo, A. DE Sarro. 2011. In vitro activity studies of doripenem and two other carbapenems tested against Pseudomonas aeruginosa and other nonfermentative bacilli. J. Chemother. 23:335–340. Furtado, G.H.C., M.D. Bergamasco, F.G. Menezes, D. Marques, A. Silva, L.B. Perdiz, et al. 2009. Imipenemresistant Pseudomonas aeruginosa infection at a medicalsurgical intensive care unit: risk factors and mortality. J. Crit. Care 24:625.e9–e14. Giske, C.G., L. Buarø, A. Sundsfjord, and B. Wretlind. 2008. Alterations of porin, pumps, and penicillin-binding proteins in carbapenem resistant clinical isolates of Pseudomonas aeruginosa. Microb. Drug Resist. 14:23–30. Hansen, D.S., H. Schumacher, F. Hansen, M. Stegger, F.B. Hertz, K. Schønning, et al. 2012. Extended-spectrum b-lactamase (ESBL) in Danish clinical isolates of Escherichia coli and Klebsiella pneumoniae: prevalence, b-lactamase distribu-
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
tion, phylogroups, and co-resistance. Scand. J. Infect. Dis. 44:174–181. Jeong, J.H., K.S. Shin, J.W. Lee, E.J. Park, and S.-Y. Son. 2009. Analysis of a novel class 1 integron containing metallobeta-lactamase gene VIM-2 in Pseudomonas aeruginosa. J. Microbiol. 47:753–759. Johansen, H.K., S.M. Moskowitz, O. Ciofu, T. Pressler, and N. Høiby. 2008. Spread of colistin resistant non-mucoid Pseudomonas aeruginosa among chronically infected Danish cystic fibrosis patients. J. Cyst. Fibros. 7:391–397. Juan, C., O. Gutie, C. Vidal, L. Pe, A. Oliver, J.E.T. Al, et al. 2005. Molecular mechanisms of beta-lactam resistance mediated by AmpC hyperproduction in Pseudomonas aeruginosa clinical strains. Antimicrob. Agents Chemother. 49:4733–4738. Kiratisin, P., R.A. Keel, and D.P. Nicolau. 2013. Pharmacodynamic profiling of doripenem, imipenem and meropenem against prevalent Gram-negative organisms in the Asia-Pacific region. Int. J. Antimicrob. Agents. 41:47–51. Koh, T.H., C.T. Khoo, T.T. Tan, M.A.B.M. Arshad, L.P. Ang, L.J. Lau, et al. 2010. Multilocus sequence types of carbapenem-resistant Pseudomonas aeruginosa in Singapore carrying metallo-beta-lactamase genes, including the novel bla(IMP-26) gene. J. Clin. Microbiol. 48:2563–2564. Lagatolla, C., E.A. Tonin, C. Monti-bragadin, L. Dolzani, F. Gombac, C. Bearzi, et al. 2004. Endemic Carbapenem-resistant Pseudomonas aeruginosa with acquired metallo-b-lactamase determinants in a European hospital. Emerg. Infect. Dis. 10:3–6. Leblebicioglu, H., N. Cakir, M. Celen, H. Kurt, H. Baris, and J. Laeuffer. 2012. Comparative activity of carbapenem testing (the COMPACT study) in Turkey. BMC Infect. Dis. 12:42. Lister, P.D., D.J. Wolter, and N.D. Hanson. 2009. Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 22:582–610. Maatallah, M., J. Cheriaa, A. Backhrouf, A. Iversen, H. Grundmann, T. Do, et al. 2011. Population structure of Pseudomonas aeruginosa from five Mediterranean countries: evidence for frequent recombination and epidemic occurrence of CC235. PLoS One 6:e25617. Magiorakos, A., A. Srinivasan, R.B. Carey, Y. Carmeli, M.E. Falagas, C.G. Giske, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18: 268–281. Michalopoulos, A.S., and M.E. Falagas. 2011. Colistin: recent data on pharmacodynamics properties and clinical efficacy in critically ill patients. Ann. Intensive Care 1:30. Miriagou, V., G. Cornaglia, M. Edelstein, I. Galani, C.G. Giske, M. Gniadkowski, et al. 2010. Acquired carbapenemases in Gram-negative bacterial pathogens: detection and surveillance issues. Clin. Microbiol. Infect. 16:112–122. Paramythiotou, E., J.-C. Lucet, J.-F. Timsit, D. Vanjak, C. Paugam-Burtz, J.-L. Trouillet, et al. 2004. Acquisition of multidrug-resistant Pseudomonas aeruginosa in patients in intensive care units: role of antibiotics with antipseudomonal activity. Clin. Infect. Dis. 38:670–677. Pasteran, F., D. Faccone, S. Gomez, S. De Bunder, F. Spinelli, M. Rapoport, et al. 2012. Detection of an international multiresistant clone belonging to sequence type 654 involved in the dissemination of KPC-producing Pseudomonas aeruginosa in Argentina. J. Antimicrob. Chemother. 67:1291–1293.
DANISH CARBAPENEM NONSUSCEPTIBLE P. AERUGINOSA 34. Pasteran, F., O. Veliz, M. Rapoport, L. Guerriero, and A. Corso. 2011. Sensitive and specific modified Hodge test for KPC and metallo-beta- lactamase detection in Pseudomonas aeruginosa by use of a novel indicator strain, Klebsiella pneumoniae ATCC 700603. J. Clin. Microbiol. 49: 4301–4303. 35. Pen˜a, C., C. Suarez, M. Gozalo, J. Murillas, B. Almirante, V. Pomar, et al. 2012. Prospective multicenter study of the impact of carbapenem resistance on mortality in Pseudomonas aeruginosa bloodstream infections. Antimicrob. Agents. Chemother. 56:1265–1272. 36. Riera, E., G. Cabot, X. Mulet, M. Garcı´a-Castillo, R. del Campo, C. Juan, et al. 2011. Pseudomonas aeruginosa carbapenem resistance mechanisms in Spain: impact on the activity of imipenem, meropenem and doripenem. J. Antimicrob. Chemother. 66:2022–2027. 37. Rodrı´guez-Martı´nez, J.-M., L. Poirel, and P. Nordmann. 2009. Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa. Antimicrob. Agents. Chemother. 53:4783–4788. 38. Samuelsen, O., M. a Toleman, A. Sundsfjord, J. Rydberg, T.M. Leegaard, M. Walder, et al. 2010. Molecular epidemiology of metallo-beta-lactamase-producing Pseudomonas aeruginosa isolates from Norway and Sweden shows import of international clones and local clonal expansion. Antimicrob. Agents. Chemother. 54:346–352. 39. Strateva, T., and D. Yordanov. 2009. Pseudomonas aeruginosa— a phenomenon of bacterial resistance. J. Med. Microbiol. 58:1133–1148.
29
40. Tsakris, A., A. Poulou, I. Kristo, T. Pittaras, N. Spanakis, S. Pournaras, et al. 2009. Large dissemination of VIM-2-metallo-{beta}-lactamase-producing Pseudomonas aeruginosa strains causing health care-associated community-onset infections. J. Clin. Microbiol. 47:3524–3529. 41. Van der Bij, A.K., D. Van der Zwan, G. Peirano, J.A. Severin, J.D. Pitout, M. Van Westreenen, W.H. Goessens, MBL-PA Surveillance Study Group. 2012. Metallo-b-lactamase-producing Pseudomonas aeruginosa in the Netherlands: the nationwide emergence of a single sequence type. Clin. Microbiol. Infect. 18: E369–E372. 42. Vatcheva-Dobrevska, R., X. Mulet, I. Ivanov, L. Zamorano, E. Dobreva, T. Velinov, et al. 2013. Molecular epidemiology and multidrug resistance mechanisms of Pseudomonas aeruginosa isolates from Bulgarian hospitals. [Epub ahead of print]; DOI: 10.1089/mdr.2013-0004.
Address correspondence to: Frank Hansen, MLS Antimicrobial Resistance Reference Laboratory and Surveillance Unit Statens Serum Institut Artillerivej 5 Copenhagen S DK-2300 Denmark E-mail:
[email protected]
