Characterization of Novel Peroxisome Proliferator ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 286, NO. 50, pp. 42923–42936, December 16, 2011 © 2011 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

Characterization of Novel Peroxisome Proliferator-activated Receptor ␥ Coactivator-1␣ (PGC-1␣) Isoform in Human Liver*□ S

Received for publication, February 3, 2011, and in revised form, October 14, 2011 Published, JBC Papers in Press, October 18, 2011, DOI 10.1074/jbc.M111.227496

Thomas K. Felder‡, Selma M. Soyal‡, Hannes Oberkofler‡, Penelope Hahne‡, Simon Auer‡, Richard Weiss§, Gabriele Gadermaier§, Karl Miller¶, Franz Krempler储, Harald Esterbauer**, and Wolfgang Patsch‡1 From the ‡Department of Laboratory Medicine, Paracelsus Medical University, 5020 Salzburg, §Department of Molecular Biology, University of Salzburg, 5020 Salzburg, Departments of ¶Surgery and 储Internal Medicine, Krankenhaus Hallein, 5400 Hallein, and **Department of Laboratory Medicine, Medical University Vienna, 1090 Vienna, Austria

PGC-1␣2 (PPARGC1A) influences transcription in an exceptional variety of biological pathways including adaptive ther-

* This study was supported by grants from the Fonds zur Förderung der wissenschaftlichen Forschung (FWF Project P19893-B05), the Wiener Wissenschafts-, Forschungs-, und Technologiefonds (WWTF Project L507-058), the Land Salzburg, and the Verein für Medizinische Forschung Salzburg, Austria. □ S The on-line version of this article (available at http://www.jbc.org) contains supplemental Figs. S1 and S2 and Table S1. The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) HQ695733. 1 To whom correspondence should be addressed: Dept. of Laboratory Medicine, Paracelsus Medical University, Müllner Hauptstrasse 48, 5020 Salzburg, Austria. Tel.: 43-662-44823800; Fax: 43-662-4482885; E-mail: [email protected]. 2 The abbreviations used are: PGC-1␣, peroxisome proliferator-activated receptor ␥ coactivator-1␣; RLM-RACE, RNA ligase-mediated rapid amplification of cDNA ends; RPA, ribonuclease protection assay; FOXO1, forkhead box 01A; PCK1, phosphoenolpyruvate carboxykinase 1; RPLP0, ribosomal protein, large, P0; SREBP-1c, sterol regulatory element-binding transcription factor 1c; NR, nuclear receptor; CREB, cAMP-response

DECEMBER 16, 2011 • VOLUME 286 • NUMBER 50

mogenesis (1), mitochondrial biogenesis (2), skeletal muscle fiber determination and neuromuscular junction formation (3, 4), angiogenesis (5, 6), hepatic gluconeogenesis (7–9), fatty acid ␤-oxidation (10), regulation of clock genes (11), and protection of neural cells from reactive oxygen species (12, 13). Recent reviews describe the numerous functions of this fascinating protein (14 –17). Several levels of regulation have been implicated to explain the diverse roles of PGC-1␣ and its interactions with distinct transcription factors. For some pathways, expression levels of PGC-1␣ and transcription factors coactivated by PGC-1␣ are crucial (18). In addition, various signaling pathways target PGC-1␣ at the post-translational level. Such modifications detailed recently (19) alter the stability of PGC-1␣ and/or direct interactions with specific factors, thereby enhancing distinct transcriptional programs. Alternative splicing and/or transcription initiation, resulting in gain or deletion of interacting domains or signaling targets, represents another mode of regulation (15). Several PGC-1␣ isoforms have been reported in animal models (20, 21). A short PGC-1␣ isoform was shown to be coexpressed with wild-type PGC-1␣ in mouse tissues and in human heart (22). The alternatively spliced mRNA is translated into a truncated protein, termed NT-PGC-1␣, that retains the N-terminal transactivation and nuclear receptor interaction domains and is functionally active. Knowledge about PGC-1␣ expression and regulation in human tissues is limited. However, such information is important because PGC-1␣ has been implicated in human disorders as diverse as type 2 diabetes mellitus (23–25) and Huntington disease (12, 26 –28). Here we report the sequence, subcellular localization, and some relevant functional properties of a novel PGC-1␣ isoform in human liver, termed L-PGC-1␣.

EXPERIMENTAL PROCEDURES Study Subjects—The study included 68 obese but otherwise healthy female patients. Participants were included if they had fasting plasma glucose levels ⬍7.0 mmol/liter, C-reactive proelement-binding protein; L, liver; NT, novel truncated; PPAR, peroxisome proliferator-activated receptor; 8-Br-cAMP, 8-bromoadenosine 3⬘,5⬘-cyclic monophosphate; LXR␣, liver X receptor ␣; MCAD, mediumchain fatty acyl-CoA dehydrogenase; mutHNF4␣, mutant HNF4␣; G6P, glucose-6-phosphatase.

JOURNAL OF BIOLOGICAL CHEMISTRY

42923

Downloaded from http://www.jbc.org/ at LANDESKLINIKEN SALZBURG on August 24, 2016

Peroxisome proliferator-activated receptor ␥ coactivator-1␣ (PGC-1␣) is a transcriptional coactivator that contributes to the regulation of numerous transcriptional programs including the hepatic response to fasting. Mechanisms at transcriptional and post-transcriptional levels allow PGC-1␣ to support distinct biological pathways. Here we describe a novel human liver-specific PGC-1␣ transcript that results from alternative promoter usage and is induced by FOXO1 as well as glucocorticoids and cAMP-response element-binding protein signaling but is not present in other mammals. Hepatic tissue levels of novel and wild-type transcripts were similar but were only moderately associated (p < 0.003). Novel mRNA levels were associated with a polymorphism located in its promoter region, whereas wildtype transcript levels were not. Furthermore, hepatic PCK1 mRNA levels exhibited stronger associations with the novel than with the wild-type transcript levels. Except for a deletion of 127 amino acids at the N terminus, the protein, termed L-PGC1␣, is identical to PGC-1␣. L-PGC-1␣ was localized in the nucleus and showed coactivation properties that overlap with those of PGC-1␣. Collectively, our data support a role of L-PGC-1␣ in gluconeogenesis, but functional differences predicted from the altered structure suggest that L-PGC-1␣ may have arisen to adapt PGC-1␣ to more complex metabolic pathways in humans.

Liver-specific Human PGC-1␣ Isoform

42924 JOURNAL OF BIOLOGICAL CHEMISTRY

of a 45-base RNA adapter oligonucleotide to the non-dephosphorylated RNA population using T4 RNA ligase (35). cDNA templates produced by random primed reverse transcription or commercially available human liver RACE-ready cDNA (Applied Biosystems/Ambion) was used for PCR. Nested primers corresponding to the 5⬘-RACE adapter sequence or complementary to PGC-1␣ (see supplemental Table S1) were used to perform the respective outer and inner reactions. PCR products were cloned into the pGEM-T Easy vector. RPA—RPAs were performed with the RPA IIITM Ribonuclease Protection Assay kit (Applied Biosystems/Ambion) as described (36). In brief, DNA plasmid templates for in vitro transcription of 32P-labeled antisense RNA probes for specific PGC-1␣ transcript sequences (supplemental Table S1) were generated as described. 32P-Labeled RNA antisense probes were synthesized using the Riboprobe威 in Vitro Transcription System (Promega) and [␣-32P]CTP (29.6 TBq/mmol; Amersham Biosciences). To produce “runoff” transcripts with SP6 or T7 RNA polymerases, plasmids were linearized with endonucleases generating 5⬘-overhangs. In vitro transcribed RNA was gel-purified, and incorporated radioactivity was determined by liquid scintillation counting (Wallac 1450 Microbeta PLU, EG&G Berthold). Typically, 10 ␮g of total or 500 ng of poly(A⫹) RNA was hybridized with ⬃5 ⫻ 104 cpm 32P-labeled antisense probes at 42 °C overnight. After digestion of unprotected RNA with 0.5 unit of RNase A and 20 units of RNase T1 at 37 °C for 30 min, 32P-labeled RNA-RNA hybrids were precipitated, subjected to electrophoresis in 5% polyacrylamide gels containing 8 M urea, dried, and exposed to the Image Station 2000 MultiModal Imaging System (Eastman Kodak Co.) or x-ray films (Kodak). Northern Blot Analyses—Northern blotting was performed with a NorthernMax威 kit (Ambion) using 5 ␮g of HepG2 or 2.5 ␮g of human liver, skeletal muscle, and kidney poly(A⫹) RNA (Clontech) per lane separated in 1.1% denaturing agarose gels (37). RNA was transferred to BrightStar威-Plus positively charged nylon membrane (Ambion) using a TurboblotterTM system (Whatman/Schleicher & Schuell). Membranes were hybridized overnight at 65 °C in Ultrahyb威 Northern blot solution (Ambion) with [␣-32P]CTP RNA probes complementary to PGC-1␣ or L-PGC-1␣ sequences. Blots were washed at 68 °C with low and high stringency buffers and subsequently exposed to Amersham Biosciences HyperfilmTM MP (GE Healthcare). Gene Expression and Genotyping—Equal amounts of RNA were reverse transcribed (36). Liver and/or hepatic mRNA levels of the genes encoding FOXO1 (Hs00231106_m1), glucose6-phosphatase (G6P; Hs00609178_m1), and phosphoenolpyruvate carboxykinase 1 (PCK1; Hs00159918_m19) were quantified in duplicate using the TaqMan gene expression assays (Applied Biosystems) listed in parentheses and the iCycler iQ Multi-Color real time PCR detector (Bio-Rad). Acidic ribosomal protein RPLP0 (NCBI Reference Sequence NM_001002.3) mRNA was used as an internal standard as described (38). For quantification of PGC-1␣ transcripts, we used assays spanning exons 1/2 (Hs02026722_m1), 1L/3 (custom-made), and 10/11 (Hs01016719_m1). To minimize the confounding effects of truncated PGC-1␣ transcripts as deduced from Northern analyses, we subtracted exon 1L/3 VOLUME 286 • NUMBER 50 • DECEMBER 16, 2011


tein levels ⬍30 mg/liter, no history of diabetes or use of lipidlowering medication, and no weight changes ⬎3% during the previous 2 months. They underwent a surgical weight-reducing procedure including a liver biopsy after an overnight fast. Tissue samples were collected in RNAlater (Ambion). Study participants provided informed consent, and study protocols were approved by the local ethics committee. Plasmids—Expression plasmids pLXR␣, pFOXO1, pFOXA2, pSREBP-1c, and pPGC-1␣ as well as the promoter-luciferase reporter construct pSREBP-1c-LUC were described earlier (25, 29 –33). Plasmids pHNF4␣ and pL-PGC-1␣ and the enhanced GFP in-frame fusion constructs pL-PGC-1␣-GFP and pPGC1␣-GFP were cloned into pcDNA6-V5/His A (Invitrogen) or pEGFP-N1 (Clontech), respectively. pcDNA6 was also used for generating human expression plasmids pPPAR␣ and pPPAR␥. The human promoter-luciferase reporter vectors pCD36Prom-Luc, pMCAD-Prom-Luc, pPCK1-Prom-Luc, pPGC-1␣Prom(2647)-Luc, and pL-PGC-1␣-Prom(3518)-Luc were generated in the pGL4 backbone (Promega). Two truncations of the promoter region were created from pL-PGC-1␣Prom(3518)-Luc, namely pL-PGC-1␣-Prom(1158)-Luc and pL-PGC-1␣-Prom(542)-Luc. The predicted binding sites for forkhead box 01A (FOXO1), CREB1 and NR3C1 (glucocorticoid receptor) of the latter plasmid as well as the AF-2 domain (L374A and L375A) in pHNF4␣ and pHNF4␣-Halo were altered using the QuikChange site-directed mutagenesis kit (Stratagene). L-PGC-1␣ was cloned into pCI TPA Art Tet, kindly provided by A. Hartl (34), for DNA vaccination. Plasmids for the ribonuclease protection assay (RPA) and Northern probe generation by in vitro transcription were obtained by T/A cloning of adequate PCR amplicons into the pGEM威-T Easy Vector System (Promega). The C-terminal Halo-tagged versions pL-PGC-1␣-Halo, pPGC-1␣-Halo, pHNF4␣-Halo, and pmutHNF4␣-Halo used for chromatin isolation and pulldown analyses were generated in the pHTC HaloTag威 CMV-neo Vector (Promega). All plasmids were generated by standard molecular biology cloning techniques and verified by DNA sequencing using the ABI 3500 genetic analyzer (Applied Biosystems). Primers used for the generation of the respective amplicons are given in supplemental Table S1. RNA Analyses—Total RNA was isolated from Sprague-Dawley rat liver, human liver, and HepG2 cells using RNeasy Mini or Midi kits (Qiagen) and digested with DNase I (Promega). Poly(A⫹) fractions were prepared using the PolyATract mRNA Isolation System (Promega). The quality of total and poly(A⫹)selected RNA was ascertained by electrophoresis in denaturing formaldehyde-agarose gels. We purchased the FirstChoice Human Total RNA Survey Panel and Swiss Webster mouse liver RNA (Applied Biosystems/Ambion) and hepatic total RNA from dog and rhesus monkey (Biochain). RNA Ligase-mediated Rapid Amplification of cDNA Ends (RLM-RACE)—The FirstChoice威 RLM-RACE kit (Applied Biosystems/Ambion) was used for RLM-RACE analyses according to the manufacturer’s instructions. Briefly, 1 ␮g of total human liver RNA was treated with calf intestine alkaline phosphatase to remove free 5⬘-phosphates, leaving the 5⬘-cap structure of full-length mRNA intact. The cap was removed by incubation with tobacco acid pyrophosphatase prior to ligation



taining 5% (w/v) nonfat dry milk for 1 h at 22 °C, membranes were incubated overnight at 4 °C with monoclonal antibody PGC-1␣ (3G6 rabbit mAb, Cell Signaling Technology), polyclonal IgG PGC-1␣ (K-15, sc-5816 antiserum, Santa Cruz Biotechnology), or antisera obtained by DNA vaccination. After washing and incubation with the secondary anti-rabbit HRPlinked (Cell Signaling Technology) or anti-mouse IgG HRPlinked antibody (Pierce Thermo Fisher Scientific) for 1 h at 22 °C, blots were exposed to SuperSignal West Dura substrate (Pierce Thermo Fisher Scientific), and chemiluminescence signals were recorded using the Kodak Imaging Station 2000 MM. Chromatin Immunoprecipitation (ChIP) Assays—We used the HaloChip System (Promega), which provides a robust alternative to the standard ChIP method by capturing protein-DNA complexes from mammalian cells without the need for antibodies. The HaloTag protein is fused to the protein of interest via cloning into a HaloTag vector and mediates a covalent interaction with a resin-based ligand. C-terminally Halo-tagged versions of L-PGC-1␣, PGC-1␣, or HNF4␣ or the empty HaloTag vector was transiently expressed in HEK293 or HepG2 cells for 24 h and subsequently treated for 10 min with formaldehyde (1%, v/v) to induce covalent protein-DNA cross-links. Crosslinking was quenched by the addition of glycine to a final concentration of 125 mM. Cells were pelleted in PBS and frozen at ⫺70 °C for 10 min prior to lysis by mechanical disruption using 25 strokes of a Dounce homogenizer. Lysates were sonicated using a Branson sonicator (13 cycles of 15 s each with 1 min of cooling on ice between cycles) to shear chromatin to a median fragment size of ⬃500 bp. Cross-linked complexes containing HaloTag proteins were captured using HaloLink resin according to the manufacturer’s recommendations. After stringent washing to remove nonspecific proteins and DNA, captured DNA fragments were released by heating for 6 h at 65 °C and purified using a Wizard SV Gel and PCR Clean-Up System (Promega). Purified DNA was subjected to PCR amplification using primers spanning the HNF4␣ binding site in the PCK1 promoter (39). Cells transfected with the empty pHTC HaloTag vector were used as a negative control. As an additional control, an aliquot of the L-PGC-1␣-Halo lysate was incubated with blocking ligands, preventing the interaction of the Halo-tagged protein with the HaloLink resin. Pulldown Analyses—We used the HaloTag Mammalian PullDown System (Promega) according to the manufacturer’s instructions. HEK293 cells (2 ⫻ 107) were transiently transfected with C-terminally Halo-tagged versions of L-PGC-1␣ or HNF4␣ as baits to capture interacting proteins. Cells expressing the HaloTag control vector served as a negative control. Cells were lysed 36 h after transfection, and nuclear extracts were prepared as described (36). HaloTag fusion proteins along with their interacting proteins were captured using the HaloLink resin and washed gently. Interacting proteins were eluted from the resin with SDS elution buffer and subjected to SDS-PAGE followed by electroblotting. Blots were probed with mouse monoclonal HNF4␣ antibody (sc-101059, Santa Cruz Biotechnology) and anti-mouse IgG HRP-linked antibody (Pierce Thermo Fisher Scientific) as secondary antibody. Monoclonal histone H3 antibody (3H1 rabbit mAb, Cell SignalJOURNAL OF BIOLOGICAL CHEMISTRY

42925


from exon 10/11 containing transcripts for estimation of fulllength PGC-1␣ transcripts. We verified the accuracy of the customized assay by sequencing the cloned amplicons in three individuals. To directly compare measurements of PGC-1␣ transcript regions, gene segments containing the sequences targeted by the respective TaqMan assays were used to construct standard curves. Data are presented in arbitrary units relative to RPLP0 mRNA. For typing rs12500214, we used a TaqMan genotyping assay (C_11325181_10, Applied Biosystems). Cell Culture and Transfection Experiments—Human hepatoma HepG2 cells were grown as recommended by the supplier (American Type Culture Collection). HepG2 cells cultured in 24-well dishes were transfected using Lipofectamine 2000 reagent (Invitrogen) as described (25). We used 0.2 ␮g of reporter plasmids, 0.5 ␮g of expression plasmids, and 20 ng of pRL-TK plasmid (Promega) as transfection control per well. Cells were collected 24 h after transfection, and firefly and Renilla luciferase activities were measured with a GloMax Multi Detection System luminometer (Promega) using the Dual-Luciferase Reporter Assay System (Promega). Results are representative of two experiments, each performed in quadruplicate, and are given as means ⫾ S.D. Dexamethasone, 8-bromoadenosine 3⬘,5⬘-cyclic monophosphate (8-Br-cAMP), WY14643, troglitazone, 22(R)-hydroxycholesterol, and 9-cis-retinoic acid were obtained from Sigma-Aldrich and used at the concentrations indicated. Fluorescence Microscopy—A Zeiss Axioskop microscope equipped with an oil immersion ⫻100 objective lens and a video camera was used for fluorescence and differential interference contrast microscopy. HepG2 cells were transfected with plasmid pL-PGC-1␣-GFP or pPGC-1␣-GFP. Visualization of nuclei and mitochondria in living cells was performed with 4⬘,6⬘-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) DNA staining and MitoTracker威 Red CMXRos (Invitrogen, Molecular Probes), respectively. In Vitro Transcription/Translation—Plasmids pPGC-1␣ and pL-PGC-1␣ and the TNT威 Quick Coupled Transcription/ Translation System (Promega) were used for in vitro synthesis of wild-type and L-PGC-1␣. Briefly, 1 ␮g of circular plasmid DNA was added to TNT lysate, reaction buffer, RNA polymerase, ribonuclease inhibitor, and non-radioactive amino acids and incubated at 30 °C for 90 min. Samples were denatured in sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% (w/v) SDS, 10% glycerol, 50 mM DTT, 0.01% (w/v) bromphenol blue) at 95 °C for 5 min, cooled on ice, and subjected to electrophoresis in SDS-polyacrylamide gels. Immunoblotting—Human brain tissue protein extract (Millipore, catalogue number CL302) and liver nuclear extract (Active Motif, catalogue number 36042) were used for immunoblotting. Nuclear and cytoplasmic extracts from HepG2 cells grown to confluence in 70-cm2 flasks were prepared using the NE-PERTM kit (Pierce Thermo Fisher Scientific). Protein concentrations were determined using the BCA Protein Assay (Pierce Thermo Fisher Scientific). Equal amounts of nuclear extracts per lane (15 ␮g) were subjected to SDS-polyacrylamide gel electrophoresis followed by electrotransfer to an Amersham Biosciences HybondTM-P PVDF transfer membrane (GE Healthcare) as described (32). After blocking with 1⫻ TBS con-


RESULTS Identification and Characterization of Novel PGC-1␣ Transcript in Human Liver and HepG2 Cells—Initially, we used cDNA from various tissues to perform PCR yielding amplicons evenly spread over the entire human PGC-1␣ mRNA. Marked reductions of PCR products spanning exons 2– 4 relative to other exon-spanning amplicons of comparable length were observed in cDNA from liver but not from skeletal muscle or kidney (data not shown). To identify alternative transcripts, we used RLM-RACE, a technique that restricts cDNA amplification to 5⬘-capped mRNAs. RACE-ready cDNA prepared from liver biopsies of three patients served as templates for 5⬘-RLMRACE from exon 4. Two distinct amplification products were observed in all three subjects (Fig. 1A). Sequencing showed that the larger 847-bp amplicon contained an alternative exon 1, termed exon 1L, located within intron 2, that was spliced to exon 3 followed by exon 4. The smaller 637-bp amplicon contained the reported wild-type sequence. Similar results were obtained with RACE-ready human liver cDNA (Ambion) and HepG2 cDNA (data not shown). To fine map the start site(s) of the novel transcript, we performed 5⬘-RLM-RACE with a nested reverse primer located in exon 1L and observed two amplicons in liver biopsies of four subjects but no amplicon in brain mRNA (Fig. 1B). Sequencing indicated that the larger fragments differed from the shorter fragments by a 5⬘-extension of 41 bp (supplemental Fig. S1). Interestingly, the relative intensities of the two bands varied among individuals. As NCBI dbEST entry BX105309 showed another exon upstream of exon 1L in human testis, we performed PCR with primers located in exon 1L and the putative


upstream exon but did not detect such an exon in liver. Moreover, in silico analyses predicted two transcriptional initiation sites in exon 1L with scores of 0.86 and 0.85 that perfectly matched the sites obtained by RLM-RACE. Hence, the novel liver transcript is generated by variable utilization of two transcription start sites in exon 1L. As described previously (37), wild-type transcripts in liver and brain were also initiated at two adjacent sites (Fig. 1B). To confirm the expression of exon 1L in human liver and HepG2 cells, we performed RPAs using a probe spanning the exon 1L/exon 3 junction. Fragments predicted from RACE studies were protected in liver and HepG2 cells but not in skeletal muscle or kidney (Fig. 1C). Furthermore, abundance levels of transcripts with or without exon 1L were comparable. Because significant amounts of 64-nucleotide fragments protected only if exon 1L was spliced to sequences other than the acceptor site of exon 3 were not detected, exon 1L was exclusively spliced to exon 3. This conclusion was supported by 3⬘-RACE studies (data not shown). The location of exon 1L in the genomic PGC-1␣ context is displayed in Fig. 1D. Two RPA probes extending from exon 1L or exon 2 to exon 7 were used for further characterization of hepatic PGC-1␣ transcripts. Liver and HepG2 RNA contained fully protected fragments with both probes (supplemental Fig. S2, A and B), but transcripts harboring exon 1L were not detected in brain RNA. To determine whether exon 1L-initiated mRNA was subject to alternative splicing similar to transcripts encoding NT-PGC1␣, we performed semiquantitative RT-PCR and sequenced amplicons. Using liver and HepG2 mRNA as templates, we observed a minor transcript population initiated at exon 1L that was alternatively spliced and contained the intron 6 insertion (supplemental Fig. S2C). Next, we determined the full sequence of exon 1L-initiated transcripts. Exon 1L and exon 13 primers produced amplicons specific to HepG2 or liver cDNA compared with control amplicons amplified with exon 1 and exon 13 primers and obtained in liver, skeletal muscle, and HepG2 cDNA (Fig. 1E). Sequencing of amplicons verified the exon 1L/exon 3 junction and the regular order of exons 3–13. Northern blots using mRNA and a cRNA probe hybridizing to exon 1L revealed two transcripts of ⬃6.4 and ⬃5.3 kb in liver and HepG2 cells but not in kidney or skeletal muscle (Fig. 1F). Using a probe spanning exons 2–7, transcripts of comparable sizes were observed in all mRNAs analyzed (Fig. 1G). As suggested previously (37), the size difference of 1.1 kb between these mRNA species most likely reflects usage of alternative poly(A) signals in exon 13. Thus, liver and HepG2 cell transcripts initiated in exon 1L are similar in size to wild-type transcripts present in other tissues. Hence, only probes targeting the distinct 5⬘-regions discriminate the two types of transcripts. In liver, HepG2 cells, and kidney and to a lesser extent in skeletal muscle, abundant small transcripts of ⬃0.8 kb were observed with the exon 2–7 but not the exon 1L probe. Similar data have been reported in rats (43). Because of the more effective transfer of short mRNA by diffusion blotting, their levels are probably greatly overestimated in comparison with full-length mRNA. VOLUME 286 • NUMBER 50 • DECEMBER 16, 2011


ing Technology) was used as a loading control of nuclear extracts. DNA Vaccination—Female BALB/c mice (6 – 8 weeks of age; Charles River, Sulzfeld, Germany) were immunized via gene gun three times at weekly intervals. L-PGC-1␣, cloned into pCI TPA Art Tet (34), was precipitated onto gold beads (1.6-␮m diameter) with CaCl2 in the presence of spermidine at a loading rate of 2 ␮g/mg of gold. Mice received a total of 2 ␮g of DNA per immunization, divided between two non-overlapping areas, on the shaved abdomen at a helium pressure of 400 p.s.i. Blood samples were taken before and 2 weeks after the third immunization. Mice were boosted by gene gun 11 weeks after the third immunization and exsanguinated 1 week later (34, 40). All animal experiments were approved by the local animal committee. Computational and Statistical Analyses—Linear regression analyses were performed using log-transformed hepatic mRNA levels. Effects of genotypes associated with rs12500214 on L-PGC-1␣ transcript levels were ascertained by analysis of variance adjusted for age and body mass index. Transactivation assays were analyzed by analysis of variance. Allele frequencies were estimated by gene counting. Agreement with HardyWeinberg expectations was tested using a ␹2 goodness-of-fit test. To identify transcription initiation sites and evolutionarily conserved regions we used PROMO (41) and rVISTA (42). Accession Number—The sequence of the transcript encoding L-PGC-1␣ has been deposited in GenBankTM under accession number HQ695733.



FIGURE 1. Identification of L-PGC-1␣ in human liver. A, 5⬘-RLM-RACE of hepatic total RNA from three patients (P1–P3) with outer and inner reactions primed from exon 4. B, 5⬘-RLM-RACE of hepatic total RNA from four patients (P1–P4) and human brain total RNA. Primers for outer and inner reactions are indicated by black and gray arrows, respectively. C, RPA using a probe extending from exon 1L to exon (ex) 3 and total human tissue or HepG2 RNA. Protected fragments are shown below the autoradiograph. D, diagram showing exon 1L (black box), the translation start site for L-PGC-1␣ (bold arrow), and PGC-1␣ (plain arrow) in the genomic context of the PGC-1␣ locus. E, amplification of L-PGC-1␣ (1L–13) and PGC-1␣ (1–13) using HepG2, liver, or skeletal (sk.) muscle cDNA. F and G, Northern blots of mRNA from human tissues and HepG2 cells using probes complementary to exon 1L (F) or extending from exon 2 to exon 7 (G). M, molecular marker; nc, negative control; pc, in vitro transcribed mRNA containing exon 1L and exon 3–7 sequences; nt, nucleotides.

Novel Isoform Is Highly Enriched in Human Liver but Not Detectable in Livers of Mice or Higher Mammals—To determine the tissue-specific expression of exon 1L, we quantified exon 1L- and exon 1-containing transcripts in 18 human tissues (Fig. 2A). Exon 1- and 2-containing mRNA was expressed in most tissues but mainly in brain, kidney, liver, skeletal muscle, DECEMBER 16, 2011 • VOLUME 286 • NUMBER 50

and thyroid. In contrast, exon 1L-containing transcripts were strongly expressed in liver and to a lesser extent in testis. We therefore termed the novel transcript L-PGC-1␣. As observed with RPAs, the abundance levels, corrected for amplification efficiency, of wild-type and exon 1L-containing transcripts were comparable in human liver. JOURNAL OF BIOLOGICAL CHEMISTRY

42927


PGC-1␣ mRNA is highly conserved among mammals, and exon 1L is located within an evolutionarily conserved region. We therefore ascertained whether exon 1L homologues are expressed in livers of mammals. Using several primer pairs targeting the conserved exon 1L region and exon 3 of the mouse gene, we failed to detect transcripts in liver cDNA of overnight fasted mice. In contrast, transcripts spanning exons 1–3 were readily amplified from the same cDNA. In addition, a probe complementary to murine exons 2 and 3 protected fragments of wild-type transcripts as expected (Fig. 2B). However, 92 nucleotide-containing fragments indicative of splicing of another exon (such as exon 1L) to exon 3 were not observed. RT-PCRs


using hepatic RNA from rat, dog, and rhesus monkey and primers located in fully conserved regions of exon 1L and exon 3 produced no amplicons, whereas a product was readily obtained in human liver. The adequacy of RNAs was verified in assays with universal primers located in exons 11 and 13 as amplicons were obtained in all species (Fig. 2C). In Vitro Transcription/Translation, Immunoblotting, and Immunocytochemistry—Splicing of exon 1L to exon 3 eliminates the start ATG codon of PGC-1␣ located in exon 1. The first ATG codon, producing an open reading frame, is shifted into exon 3, resulting in deletion of the first 127 amino acids. To test whether such a shorter isoform is translated, we performed VOLUME 286 • NUMBER 50 • DECEMBER 16, 2011


FIGURE 2. Tissue- and species-specific expression of L-PGC-1␣ transcripts. A, mRNA abundance of exon 1/exon 2- and exon 1L/exon 3-containing transcripts relative to RPLP0 mRNA and normalized to amplification efficiency: Columns (error bars) are means (S.D.). B, RPA using total mouse liver RNA and a mouse-specific probe extending from exon (ex) 2 to exon 3. Fragments protected in wild-type or possible variant transcripts are shown below the autoradiograph. C, evolutionary conservation of rat, mouse, dog, and rhesus monkey sequences (relative to human) extending from exon 1 to exon 4 (rVISTA). Primers located in exon 1L and exon 3 as indicated by arrows and matching the sequence in each species were used for PCR. Universal primers located in exon 11 and exon 13 were used for validation PCR. Blue, exons; salmon, intronic sequences; green, repeat sequences or transposons. AU, arbitrary units; t., tissue; Ovar, ovary; Sk., skeletal; Sm., small; nt, nucleotides; nc, negative control.


in vitro coupled transcription/translation reactions with PGC-1␣ and L-PGC-1␣. Both PGC-1␣ and L-PGC-1␣ (⬃91 and 77 kDa, respectively) were identified by immunoblotting using an antibody directed against C-terminal epitopes of PGC-1␣ (Fig. 3A). The same antibody recognized two proteins of sizes attributed to potential post-translationally modified PGC-1␣ and L-PGC-1␣ in HepG2 nuclear extracts, whereas a monoclonal antibody against an N-terminal epitope detected PGC-1␣ and NT-PGC-1␣ but not L-PGC-1␣ (Fig. 3, B and C). Antiserum produced by vaccination with DNA encoding L-PGC-1␣ clearly detected a band (not observed with preimmune serum of the predicted L-PGC-1␣ size in nuclear extracts of HepG2 cells and liver, whereas faint bands corresponding to the size of the wild-type protein were visualized (Fig. 3, D and DECEMBER 16, 2011 • VOLUME 286 • NUMBER 50

E). A comparison of functional domains present in PGC-1␣, L-PGC-1␣, and NT-PGC-1␣ is shown in Fig. 3F. To ascertain the subcellular localization of L-PGC-1␣, which contains a nuclear localization signal, we transiently expressed wild-type and L-PGC-1␣, both C-terminally tagged with inframe enhanced GFP, in HepG2 cells. We observed colocalization of both wild-type and L-PGC-1␣ with DAPI staining, indicating nuclear localization of the new isoform (Fig. 4). The 5⬘-Sequence of L-PGC-1␣ Supports Its Transcription— To substantiate the accuracy of transcription initiation sites in exon 1L, we cloned a ⬃ 3.2-kb upstream fragment into a reporter vector and observed, in comparison with control, a 4-fold increase of transcriptional activity in transient transfections of HepG2 cells (Fig. 5A). In silico analysis predicted a JOURNAL OF BIOLOGICAL CHEMISTRY

42929


FIGURE 3. Detection of L-PGC-1␣ in human liver and/or HepG2 cells and diagram of functional domains of PGC-1␣. A, in vitro translated proteins detected by polyclonal antiserum directed against C-terminal epitopes. B and C, immunoblots of nuclear extracts from HepG2 cells using a polyclonal serum against C-terminal epitopes (B) and a monoclonal antibody (Ab) against an N-terminal (N-term) epitope (C). D, immunoblots of the HepG2 nuclear extract used in B and C with polyclonal pre- and post-DNA vaccination-based sera. E, immunoblots of nuclear extracts from human liver and nuclear (nuc) and cytoplasmic (cyto) extracts from HepG2 cells using the N-terminal monoclonal antibody (left panel) or DNA vaccination-based antiserum (right panel). F, NT-PGC-1␣ and L-PGC-1␣ structures are indicated by bold brackets; interacting surfaces along with interacting partners are depicted by brackets. NES1 and NES2, nuclear export signals; AD, activation domain; L1, L2, and L3, nuclear boxes; SUMO, sumoylation sites; HCB, host cell factor docking site; RS, arginine/serine-rich domains, NL, nuclear localization signal; RRM, RNA recognition motif; P, phosphorylation sites; CBP, CREB-binding protein.


FOXO1 binding site in the putative promoter. Indeed, cotransfection of HepG2 cells with FOXO1 expression plasmids markedly induced reporter gene activity, and two truncated promoter-reporter constructs retained FOXO1 inducibility (Fig. 5A). Mutagenesis of the predicted FOXO1 core sequence in the 0.542-kb promoter construct reduced its activation by FOXO1 nearly to the control level (Fig. 5, B and C). Thus, the sequence immediately upstream of exon 1L is a functional promoter that is activated by FOXO1 in vitro. Moreover, FOXO1 and L-PGC-1␣ mRNA levels in livers of obese subjects are strongly correlated (Fig. 5D). Exon 1L along with its 5⬘-region (harboring rs12500214) is located in a haplotype block distinct from haplotype blocks comprising the wild-type promoter or the sequence downstream of exon 2.3 We typed rs12500214 in 68 obese female subjects. Genotypes associated with rs12500214 fulfilled Hardy-Weinberg expectations and were associated with L-PGC-1␣ mRNA levels (Fig. 5E). Conversely, no effects of rs12500214 on full-length PGC-1␣ mRNA were noted (1.73 ⫾ 2.44, 2.11 ⫾ 3

T. K. Felder, S. M. Soyal, H. Oberkofler, P. Hahne, S. Auer, R. Weiss, G. Gadermaier, K. Miller, F. Krempler, H. Esterbauer, and W. Patsch, unpublished observations.


1.96, and 0.60 ⫾ 0.58 arbitrary units for genotypes GG, GA, and AA, respectively). Glucocorticoids as well as glucagon-PKA signaling are enhanced in the fasting state, and both signaling pathways increase hepatic PGC-1␣ expression (9). We therefore investigated whether hepatic L-PGC-1␣ mRNA is also induced by these signaling cascades. HepG2 cells treated with dexamethasone showed comparable increases in L-PGC-1␣ and PGC-1␣ transcripts and larger increases in the mRNA levels of the PGC-1␣ targets PCK1 and G6P. At the doses used, even stronger effects on L-PGC-1␣, PGC-1␣, PCK1, and G6P mRNA levels were observed with the cAMP analog 8-Br-cAMP (Fig. 6A). Moreover, strong associations of L-PGC-1␣ and PCK1 transcript levels were noted in liver biopsies, providing an in vivo correlate for a role of L-PGC-1␣ in PCK1 mRNA expression (Fig. 6B). Furthermore, PGC-1␣ transcript levels displayed only modest associations with L-PGC-1␣ (r ⫽ 0.3756, p ⫽ 0.003) and PCK1 transcript levels (r ⫽ 0.3649, p ⫽ 0.005). To identify the respective cis-regulatory sites in the L-PGC-1␣ promoter, we transfected reporter constructs driven by L-PGC-1␣ promoters of different lengths into HepG2 cells. Again, treatment of cells with 8-Br-cAMP induced L-PGC-1␣ promoter activities more than dexamethasone. Furthermore, the stimulatory VOLUME 286 • NUMBER 50 • DECEMBER 16, 2011


FIGURE 4. Subcellular localization of PGC-1␣ and L-PGC-1␣ in HepG2 cells. Differential interference contrast (DIC) and fluorescence micrographs of HepG2 cells transiently transfected with enhanced GFP (eGFP) in-frame fusion constructs pPGC-1␣-GFP and pL-PGC-1␣-GFP are shown. DAPI or MITO denotes nuclear staining with 4⬘,6⬘-diamidino-2-phenylindole or mitochondrial staining with MitoTracker Red CMXRos, respectively.


effects of both dexamethasone and 8-Br-cAMP increased with the extent of promoter truncations (Fig. 6C). In silico analyses suggested putative binding sites for CREB and glucocorticoid receptors (glucocorticoid response element) at position ⫺368 to ⫺348 and ⫺57 to ⫺36, respectively. Indeed, mutagenesis of the CREB binding site and the glucocorticoid response element in the 0.542-kb promoter construct abrogated its activation by the respective treatment (Fig. 6D). To identify potential transcriptional pathways with distinct influences on hepatic L-PGC-1␣ and PGC-1␣ promoter activities, HepG2 cells were cotransfected with equimolar amounts of L-PGC-1␣ and PGC-1␣ promoter-reporter constructs and expression plasmids encoding various transcription factors known to be active in liver (Fig. 6E). PPAR␥ and nuclear active SREBP-1c had no stimulatory effect on either reporter construct, whereas PPAR␣ enhanced transcription only from the L-PGC-1␣ promoter. HNF4␣ and LXR␣ activated both reporter constructs. Compared with the PGC-1␣ promoter, the L-PGC-1␣ promoter was more strongly trans-activated by FOXO1, whereas the opposite effect was observed for FOXA2. DECEMBER 16, 2011 • VOLUME 286 • NUMBER 50

L-PGC-1␣ and PGC-1␣ Have Overlapping Coactivation Properties—To delineate potential functional differences between PGC-1␣ and L-PGC-1␣ in human systems, we compared their coactivation properties by cotransfection of HepG2 cells with L-PGC-1␣ and PGC-1␣ expression vectors along with reporter constructs driven by promoters of various nuclear receptors (NRs). As PGC-1␣ was originally identified as a coactivator of PPAR␥, we examined the ability of L-PGC-1␣ to coactivate the CD36 promoter containing a bona fide PPAR␥ response element with activity in liver (44). L-PGC-1␣ and PGC-1␣ showed comparable coactivation potencies when equimolar amounts of expression plasmids were used (Fig. 7A). Coactivation of PPAR␣ and HNF4␣, demonstrated previously for PGC-1␣ (45, 46), was determined with MCAD and PCK1 promoters, respectively. Again, comparable activities for L-PGC-1␣ and PGC-1␣ were observed (Fig. 7, B and C). However, only PGC-1␣ coactivated LXR␣ at the SREBP-1c gene promoter (Fig. 7D). L-PGC-1␣ Physically Interacts with HNF4␣ and Is Recruited to PCK1 Promoter—As our in vitro reporter gene assays indicated that L-PGC1␣ coactivated the transcriptional activity of JOURNAL OF BIOLOGICAL CHEMISTRY

42931


FIGURE 5. Transcriptional activity of exon 1L 5ⴕ-upstream region. A, L-PGC-1␣ promoter-reporter constructs of various lengths were cotransfected with a FOXO1 expression plasmid into HepG2 cells. B, FOXO1 binding site DNA logo (62) and native and mutagenized (MUT) L-PGC-1␣ promoter (Prom) sequences. C, mutagenesis of the FOXO1 binding site in the 0.542-kb promoter construct abolishes FOXO1-dependent reporter activation in HepG2 cells. D, correlation of hepatic L-PGC-1␣ and FOXO1 transcript levels in humans. E, effects of genotypes associated with rs12500214 on L-PGC-1␣ transcript levels. AU, arbitrary units. Columns are means, error bars are S.D. (A, C) or S.E. (E).


HNF4␣ at the PCK1 promoter, we used ChIP and pulldown assays as additional approaches to directly demonstrate a physical interaction of L-PGC-1␣ with HNF4␣. We transiently transfected HEK293 cells with expression plasmids encoding the Halo-tagged versions of PGC-1␣, L-PGC-1␣, and HNF4␣ and studied the recruitment of the respected fusion proteins to the PCK1 promoter. Using DNA fragments captured by HaloTag resins, we performed PCR with a primer pair amplifying a 177-nucleotide fragment spanning the predicted HNF4␣ binding site on the PCK1 promoter (39). Signals of the expected sizes were obtained for all three constructs, whereas no signal was noted in cells expressing solely the HaloTag protein (Fig. 8A). Next, we performed pulldown experiments with nuclear


extracts from HEK293 cells transiently transfected with empty vector and Halo-tagged L-PGC-1␣ or HNF4␣ expression plasmids. HNF4␣ clearly was present in protein complexes isolated from cells expressing Halo-tagged L-PGC-1␣ but not from cells transfected with the empty vector or the Halo-tagged HNF4␣ expression plasmid (Fig. 8B). The latter result was expected as the Halo-tagged protein covalently binds the HaloTag resin. Previous studies have shown that coactivation of PPAR␣ and glucocorticoid receptor by PGC-1␣ requires an intact AF-2 domain (10, 47, 48). To determine whether coactivation of HNF4␣ by L-PGC-1␣ also is dependent on AF-2 function, we mutagenized this domain in HNF4␣ and its Halo-tagged version (49) and studied its effect on PCK1 promoter activation. In VOLUME 286 • NUMBER 50 • DECEMBER 16, 2011


FIGURE 6. Induction of L-PGC-1␣ mRNA by dexamethasone, 8-Br-cAMP, and various transcription factors in HepG2 cells. A, HepG2 cells were incubated with 1 ␮M dexamethasone or 100 ␮M 8-Br-cAMP for 6 h, and mRNA levels were measured by quantitative real time RT-PCR. B, correlation of hepatic L-PGC-1␣ and PCK1 transcript levels in humans. C, L-PGC-1␣ promoter-reporter constructs of various lengths were transfected into HepG2 cells in equimolar amounts and incubated as in A prior to measurement of reporter gene activities. D, mutagenesis (Mut) of glucocorticoid response element (GRE) or the CREB binding site (CREBP) in the 0.542-kb promoter construct abrogates its activation by glucocorticoids or 8-Br-cAMP in HepG2 cells. Columns (error bars) are means (S.D.) of quadruplicate determinations; asterisks within bars denote p ⬍ 0.01 versus control. E, transactivation of L-PGC-1␣ and PGC-1␣ promoter-reporter constructs by various transcription factors with reported activity in liver. Asterisks within bars denote p ⬍ 0.01 versus control. AU, arbitrary units; Prom-LUC, promoter-luciferase.


studies of transient transfection of HepG2 cells with HNF4␣ and mutHNF4␣ expression plasmids, activation of the PCK1 promoter was slightly reduced by the mutated protein in comparison with the wild-type protein. However, coactivation of HNF4␣ by L-PGC-1␣ was completely abolished by the mutation (Fig. 9A). The former result was supported by ChIP assays showing an amplification of the HNF4␣ binding site of the PCK1 promoter in cells expressing the Halo-tagged version of mutated HNF4␣ (data not shown). We also performed ChIP assays in HepG2 cells cotransfected with pL-PGC-1␣-Halo and pHNF4␣ or pmutHNF4␣ (Fig. 9B). Signal intensities of amplicons spanning the HNF4␣ binding site of the PCK1 promoter were reduced to ⬃50% in cells coexpressing mutant HNF4␣ compared with cells coexpressing HNF4␣. The signals noted in mutHNF4␣ cells were a consistent finding and may reflect the activity of endogenous HNF4␣ present in HepG2 cells. No amplification products were generated in cells transfected with the empty vector or after blocking the binding of Halo-tagged L-PGC-1␣ to the HaloTag resin.

DISCUSSION Alternative pre-mRNA processing and/or transcript initiation substantially enhances the complexity of mammalian transcriptomes as multiple transcripts and proteins with distinct functions may be produced from a single gene locus. A systemDECEMBER 16, 2011 • VOLUME 286 • NUMBER 50

4

S. M. Soyal, T. K. Felder, S. Auer, P. Hahne, H. Oberkofler, and W. Patsch, unpublished observations.


42933


FIGURE 7. Functional differences between PGC-1␣ and L-PGC-1␣. HepG2 cells were cotransfected with equimolar amounts of PGC-1␣ or L-PGC-1␣ expression plasmids (A–D) and CD36 promoter-reporter and PPAR␥ expression plasmids (A), MCAD promoter-reporter and PPAR␣ expression plasmids (B), PCK1 promoter-reporter and HNF4␣ expression plasmids (C), or SREBP-1c gene promoter reporter and LXR␣ expression plasmids (D). Ligands added included 1 ␮M troglitazone (A), 10 ␮M WY14643 (B), and 10 ␮M 22(R)-hydroxycholesterol, and 10 ␮M 9-cis-retinoic acid (D), respectively. Results are means ⫾ S.D. Prom-LUC, promoter-luciferase; n.s., not significant. Columns (error bars) are means (S.D.).

atic 5⬘-end analysis of the human transcriptome using the cap analysis of gene expression approach showed that 58% of human protein-coding transcriptional units had one or more alternative promoters (50). We show here that an alternative promoter of PGC-1␣ is used in human liver to produce a novel transcript that encodes a biologically active protein, termed L-PGC-1␣. The structure of the novel transcript was deduced from data obtained by several complementary methods. Transcriptional start sites identified by RLM-RACE were consistent with predictive promoter algorithms, results from Northern blots, and the demonstration of promoter activity in the immediate upstream region. Wild-type and liver-specific transcripts can be initiated from two adjacent sites in TATA-less promoters. The novel exon 1L is spliced to the regular acceptor site of exon 3 and contains wild-type exons 3–13 in a regular order. Apart from liver, exon 1L is transcribed in testis albeit at a lower level. However, exon 1L-containing transcripts in testis may differ from the respective liver transcripts as NCBI dbEST entry BX105309 indicates another exon upstream of exon 1L. Testis and brain express the largest amount of variant transcripts (51). Although exon 1L is not expressed in human brain, we identified two major variant brain transcripts initiated from promoters distinct from the liver-specific promoter.4 Thus, tissue-specific differences in core promoter recognition factors (52) may play a role in PGC-1␣ transcription. L-PGC-1␣ transcripts can undergo alternative 3⬘-splicing. The resulting transcript predicts a protein resembling NT-PGC-1␣ but devoid of the N-terminal activation domain. Whether such a protein that also lacks the mediator binding site is produced by the human liver or whether the respective transcripts have other functions or are targeted to nonsense-mediated mRNA decay (53) remains to be determined. A taxonomic comparison indicated that all main interacting domains of PGC-1␣ are highly conserved across recently diverged mammalian species (16). Although exon 1L is located in an evolutionarily conserved region, L-PGC-1␣ transcript homologues were not detected in livers of several mammals. Thus, L-PGC-1␣ most likely reflects an adaption to more complex pathways in humans. Differentially regulated transcription start sites frequently generate alternative N termini (54). L-PGC-1␣ was predicted to lack 127 amino acids at the N terminus. A protein of the expected size was translated in vitro and detected with specific antibodies in liver and HepG2 cells. The altered structure of L-PGC-1␣ likely results in functional changes defined by retained and deleted domains (Fig. 3F). The activation domain facilitating recruitment of SRC-1 and CREB-binding protein (55) has been mapped to the deleted region. Furthermore, the first of three LXXLL motifs, the nuclear export signals, and the GCN5 interaction site mapped to amino acids 1–97 of PGC-1␣ (56) are deleted in L-PGC-1␣. Thus, wild-type and L-PGC-1␣ may differ in properties related to recruitment of chromatinmodifying factors, intracellular trafficking, coactivation of transcription factors, and possibly degradation and post-transla-


FIGURE 8. L-PGC-1␣ is recruited to PCK1 promoter and physically interacts with HNF4␣. A, chromatin from HEK293 cells transfected with Halo-tagged expression plasmids as indicated was captured using HaloTag resin and analyzed by PCR amplifying a fragment spanning the predicted HNF4␣ binding site in the human PCK1 promoter. B, nuclear extracts from HEK293 cells transfected with Halo-tagged expression plasmids as indicated were subjected to pulldown with HaloTag resin followed by immunoblotting with a monoclonal HNF4␣ antibody. Histone-3 (H3) antibody was used as a loading control for nuclear extracts. WB, Western blot; neg., negative; IP, immunoprecipitation.

tional modifications. PGC-1␣ shares an N-terminal activation domain, an arginine/serine-rich domain, and an RNA binding domain with the other protein family members PGC-1␤ and PGC-related coactivator (17). The homology of L-PGC-1␣ with both of these other proteins is therefore restricted to the C terminus. L-PGC-1␣ is located mainly in the nucleus and therefore likely to be transcriptionally active. To this end, we used human systems to delineate functional differences between PGC-1␣ and L-PGC-1␣. The finding that L-PGC-1␣ coactivated PPAR␥-mediated transcription was not unexpected because the docking surface for PPAR␥ is retained in the hepatic isoform. Furthermore, both proteins coactivated PPAR␣- and HNF4␣-mediated transcriptional activation, but only PGC-1␣ effectively coactivated LXR␣ at the SREBP-1c gene promoter. As the interaction of PGC-1␣ with HNF4␣ is central to hepatic gluconeogenesis, we extended the studies of coactivation of HNF4␣ by L-PGC-1␣ and used ChIP and pulldown assays to demonstrate a direct physical interaction between the two proteins at the PCK1 promoter. In addition, mutational studies suggested that coactivation of HNF4␣ by L-PGC-1␣ requires an intact AF-2 site. The crystal structure of HNF4␣ in a complex with a PGC-1␣ fragment containing all three LXXLL motifs, also termed NR boxes, has been resolved recently (57). Only one of the three LXXLL motifs was bound at the canonical binding pocket. However, the bound LXXLL motif was not a


selected box but represented an averaged structure of more than one NR box. Functional studies showed a main role of NR boxes 2 and 3 in binding and coactivation of HNF4␣. As NR boxes 2 and 3 are retained in L-PGC-1␣, its coactivation of HNF4␣ is plausible. An intact NR box 2 also was necessary for coactivation of LXR␣, but LXR␣ and other NR box 2-dependent NRs such as PPAR␣ and glucocorticoid receptor coactivated by PGC-1␣ differed in that coactivation of the former was not affected by removal of a repressor binding to NR box 3 (30, 31, 58, 59). Small differences in NR binding pockets can create local environments that allow NR-specific recruitment of coactivators (57). Therefore, it is possible that NR box 1 and/or additional factors recruited via the N-terminal region (deleted in L-PGC-1␣) are required for effective coactivation of LXR␣. PGC-1␣ plays a central role in the metabolic adaptions of the liver to fasting. In PGC-1␣-deficient mice, the program of hormone-stimulated gluconeogenesis is defective, whereas constitutively activated gluconeogenesis is maintained (60). Our studies in HepG2 cells suggest that the hormonal changes that increase hepatic PGC-1␣ expression also enhance L-PGC-1␣ expression. Like PGC-1␣ mRNA, L-PGC-1␣ mRNA increased in response to glucocorticoids and CREB signaling. As suggested by the promoter studies, FOXO1 may play an even greater role in L-PGC-1␣ than in PGC-1␣ transcription. Furthermore, the coactivation of PCK1 transcription and the strong correlation with PCK1 transcripts also argue for a role of VOLUME 286 • NUMBER 50 • DECEMBER 16, 2011


FIGURE 9. Physical and functional interactions between L-PGC-1␣ and HNF4␣ depend on intact AF-2 domain in HNF4␣. A, HepG2 cells were cotransfected with PCK1 promoter-luciferase reporter constructs and HNF4␣ or mutHNF4␣ expression constructs with or without L-PGC-1␣ expression constructs. Columns (error bars) are means (S.D.). -Fold induction is relative to promoter activity in cells transfected solely with the promoter-luciferase constructs. B, HEK293 chromatin from cells transfected with Halo-tagged L-PGC-1␣ and HNF4␣ or mutHNF4␣ expression constructs was isolated by HaloTag resin. Captured DNA was analyzed by amplifying the predicted HNF4␣ binding site in the human PCK1 promoter by PCR. Prom-LUC, promoter-luciferase.


REFERENCES 1. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M., and Spiegelman, B. M. (1998) Cell 92, 829 – 839 2. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R. C., and Spiegelman, B. M. (1999) Cell 98, 115–124 3. Lin, J., Wu, H., Tarr, P. T., Zhang, C. Y., Wu, Z., Boss, O., Michael, L. F., Puigserver, P., Isotani, E., Olson, E. N., Lowell, B. B., Bassel-Duby, R., and Spiegelman, B. M. (2002) Nature 418, 797– 801 4. Handschin, C., Kobayashi, Y. M., Chin, S., Seale, P., Campbell, K. P., and Spiegelman, B. M. (2007) Genes Dev. 21, 770 –783 5. Arany, Z., Foo, S. Y., Ma, Y., Ruas, J. L., Bommi-Reddy, A., Girnun, G., Cooper, M., Laznik, D., Chinsomboon, J., Rangwala, S. M., Baek, K. H., Rosenzweig, A., and Spiegelman, B. M. (2008) Nature 451, 1008 –1012 6. Chinsomboon, J., Ruas, J., Gupta, R. K., Thom, R., Shoag, J., Rowe, G. C., Sawada, N., Raghuram, S., and Arany, Z. (2009) Proc. Natl. Acad. Sci. U.S.A. 106, 21401–21406 7. Herzig, S., Long, F., Jhala, U. S., Hedrick, S., Quinn, R., Bauer, A., Rudolph, D., Schutz, G., Yoon, C., Puigserver, P., Spiegelman, B., and Montminy, M. (2001) Nature 413, 179 –183 8. Puigserver, P., Rhee, J., Donovan, J., Walkey, C. J., Yoon, J. C., Oriente, F., Kitamura, Y., Altomonte, J., Dong, H., Accili, D., and Spiegelman, B. M. (2003) Nature 423, 550 –555 9. Yoon, J. C., Puigserver, P., Chen, G., Donovan, J., Wu, Z., Rhee, J., Adelmant, G., Stafford, J., Kahn, C. R., Granner, D. K., Newgard, C. B., and Spiegelman, B. M. (2001) Nature 413, 131–138 10. Vega, R. B., Huss, J. M., and Kelly, D. P. (2000) Mol. Cell. Biol. 20, 1868 –1876 11. Liu, C., Li, S., Liu, T., Borjigin, J., and Lin, J. D. (2007) Nature 447, 477– 481 12. St-Pierre, J., Drori, S., Uldry, M., Silvaggi, J. M., Rhee, J., Jäger, S., Handschin, C., Zheng, K., Lin, J., Yang, W., Simon, D. K., Bachoo, R., and Spiegelman, B. M. (2006) Cell 127, 397– 408 13. Valle, I., Alvarez-Barrientos, A., Arza, E., Lamas, S., and Monsalve, M. (2005) Cardiovasc. Res. 66, 562–573 14. Finck, B. N., and Kelly, D. P. (2006) J. Clin. Investig. 116, 615– 622 15. Handschin, C., and Spiegelman, B. M. (2006) Endocr. Rev. 27, 728 –735 16. Soyal, S., Krempler, F., Oberkofler, H., and Patsch, W. (2006) Diabetologia 49, 1477–1488 17. Lin, J., Handschin, C., and Spiegelman, B. M. (2005) Cell Metab. 1,


361–370 18. Spiegelman, B. M., and Heinrich, R. (2004) Cell 119, 157–167 19. Chang, J. S., Huypens, P., Zhang, Y., Black, C., Kralli, A., and Gettys, T. W. (2010) J. Biol. Chem. 285, 18039 –18050 20. Baar, K., Wende, A. R., Jones, T. E., Marison, M., Nolte, L. A., Chen, M., Kelly, D. P., and Holloszy, J. O. (2002) FASEB J. 16, 1879 –1886 21. Miura, S., Kai, Y., Kamei, Y., and Ezaki, O. (2008) Endocrinology 149, 4527– 4533 22. Zhang, Y., Huypens, P., Adamson, A. W., Chang, J. S., Henagan, T. M., Boudreau, A., Lenard, N. R., Burk, D., Klein, J., Perwitz, N., Shin, J., Fasshauer, M., Kralli, A., and Gettys, T. W. (2009) J. Biol. Chem. 284, 32813–32826 23. Mootha, V. K., Lindgren, C. M., Eriksson, K. F., Subramanian, A., Sihag, S., Lehar, J., Puigserver, P., Carlsson, E., Ridderstråle, M., Laurila, E., Houstis, N., Daly, M. J., Patterson, N., Mesirov, J. P., Golub, T. R., Tamayo, P., Spiegelman, B., Lander, E. S., Hirschhorn, J. N., Altshuler, D., and Groop, L. C. (2003) Nat. Genet. 34, 267–273 24. Patti, M. E., Butte, A. J., Crunkhorn, S., Cusi, K., Berria, R., Kashyap, S., Miyazaki, Y., Kohane, I., Costello, M., Saccone, R., Landaker, E. J., Goldfine, A. B., Mun, E., DeFronzo, R., Finlayson, J., Kahn, C. R., and Mandarino, L. J. (2003) Proc. Natl. Acad. Sci. U.S.A. 100, 8466 – 8471 25. Oberkofler, H., Linnemayr, V., Weitgasser, R., Klein, K., Xie, M., Iglseder, B., Krempler, F., Paulweber, B., and Patsch, W. (2004) Diabetes 53, 1385–1393 26. Cui, L., Jeong, H., Borovecki, F., Parkhurst, C. N., Tanese, N., and Krainc, D. (2006) Cell 127, 59 – 69 27. Weydt, P., Pineda, V. V., Torrence, A. E., Libby, R. T., Satterfield, T. F., Lazarowski, E. R., Gilbert, M. L., Morton, G. J., Bammler, T. K., Strand, A. D., Cui, L., Beyer, R. P., Easley, C. N., Smith, A. C., Krainc, D., Luquet, S., Sweet, I. R., Schwartz, M. W., and La Spada, A. R. (2006) Cell Metab. 4, 349 –362 28. Weydt, P., Soyal, S. M., Gellera, C., Didonato, S., Weidinger, C., Oberkofler, H., Landwehrmeyer, G. B., and Patsch, W. (2009) Mol. Neurodegener. 4, 3 29. Felder, T. K., Hahne, P., Soyal, S. M., Miller, K., Höffinger, H., Oberkofler, H., Krempler, F., and Patsch, W. (2010) Int. J. Obes. 34, 846 – 851 30. Oberkofler, H., Schraml, E., Krempler, F., and Patsch, W. (2003) Biochem. J. 371, 89 –96 31. Oberkofler, H., Esterbauer, H., Linnemayr, V., Strosberg, A. D., Krempler, F., and Patsch, W. (2002) J. Biol. Chem. 277, 16750 –16757 32. Oberkofler, H., Hafner, M., Felder, T., Krempler, F., and Patsch, W. (2009) J. Mol. Med. 87, 299 –306 33. Felder, T. K., Klein, K., Patsch, W., and Oberkofler, H. (2005) Biochim. Biophys. Acta 1731, 41– 47 34. Hartl, A., Weiss, R., Hochreiter, R., Scheiblhofer, S., and Thalhamer, J. (2004) Methods 32, 328 –339 35. Maruyama, K., and Sugano, S. (1994) Gene 138, 171–174 36. Esterbauer, H., Schneitler, C., Oberkofler, H., Ebenbichler, C., Paulweber, B., Sandhofer, F., Ladurner, G., Hell, E., Strosberg, A. D., Patsch, J. R., Krempler, F., and Patsch, W. (2001) Nat. Genet. 28, 178 –183 37. Esterbauer, H., Oberkofler, H., Krempler, F., and Patsch, W. (1999) Genomics 62, 98 –102 38. Hahne, P., Krempler, F., Schaap, F. G., Soyal, S. M., Höffinger, H., Miller, K., Oberkofler, H., Strobl, W., and Patsch, W. (2008) J. Intern. Med. 264, 452– 462 39. Yamagata, K., Daitoku, H., Shimamoto, Y., Matsuzaki, H., Hirota, K., Ishida, J., and Fukamizu, A. (2004) J. Biol. Chem. 279, 23158 –23165 40. Leitner, W. W., Seguin, M. C., Ballou, W. R., Seitz, J. P., Schultz, A. M., Sheehy, M. J., and Lyon, J. A. (1997) J. Immunol. 159, 6112– 6119 41. Messeguer, X., Escudero, R., Farré, D., Núñez, O., Martínez, J., and Albà, M. M. (2002) Bioinformatics 18, 333–334 42. Loots, G. G., and Ovcharenko, I. (2004) Nucleic Acids Res. 32, W217–W221 43. Kakuma, T., Wang, Z. W., Pan, W., Unger, R. H., and Zhou, Y. T. (2000) Endocrinology 141, 4576 – 4582 44. Zhou, J., Febbraio, M., Wada, T., Zhai, Y., Kuruba, R., He, J., Lee, J. H., Khadem, S., Ren, S., Li, S., Silverstein, R. L., and Xie, W. (2008) Gastroenterology 134, 556 –567


42935


L-PGC-1␣ in gluconeogenesis. Studies in mice have shown that acetylation of PGC-1␣ by GCN5 represses its ability to induce gluconeogenic gene expression (56), whereas deacetylation by SIRT1 enhances its activity on gluconeogenic genes (61). As the binding site for GCN5 is most likely deleted in L-PGC-1␣, it is intriguing to speculate that the regulation of its functional activity is not or is less dependent on deacetylation by SIRT1. Like PGC-1␣, L-PGC-1␣ coactivated PPAR␣-mediated transcription. As PPAR␣ trans-activated the L-PGC-1␣ promoter, a feed forward loop may be created that enhances fatty acid oxidation, thereby supporting hepatic ATP production in the fasting state. In conclusion, we have identified an alternative PGC-1␣ transcript that appears to be specific for human liver and encodes a functional protein that lacks 127 amino acids at the N terminus. In vivo correlations between L-PGC-1␣ transcript levels and hepatic mRNA levels encoding distinct transcription factors together with our trans-activation studies in HepG2 cells suggest overlapping transcriptional networks regulating the expression of L-PGC-1␣, PGC-1␣, and their downstream targets. Collectively, our data suggest a role of L-PGC-1␣ in hepatic gluconeogenesis, but further studies are needed to rationalize differences in regulation and function between PGC-1␣ and L-PGC-1␣.



U.S.A. 100, 189 –192 54. Sandelin, A., Carninci, P., Lenhard, B., Ponjavic, J., Hayashizaki, Y., and Hume, D. A. (2007) Nat. Rev. Genet. 8, 424 – 436 55. Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O’Malley, B., and Spiegelman, B. M. (1999) Science 286, 1368 –1371 56. Lerin, C., Rodgers, J. T., Kalume, D. E., Kim, S. H., Pandey, A., and Puigserver, P. (2006) Cell Metab. 3, 429 – 438 57. Rha, G. B., Wu, G., Shoelson, S. E., and Chi, Y. I. (2009) J. Biol. Chem. 284, 35165–35176 58. Knutti, D., Kressler, D., and Kralli, A. (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 9713–9718 59. Fan, M., Rhee, J., St-Pierre, J., Handschin, C., Puigserver, P., Lin, J., Jäeger, S., Erdjument-Bromage, H., Tempst, P., and Spiegelman, B. M. (2004) Genes Dev. 18, 278 –289 60. Lin, J., Wu, P. H., Tarr, P. T., Lindenberg, K. S., St-Pierre, J., Zhang, C. Y., Mootha, V. K., Jäger, S., Vianna, C. R., Reznick, R. M., Cui, L., Manieri, M., Donovan, M. X., Wu, Z., Cooper, M. P., Fan, M. C., Rohas, L. M., Zavacki, A. M., Cinti, S., Shulman, G. I., Lowell, B. B., Krainc, D., and Spiegelman, B. M. (2004) Cell 119, 121–135 61. Rodgers, J. T., Lerin, C., Haas, W., Gygi, S. P., Spiegelman, B. M., and Puigserver, P. (2005) Nature 434, 113–118 62. Crooks, G. E., Hon, G., Chandonia, J. M., and Brenner, S. E. (2004) Genome Res. 14, 1188 –1190

VOLUME 286 • NUMBER 50 • DECEMBER 16, 2011


45. Gulick, T., Cresci, S., Caira, T., Moore, D. D., and Kelly, D. P. (1994) Proc. Natl. Acad. Sci. U.S.A. 91, 11012–11016 46. Rhee, J., Inoue, Y., Yoon, J. C., Puigserver, P., Fan, M., Gonzalez, F. J., and Spiegelman, B. M. (2003) Proc. Natl. Acad. Sci. U.S.A. 100, 4012– 4017 47. Knutti, D., Kaul, A., and Kralli, A. (2000) Mol. Cell. Biol. 20, 2411–2422 48. Tcherepanova, I., Puigserver, P., Norris, J. D., Spiegelman, B. M., and McDonnell, D. P. (2000) J. Biol. Chem. 275, 16302–16308 49. Iyemere, V. P., Davies, N. H., and Brownlee, G. G. (1998) Nucleic Acids Res. 26, 2098 –2104 50. Carninci, P., Sandelin, A., Lenhard, B., Katayama, S., Shimokawa, K., Ponjavic, J., Semple, C. A., Taylor, M. S., Engström, P. G., Frith, M. C., Forrest, A. R., Alkema, W. B., Tan, S. L., Plessy, C., Kodzius, R., Ravasi, T., Kasukawa, T., Fukuda, S., Kanamori-Katayama, M., Kitazume, Y., Kawaji, H., Kai, C., Nakamura, M., Konno, H., Nakano, K., Mottagui-Tabar, S., Arner, P., Chesi, A., Gustincich, S., Persichetti, F., Suzuki, H., Grimmond, S. M., Wells, C. A., Orlando, V., Wahlestedt, C., Liu, E. T., Harbers, M., Kawai, J., Bajic, V. B., Hume, D. A., and Hayashizaki, Y. (2006) Nat. Genet. 38, 626 – 635 51. Grosso, A. R., Gomes, A. Q., Barbosa-Morais, N. L., Caldeira, S., Thorne, N. P., Grech, G., von Lindern, M., and Carmo-Fonseca, M. (2008) Nucleic Acids Res. 36, 4823– 4832 52. Goodrich, J. A., and Tjian, R. (2010) Nat. Rev. Genet. 11, 549 –558 53. Lewis, B. P., Green, R. E., and Brenner, S. E. (2003) Proc. Natl. Acad. Sci.

SUPPLEMENTAL DATA

Figure S1. Exon 1L sequence.

Figure S2. Characterization of L-PGC-1α and exon 1L initiated splice variant.

Table S1 Oligonucleotides used for RACE analyses, plasmid generation and mutagenesis

SUPPLEMENTAL FIGURE LEGENDS FIGURE S1. Exon 1L sequence. Comparison of human exon 1L sequence with respective genomic sequences from monkey, dog, mouse and rat; transcription start sites (TS1 and TS2) of L-PGC-1α are indicated. FIGURE S2. Characterization of L-PGC-1α and exon 1L initiated splice variant. (A,B) RPA using total tissue or HepG2 RNA and probes extending from exon 1L to exon 7 (A) or exon 2 to exon 7 (B). Fragments protected by respective probes are shown below the autoradiographs; M, molecular size marker. (C) Human cDNA obtained from liver or brain mRNA was used as template for semiquantitative PCR reactions using primers located in exon 1L and exon 7 in the presence of α-32PdCTP.18 cycles were performed to restrict amplicon generation to the logarithmic phase; nc, negative control; pc1 and pc2, positive controls using plasmids encoding NT-L-PGC1 and L-PGC-1 as templates.

Figure S1

Figure S2

Sequence forward 5’-3’ * Sequence reverse 5’-3’ * GCTGATGGCGATGAATGAACACTG GGGTACTGAGACCACTGCATTCATT CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG AACTTAGCTGAGTGTTGGCTGGTG GCTGATGGCGATGAATGAACACTG ACTGCTAGCAAGTTTGCCTCATT CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG GACGAATGAATGAAAGATGCCCAT CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG GTCACTGCACCACTTGAGTCCACC GTTTGGTCATTGCTGGAAC GTTCCAGCAATGACCAAACATGA TGCTGCTCTGGTTGGTGAAGACCAGC GCGTTCAATAGTCTTGTTCTCAAATGG GCCTTTGCTGATGGGGGGAGAAGG GCGTTCAATAGTCTTGTTCTCAAATGG GAAGCCTGAAACTGTGAACTTTGT GCGTTCAATAGTCTTGTTCTCAAATGG TGAGTCTGTATGGAGTGACATCGAGTG TTACCTGCGCAAGCTTCTCTGAGC TGGGGTTCGTTAGAATGATGGC TTACCTGCGCAAGCTTCTCTGAGC AAAGCAAAAGGCTCAGAGGTAACAG TCAAATGAGGGCAATCCGTC CCTTTCTGAACTTGATGTGAATGACTTG AATGAGGGCAATCCGTCTTCATCCA GGTAGCAAGATTTATGTTT AATGAGGGCAATCCGTCTTCATCCAC CGGGATGATGGAGACAGC GGTGGAAGCAGGGTCAAA

Plasmid

Purpose; restriction sites

-

5' RACE Outer rxn exon 4

-

5' RACE Inner rxn exon 4

-

5' RACE Outer rxn exon 3

-

5' RACE Inner rxn exon 1L

-

5' RACE Inner rxn exon 2

pRPA_1L-3

RPA probe 1L-3

pRPA_2-7

RPA and Northern probe 2-7

pRPA_1L-7

RPA probe1L-7

-

PCR exon 7a

-

PCR exon 1-13

-

PCR exon 1L-13

pNorth_1L-3

Northern probe 1L

pRPA_m2-3

Murine RPA probe

-

ECR species

-

ECR universal exon 13

GAGAGGATCCATGCCTGACGGCACCCCTCCACCCCAGG GAGACTCGAGCCTGCGCAAGCTTCTCTGAG GAGAGCATGCATGCCTGACGGCACCCCTCCACCCCAGG GAGAACGCGTCCTGCGCAAGCTTCTCTGAGCTTCTTTCA GAGAGGTACCATGCCTGACGGCACCCCTCCACCCCAGG GAGAGGATCCCCCCTGCGCAAGCTTCTCTGAGCTTCTTTC GAGAGGTACCATGGCGTGGGACATGTGCAACCAGGACTCT GAGAGGATCCCCCCTGCGCAAGCTTCTCTGAGCTTCTTTC GAGACTCGAGCAAACATATTTGAGGTAAGGACATC GAGAAAGCTTGCTGTTACCTCTGAGCCTTTTGC GAATGCGACTCTCCAAAACCCT CAGCGGCTTGCTAGATAACTTCCTG GAGAACGCGTCATTTTGACAAGGGACAGTTGCGGGG GAGACTCGAGCCAGCAAGTTTGTGTTCCCAGTGGGA TGAGTAACTGGACACGCAAAGAATGTTCTCTGCTTACGCAACC GGTTGCGTAAGCAGAGAACATTCTTTGCGTGTCCAGTTACTCA GAGAGGTACCAAATATGGTGGGTGCATAGTCTTTA GAGACTCGAG ATACAGTAGTGTCACCTCCCGTCAT GAGAGGTACCAAGTTGCTAGCCAATCAGGACAAGT GAGACTCGAGGAACGGTGGGGGGACTTGCGGCGCGG CCTGACTCAAGTAGCTGGTCAATGACACCACTGGA TCCAGTGGTGTCATTGACCAGCTACTTGAGTCAGG GTAACTGGACACGCAAACAATGACCTCTGCTTACGCAACCTGTGTT AACACAGGTTGCGTAAGCAGAGGTCATTGTTTGCGTGTCCAGTTAC CAAGGTTGGTGAGCAATGAACCATT CATCCAGCTCCTGAATGACGCCAGT GAGAGGATCCATGGTGGACACGGAAAGCCCACTCTGCCCC GAGAGCGGCCGCTCAGTACATGTCCCTGTAGATCTCCTGCAG GAGAGGTACCATGACCATGGTTGACACAGAGATGCCATTC GAGACTCGAGCTAGTACAAGTCCTTGTAGATCTCCTGCAG ACAACCTGTTGCAGGAGATGGCGGCGGGAGGGTCCCCCAGCGATG CATCGCTGGGGGACCCTCCCGCCGCCATCTCCTGCAACAGGTTGT GAGAGATATCATGCCTGACGGCACCCCTCCACCCCAGG

pL-PGC-1

Expr. plasmid; BamHI / XhoI

pCI_TPA_Art_Tet_LPGC-1

DNA vaccination; SphI / MluI

pL-PGC-1 _GFP

C-term. eGFP fusion; KpnI / BamHI

pPGC-1 _GFP

C-term. eGFP fusion; KpnI / BamHI

pLPGC-1 Prom(3518)_Luc

Promoter reporter; XhoI / HindIII

pHNF4

Expr. Plasmid, blunt

pPCK-Prom_Luc

Promoter reporter; MluI /XhoI

pL-PGC-1 2PromMUT-Luc

Mutated FOXO1 binding site

pCD36-Prom_Luc

Promoter reporter; KpnI / XhoI

pMCAD-Prom_Luc

Promoter reporter; KpnI / XhoI

pL-PGC-1 PromMUT_CREB_Luc pL-PGC-1 PromMUT_GRE_Luc pPGC-1αProm(2647)_Luc

Mutated CREB1 binding site Mutated GR binding site Promoter reporter; blunt

pPPAR

Expr. plasmid; BamHI / NotI

pPPAR

Expr. plasmid; BamHI / XhoI

pmutHNF4α pL-PGC-1α-HALO

Mutated AF2 domain in HNF4α and pmutHNF4α-HALO Expr. plasmid; EcoRV / XhoI

GAGACTCGAG CCTGCGCAAGCTTCTCTGAGCTTCTTTC GAGAGATATC ATGGCGTGGGACATGTGCAACCAGGACT GAGACTCGAG CCTGCGCAAGCTTCTCTGAGCTTCTTTC GAGAGAATTC ATGCGACTCTCCAAAACCCTCGTCGACA GAGATCTAGA GATAACTTCCTGCTTGGTGATGGTCGGC GTGATTAGCCCCCAGTTAGGTTAGG AGCAGCACATTTTGTGTACCAAGAG

pPGC-1α-HALO

Expr. plasmid; EcoRV / XhoI

pHNF4α-HALO

Expr. plasmid; EcoRI / XbaI

-

Chip, HNF4α binding site in PCK1 promoter (-497 to –320)

Table S1 Oligonucleotides used for RACE analyses, plasmid generation and mutagenesis; * restriction sites underlined, FOXO1, CREB1, GR and HNF4 binding site bold, mutagenesis site bold and underlined.

Characterization of Novel Peroxisome Proliferator-activated Receptor γ Coactivator-1 α (PGC-1α) Isoform in Human Liver Thomas K. Felder, Selma M. Soyal, Hannes Oberkofler, Penelope Hahne, Simon Auer, Richard Weiss, Gabriele Gadermaier, Karl Miller, Franz Krempler, Harald Esterbauer and Wolfgang Patsch J. Biol. Chem. 2011, 286:42923-42936. doi: 10.1074/jbc.M111.227496 originally published online October 18, 2011

Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts

Supplemental material: http://www.jbc.org/content/suppl/2011/10/18/M111.227496.DC1.html This article cites 62 references, 26 of which can be accessed free at http://www.jbc.org/content/286/50/42923.full.html#ref-list-1


Access the most updated version of this article at doi: 10.1074/jbc.M111.227496