Characterization of transposon Tn1549, conferring VanB ... - CiteSeerX

Microbiology (2000), 146, 1481–1489

Printed in Great Britain

Characterization of transposon Tn1549, conferring VanB-type resistance in Enterococcus spp. Fabien Garnier,1 Sead Taourit,2 Philippe Glaser,2 Patrice Courvalin1 and Marc Galimand1 Author for correspondence : Marc Galimand. Tel : j33 1 45 68 83 18. Fax : j33 1 45 68 83 19. e-mail : galimand!pasteur.fr Unite! des Agents Antibacte! riens1 and Laboratoire de Ge! nomique des Micro-organismes Pathoge' nes2, Institut Pasteur, 75724 Paris Cedex 15, France

Transfer of VanB-type resistance to glycopeptides among enterococci has been reported to be associated with the movement of large chromosomal genetic elements or of plasmids. The authors report the characterization of the 34 kb transposon Tn1549 borne by a plasmid related to pAD1 and conferring vancomycin resistance in clinical isolates of Enterococcus spp. Tn1549 contained 30 ORFs and appeared to be organized like the Tn916 family of conjugative transposons into three functional regions : (i) the right end, implicated in the excision–integration process ; (ii) the central part, in which the vanB2 operon replaces the tet(M) gene ; and (iii) the left extremity, in which eight of the 18 ORFs could be implicated in the conjugative transfer.

Keywords : Tn1549, glycopeptide resistance, VanB phenotype

INTRODUCTION

Enterococci are opportunistic pathogens responsible for a wide variety of infections such as endocarditis, urinary and genital tract infections, meningitis, septicaemia and neonatal sepsis (Murray, 1990). These micro-organisms represent the third most common cause of hospitalacquired bacteraemia. Of the 20 enterococcal species described to date (Devriese et al., 1993), Enterococcus faecalis and E. faecium represent about 90 % of the clinical isolates belonging to this genus. Enterococci are increasingly resistant to a number of antimicrobial agents, including ampicillin, high levels of aminoglycosides and more recently glycopeptides (Murray, 1990). Glycopeptides inhibit peptidoglycan synthesis by binding to the C-terminal dipeptide -alanyl--alanine of the pentapeptide precursor, blocking polymerization of peptidoglycan (Reynolds, 1989). Resistance to vancomycin and teicoplanin is due to incorporation of alanyl--lactate (VanA-, VanB- and VanD-type) or of -alanyl--serine (VanC- and VanE-type) into peptidoglycan precursors that have reduced affinity for glycopeptides (Arthur et al., 1996 ; Pe! richon et al., 1997 ; Fines et al., 1999). .................................................................................................................................................

The GenBank accession number for the 33 803 bp sequence of Tn1549 is AJ192329. 0002-4032 # 2000 SGM

Transfer of antimicrobial resistance determinants among enterococci may occur via transposons or plasmids. The enterococcal conjugative transposons, of which Tn916 and Tn1545 have been the most intensively studied, range in size from 16 kb to more than 50 kb and usually confer tetracycline resistance (Clewell et al., 1995). Insertion of transposons into self-transferable plasmids, such as pheromone plasmids pAD1 or pCF10 (Clewell, 1993), is also an important mechanism for the dissemination of resistance genes among enterococci. The vanB operon has been described in most cases as part of large conjugative elements integrated into the host chromosome (Quintiliani & Courvalin, 1994). These elements were found to contain transposons conferring resistance to vancomycin, such as Tn1547 (Quintiliani & Courvalin, 1996) or Tn5382 (Carias et al., 1998). Vancomycin-resistant E. faecalis E93\268 and E. faecium 654 were isolated in 1994 in the United Kingdom. Resistance in these strains was associated with the presence of the vanB gene, borne by conjugative plasmids (Woodford et al., 1995a, b). Here we report the characterization of the 34 kb transposon Tn1549 responsible for vancomycin resistance. METHODS Strains, plasmids and growth conditions. The bacterial strains and plasmids used are described in Table 1. Enterococcus faecalis E93\268, isolated from a blood culture at

1481

F. G A R N I E R a n d O T H E R S

Table 1. Strains and plasmids used in this study Strain/plasmid E. faecalis strains JH2-2 BM4110 268-10 654-6 Plasmids pUC18 pCR2.1 pAT771

pAT772 pAT773 pAT774 pAT775 pAT776 pAT777

Relevant properties*

Reference or origin

FusR RifR derivative of JH2 StrR derivative of JH2 Conjugation of E. faecalis E93\268 with JH22, pIP834, FusR RifR VmR GmR Conjugation of E. faecium 654 with JH2-2, pIP835, FusR RifR VmR ApR plasmid vector ApR KmR plasmid vector pUC18 with a 5n16 kb SspI insert (vanYB∆ vanWHBBXB orf7-Tn orf8-Tn xis-Tn∆) of pIP834 pCR2.1 with a 1n4 kb PCR fragment (xis-Tn∆ int-Tn∆) of pIP834 pUC18 with a 2n2 kb Sau3AI insert (int-Tn∆ traE1∆ orfy sea1∆) of pIP834 pCR2.1 with a 250 bp PCR fragment (traE1∆, left inverted repeat sequence) of pIP834 pCR2.1 with a 309 bp PCR fragment of the joined extremities of Tn1549 pCR2.1 with a 900 bp PCR fragment (upstream from vanRB) of pIP834 pUC18 with a 654 bp TaqI insert (int-Tn∆ uvrB∆) of pIP835

Jacob & Hobbs (1974) Courvalin & Carlier (1986) Woodford et al. (1995a) Woodford et al. (1995b)

Vieira & Messing (1982) Invitrogen This study

This study This study This study This study This study This study

* ApR, ampicillin resistance ; FusR, fucidic acid resistance ; GmR, gentamicin resistance ; KmR, kanamycin resistance ; RifR, rifampin resistance ; StrR, streptomycin resistance ; VmR, vancomycin resistance ; ∆, partial gene.

Addenbrooke’s Hospital in Cambridge, UK, was resistant to high concentrations of gentamicin (MIC 2000 mg l−") and expressed the VanB phenotype, i.e. resistance to vancomycin (MIC 32 mg l−") and susceptibility to teicoplanin (MIC 1 mg l−") (Woodford et al., 1995a). E. faecium 654 was isolated in the renal unit of the Queen Elizabeth Hospital in Birmingham, UK, and is also of the VanB type (Woodford et al., 1995b). E. faecalis strains 268-10 and 654-6, obtained by conjugation of E. faecalis E93\268 and E. faecium 654, respectively, with E. faecalis JH2-2 (Jacob & Hobbs, 1974) were kindly provided by N. Woodford (Central Public Health Laboratory, London UK). The corresponding resistance genes are respectively borne by plasmids pIP834 and pIP835, of approximatively 80–90 kb in size. Vancomycin resistance was retransferred from E. faecalis 268-10 and E. faecalis 654-6 to E. faecalis BM4110 (Courvalin & Carlier, 1986) by filter matings with selection on streptomycin (500 mg l−") and vancomycin (10 mg l−"). Transfer frequencies are expressed as the number of transconjugants per donor colony-forming unit after the mating period. All strains were grown at 37 mC in brain heart infusion broth and agar (Difco). PCR amplification. Amplification of DNA was performed in a 2400 thermal cycler (Perkin-Elmer Cetus) with Taq DNA polymerase (Amersham) as recommended by the manufacturer. The long PCR was carried out on plasmid DNA with the XL PCR kit from Perkin Elmer, with the following conditions : 94 mC for 1 min for the first cycle ; 94 mC for 15 s, 1482

68 mC for 10 min for 16 cycles ; 94 mC for 15 s, 68 mC for 10 min with an increment of 15 s per cycle for the next 12 cycles ; and 72 mC for 10 min for the last cycle. Recombinant DNA techniques. DNA isolation, cleavage of DNA with restriction endonucleases (Amersham), purification of DNA fragments from agarose gel, dephosphorylation of vector DNA with calf intestine phosphatase and ligation with T4 DNA ligase (Boehringer Mannheim) were performed by standard methods (Ausubel et al., 1992). Gene internal fragments used as probes were labelled with [α-$#P]ATP (Amersham) by nick translation using a commercially available kit (Amersham). With Escherichia coli strains JM83 (Yanisch-Perron et al., 1985) and INVαFh (Invitrogen), the following antibiotics were used : ampicillin (100 mg l−") for cloning restriction fragments into pUC18 (Vieira & Messing, 1982) and kanamycin (50 mg l−") for cloning PCR products into pCR2.1 (Invitrogen). Plasmid construction. The plasmids were constructed as

follows (Fig. 1). Plasmid DNA from 268-10 was digested with various endonucleases and the size of the fragments hybridizing with a vanXB internal probe (Fig. 1b) was estimated (Sambrook et al., 1989). Cloning was performed with restriction endonucleases generating fragments more than 1 kb long. The recombinant plasmids were screened for by colony hybridization with the same probe (Sambrook et al., 1989) ;

pAT771.

Characterization of Tn1549

.................................................................................................................................................................................................................................................................................................................

Fig. 1. Organization of Tn1549 from E. faecalis 268-10. Schematic representation of (a) the left part, and (b) the vanB operon and the right end of the transposon. Open arrows represent ORFs. The primers used for amplification are indicated by thin half-arrows. The length of the PCR products in bp is indicated in bold. Putative terminator sequences are represented by . Plasmids used for cloning and sequencing are indicated below the maps. Relevant endonuclease restriction sites and fragments internal to vanRB, vanXB and int-VB used as probes are indicated above the maps. The imperfect inverted repeats (IRL and IRR) at the ends of the transposon are indicated by filled arrows.

plasmid pAT771, selected for further studies, contained a 5n2 kb SspI insert. pAT772. To amplify a fragment internal to the xis-Tn1549 and int-Tn1549 genes, two primers, T1 and T2 (Table 2, Fig. 1b), were designed from the sequence of xis-VB and int-VB from Tn5382 (Carias et al., 1998) and used with plasmid DNA from strain 268-10 as a template. A PCR product with the 1n4 kb expected size was obtained and cloned into pCR2.1.

A strategy similar to that used for construction of pAT771 was followed to clone the right end of Tn1549. A fragment internal to int-Tn1549 (Fig. 1b) was used as a probe. Plasmid pAT773 consisted of a 2n2 kb Sau3AI insert of plasmid DNA from strain 268-10 cloned into pUC18. pAT773.

To amplify the left junction fragment, two primers, TnOUT and P1 (Table 2, Fig. 1a), were designed from the sequence of Tn5382 (Carias et al., 1998) and of the traE1 gene (GenBank accession no. M87836) of pAD1, respectively. These primers used with plasmid DNA from strain 268-10 as a template yielded a product with the 250 bp expected size, which was cloned into pCR2.1.

pAT774.

pAT775. Amplification of the joined extremities of the Tn1549 circular intermediate was obtained by nested PCR (Manganelli et al., 1995). Primers T3 and T4 (Table 2, Fig. 1) were used with total DNA from strain 268-10 as a template in a first PCR and the product obtained was used as a template in the second PCR using primers TnOUT and TnVAN OUT (Table 2, Fig. 1). The 309 bp amplification product was cloned into pCR2.1. pAT776. The region upstream from the vanR gene was B obtained by inverted PCR (Triglia et al., 1988) using primers VB15 and VB36 (Table 2, Fig. 1b) (Evers, 1995) and plasmid DNA from strain 268-10 digested by SspI as a template. The 900 bp PCR product obtained was cloned into pCR2.1. pAT777. A strategy similar to that used for construction of pAT773 was followed to clone the right end of Tn1549 from strain 654-6. A fragment internal to int-Tn1549 (Fig. 1b) was used as a probe. Plasmid pAT777 consisted of a 650 bp TaqI insert of pIP835 DNA from strain 654-6 cloned into pUC18.

Nucleotide sequencing. The inserts in the recombinant plasmids were sequenced by the dideoxynucleotide chaintermination method (Sanger et al., 1977) using universal or

1483


Table 2. Oligonucleotides used in this study Oligonucleotide* VB15 (j) VB36 (k) T1 (j) T2 (k) T3 (j) T4 (k) TnOUT (k) TnVAN OUT (j) P1 (j) XLI (j) XLII (k)

Sequence (5h–3h)

Localization

Reference

ACTGATTCAGAATAGCG ACCAGTTGATAGGTGTT GAT\CG\ATG\TCCTATTTGGGA TAATAGTTCAGCGTCATGG ACCGCAAAGGTGCAAAG TAGCAGTATGGTTCAGC TCCGAAAGTAAATTGGTAGTA CGATCCCGCAAGGCCAGAAATG ACATGTTGGGTACTACGG TCGCTGAAAGCCCCGGAAATAC CCGCGCAGCAGATTCAGTCCTA

vanSB vanRB xis-Tn1549 int-VB int-Tn1549 Left end of Tn1549 Left end of Tn5382 int-VB traE1 Left end of Tn1549 Upstream from vanRB

Evers (1995) Evers (1995) This study This study This study This study Carias et al. (1998) Carias et al. (1998) This study This study This study

* j, Sense primer ; k, antisense primer.

specific oligodeoxynucleotides as primers, [$&S]dCTPαS (Amersham) and the Sequenase version 2.0 DNA sequencing kit (Amersham Life Science). The sequence of the long-PCR product was determined by the shotgun cloning method (Buchrieser et al., 1999) using an automatic DNA sequencer (model ABI PRISM 377, Perkin Elmer). Computer analysis. The sequence was assembled using the  (Ewing & Green, 1998 ; Ewing et al., 1998) and  (P. Green, unpublished) programs.  (Gordon et al., 1998) was used for the editing. Determination of similarity with known proteins involved interrogation of ,  and  (Altschul et al., 1997) and  (Pearson & Lipman, 1988) from the Genetics Computer Group (GCG) suite of programs.

RESULTS Characterization of the vanB operon

Hybridization experiments indicated that vancomycin resistance in E. faecalis 268-10 and 654-6 was associated with the presence of the vanB gene borne by conjugative plasmids (Woodford et al., 1995a, b) that were designated pIP834 and pIP835, respectively. The retransfer of vancomycin resistance from E. faecalis 268-10 and 6546 to E. faecalis BM4110 was determined and was found to occur at frequencies of 4n4i10−' and 4i10−#, respectively. PCR mapping with primers (VB, Fig. 1b) complementary to the vanB operon from E. faecalis V583 (Evers, 1995) showed that the order of the plasmid-borne vanB gene cluster was identical in the two plasmids and similar to that in the chromosome of strain V583 ; no large insertions or deletions in the noncoding regions were detected. No PCR products were obtained when one of the primers used for amplification was complementary to the region upstream from vanRB or downstream from vanXB. Thus, the genomic environment of the vanB cluster in strains 268-10 and 654-6 differed from that in V583. The complete nucleotide sequence of the vanB operon in pIP834 was determined. The deduced amino acid sequences of VanRB, VanSB, VanYB, VanW, VanHB 1484

and VanXB from pIP834 displayed 96, 96n2, 100, 93, 93n9 and 99 % identity with those of the corresponding proteins from V583. The vanB genes from pIP834 and from pIP835 were identical to each other, and were 96n4 % similar with that of V583 (Evers, 1995) and 99 % similar with vanB2 from E. faecalis SF300 (Gold et al., 1993). Moreover, in the 309 bp region spanning the 175 bp vanSB–vanYB intergenic region and adjacent coding sequences of pIP834, the 11 point mutations and the 5 bp deletion described in the vanB2 operon (Dahl et al., 1999) were also found. These data indicate that resistance to vancomycin in E. faecalis 268-10 and 6546 was of the vanB2 genotype. Sequence analysis of the 5n16 kb insert of pAT771 revealed, downstream from vanXB, the presence of two ORFs in the same orientation and the 5h portion of a third ORF. These ORFs were almost identical to orf7VB, orf8-VB and the 5h end of xis-VB of transposon Tn5382 (Carias et al., 1998) (Fig. 1b). These ORFs are also present with the same organization in Tn916 (Clewell et al., 1995). Sequencing of the PCR products obtained using primers complementary to the insert of pAT771 and pIP835 DNA as a template indicated an identical gene organization in pIP835 (data not shown). These observations suggest that the vanB operon from pIP834 and pIP835 was part of a transposon designated Tn1549. Right extremity of Tn1549

Since the gene organization in plasmid pIP834 was identical to that in Tn5382, two primers, T1 and T2 (Table 2, Fig. 1b), were designed to amplify a fragment internal to the xis-Tn1549 and int-Tn1549 genes and to construct pAT772. Sequence analysis of the insert in pAT772 indicated the presence of genes for an excisase and an integrase which had 98 % and 99n9 % identity with xis-VB and int-VB from Tn5382, respectively, and 74 % and 67 % identity with xis-Tn and int-Tn from Tn916-Tn1545. The three conserved residues in domain II (arginine, histidine and tyrosine) of the integrase family of site-specific recombinases (Poyart-Salmeron et

Characterization of Tn1549

.................................................................................................................................................................................................................................................................................................................

Fig. 2. Target DNA sequence at the integration site of Tn1549 into pIP834. (a) The nucleotide sequence of the transposon was aligned with those of chromosomal Tn5382 (Carias et al., 1998) and of the traE1 gene of plasmid pAD1 (Clewell, 1993). Identical nucleotides are indicated by vertical lines. The imperfect 11 bp inverted repeats are in lower-case letters. Left and right ends refer to the integrated transposon. The overlap sequence is underlined. Insertion of Tn1549 occurred at position 357 (vertical arrow) of the traE1 gene (GenBank accession no. M87836). (b) Homology between the sequence of the circular intermediate joint region of Tn1549 and of the pAD1 target sequence. Identical nucleotides are indicated by vertical lines. The overlap sequence is underlined. The 20 bp segment containing the sequence required for target activity, and designated att (Trieu-Cuot et al., 1993), is indicated at the bottom of the figure.

al., 1989) were found (data not shown). To recover the right extremity of Tn1549, the 2n2 kb insert of pAT773 that hybridized with the int-Tn1549 probe was sequenced. Sequence analysis showed the presence of the 3h end of the int-Tn1549 gene, the right extremity of Tn1549 with a copy of the imperfect inverted repeat of 11 bp identical to that in Tn5382. This 11 bp repeat was found to be adjacent to the 3h part of a gene identical to traE1 (Fig. 2a) of plasmid pAD1 (Clewell, 1993). Downstream from traE1, which encodes a positive regulator of the conjugative transfer of pAD1 (Clewell, 1993), orfy and the 5h extremity of sea1, a gene encoding a segregation protein of pAD1, were present (data not shown) (Clewell, 1993). A similar approach was used with pIP835 DNA. Sequencing of a 650 bp TaqI insert of pAT777 that hybridized with the int-Tn1549 probe indicated that the right extremity of Tn1549 has disrupted the 3h part of a gene nearly identical to uvrB from plasmid pAD1 (data not shown), which encodes an ultraviolet-resistance protein (Ozawa et al., 1997). These data indicate that Tn1549 was integrated at different loci of plasmids related to the pheromone-responsive plasmid pAD1. Junction fragments

Based on the observations that one extremity of Tn1549 was identical to the corresponding end of Tn5382 and

that the transposon was inserted into the traE1 gene, two primers, TnOUT and P1 (Table 2, Fig. 1a), were designed from the sequences of Tn5382 (Carias et al., 1998) and traE1 (GenBank accession no. M87836), respectively, to amplify the left junction. A PCR fragment of 250 bp using total DNA from E. faecalis 268-10 as a template was cloned, generating pAT774, sequenced and found to correspond to the 5h portion of traE1 adjacent to the left extremity of Tn1549 (Fig. 2a). As for Tn916-Tn1545-type conjugative transposons (Clewell et al., 1995), two imperfect inverted repeat sequences bordered Tn1549, which was inserted at position 357 of traE1 (numbering according to GenBank accession no. M87836). A 6 bp sequence (GAAAAT) located between the right inverted repeat of the transposon and position 357 of the traE1 gene could correspond to the overlapping sequence brought in by integration of the transposon (Fig. 2a) (Poyart-Salmeron et al., 1989). As reported for Tn1545 (Trieu-Cuot et al., 1993), Tn1549 has inserted into an AT-rich region and the overlap sequence of the integration site is flanked by short (7 bp) sequences which exhibit a significant degree of similarity with the transposon’s termini (Fig. 2b). Transposition of Tn916-like transposons involves the formation of a nonreplicative circular intermediate (Poyart-Salmeron et al., 1990). This was studied for 1485


Table 3. ORFs identified in the 24 kb PCR product obtained with pIP834 DNA from strain 268-10 ORF

ORF13 ORF14 ORF15 ORF16 ORF17 ORF18 ORF19 ORF20 ORF21 ORF22 ORF23 ORF24 ORF25 ORF26 ORF27 ORF28 ORF29 ORF30

Size (bp)

Coordinates (5h–3h)

Putative SD sequence and translational start (5h–3h)*

1200 213 477 1695 864 543 423 2400 1992 252 1230 2082 3921 945 447 1329 330 372

252–1451 1473–1685 1760–2236 2233–3927 4426–5289 5320–5862 5876–6298 6228–8627 8659–10 650 10 673–10 924 10 914–12 143 12 140–14 221 14 370–18 290 18 291–19 235 20 188–19 742 21 857–20 529 22 147–21 818 22 776–22 405

GAGAAAGGAGGCGACGCCATG GAAAAGGAGGACGACCCTATG TGACAAGGAGGGATGCGATTG GGAAAGGGGGCTGGAACTGTG GGAAAGGAGGTGCTACCCGTG AGCATACACAGGAGGAACTTG CGTGAAAGGAGGTGCCAAATG AACAGGAGGTAAAGGCCATTG CAAAGGAGGTGAACCACCATG AGAAAGGAGCTTTCAATTATG ACAGGAGGACAATGCCCATG TGAACAGGAGGACGAGGAATG AGAGAAAGGAGTGACCGCGTG GGATTGGAGGTAGAGTAAATG GCGCCAGCGGAAAAGATACTG GGGGGCGCTGGCGCAGATATG TGGAAAGGACGGTGAAGCATG GTAAGTGGGAGGTGCGATATG

* The Shine–Dalgarno (SD) sequences are underlined and the translational starts are indicated in bold.

Tn1549 by amplification with primers designed to direct polymerization outward from the ends of the transposon. Sequence analysis of the 309 bp amplification product cloned to form pAT775 confirmed that this fragment corresponded to the joint region (data not shown). This result indicates that Tn1549 can excise and generate a circular intermediate. Left extremity of Tn1549

A similar PCR strategy was used to complete the sequence of the left part of the transposon. First, the region upstream from the vanRB gene in strain 268-10 was obtained by sequencing the 560 bp insert in pAT776 in which no ORF was found (Fig. 1a). Secondly, two primers, XL1 and XL2, complementary to the left end of Tn1549 and to the region upstream from vanRB (Table 2, Fig. 1a) allowed amplification of a 24 kb PCR product from both strains. Restriction profiles of these PCR products obtained after digestion by HincII, SspI or XmnI were identical (data not shown). The 24 kb amplification product obtained from 268-10 DNA was purified and sequenced after shotgun cloning (Buchrieser et al., 1999). The mean GjC content of the left part of the transposon (nucleotides 1–24 046) (Fig. 1a) was 55n4 mol %, significantly higher than that reported for Enterococcus chromosomal DNA (38 %) or the plasmid traE1 gene (40n7 mol %). Eighteen ORFs were identified by GCG program analysis, with sizes ranging from 213 to 3921 bp (Table 3). ORFs 13 to 26 were in the same orientation, whereas ORFs 27 to 30 were in the opposite 1486

orientation (Fig. 1a). The start codon of ORFs 16, 20, 23, 24 and 29 overlapped with the end of the previous ORF. Two putative terminator sequences with perfect 8- and 16-base inverted repeats, respectively, were found between ORFs 24 and 25, and between ORFs 26 and 27 (Fig. 1a). Near-consensus ribosome-binding sites were found for all ORFs (Table 3), indicating that they were probably coding sequences. The deduced amino acid sequences were compared to those present in the nonredundant protein database at the National Center for Biotechnology Information Web site using the  program (Table 4). Eight deduced sequences showed a significant degree of identity with known proteins. ORF16 was 29 % identical to the TrsK protein involved in conjugation of Staphylococcus aureus plasmid pGO1. TrsK also exhibited 20 % identity with three related proteins, TraD, VirD4 and TraG (Morton et al., 1993), necessary for conjugative transfer of plasmids in Gramnegative species. ORF18 was 39 % identical to the MunI methyltransferase of Mycoplasma sp., which recognizes the double-stranded sequence CAATTG and protects DNA from cleavage by MunI endonuclease (Siksnys et al., 1994). ORF20 presented 27 % identity with part of the TrsE protein involved in the conjugative transfer of S. aureus plasmid pGO1 (Morton et al., 1993). ORF21 was 45 % identical to ORF14 of Tn916 (Flannagan et al., 1994).

Characterization of Tn1549 Table 4. Comparison of sequences deduced from the ORFs in the 24 kb PCR product obtained with pIP834 DNA from strain 268-10 ORF

Size (aa residues)

ORF13 ORF14 ORF15 ORF16

400 71 159 565

ORF17 ORF18

288 181

ORF19 ORF20 ORF21 ORF22 ORF23 ORF24

141 800 664 84 410 694

ORF25

1307

ORF26 ORF27 ORF28 ORF29 ORF30

315 149 443 110 124

Homologous protein (organism) (% identity, aa overlap)

TrsK protein (Staphylococcus aureus) (29 %, 413 aa) MunI methyltransferase (Mycoplasma sp.) (39 %, 168 aa) TrsE protein (S. aureus) (27 %, 437 aa) ORF14\Tn916 (E. faecalis) (45 %, 144 aa)

DNA topoisomerase III (Bacillus subtilis) (38 %, 625 aa) LtrC-like protein (S. aureus) (33 %, 291 aa)

Partially sequenced genomes Enterococcus faecalis V583

Clostridium difficile 630

gef 6163 (34 %, 279 aa)

contig 116 (67 %, 325 aa) contig 116 (73 %, 69 aa) contig 116 (51 %, 133 aa) contig 116 (73 %, 540 aa)

gef 6163 (48 %, 133 aa) gef 6163 (60 %, 540 aa) gef 6163 (54 %, 286 aa) gef 6163 (76 %, 155 aa)

contig 116 (53 %, 286 aa)

gef 6163 (50 %, 129 aa) gef 6163 (59 %, 796 aa) gef 6163 (65 %, 136 aa) gef 6163 (41 %, 74 aa) gef 6163 (33 %, 192 aa) gef 6163 (63 %, 174 aa)

contig 116 (57 %, 135 aa) contig 116 (63 %, 798 aa) contig 116 (34 %, 633 aa) contig 116 (55 %, 80 aa) contig 116 (41 %, 156 aa) contig 116 (63 %, 686 aa)

gef 6217 (34 %, 295 aa)

contig 116 (46 %, 523 aa)

gef 6163 (39 %, 292 aa) ORF8\Tn916 (E. faecalis) (27 %, 76 aa) Rlx protein (S. aureus) (32 %, 235 aa)

ORF24 was 38 % identical to DNA topoisomerase III from Bacillus subtilis, which catalyses the conversion of one isomer of DNA to another (Beloin et al., 1997). ORF25 presented 27 % identity with a portion of the LtrC-like protein involved in conjugation of plasmid pSK41 from S. aureus (Berg et al., 1998). ORF27 was 28 % identical to ORF8 of transposon Tn916, which regulates transcription of the orf7, orf8, xis, int and tra genes (Celli & Trieu-Cuot, 1998). ORF28 was 32 % identical to the Rlx protein of S. aureus, which is probably required for relaxation complex formation and plasmid mobilization by conjugative plasmids (Projan et al., 1985). In order to detect related transposons in other organisms, we also performed searches for similar sequences in unfinished microbial genomes. Both  using the sequence of the Tn1549 and  using the predicted amino acid sequence of the 30 proteins as query sequences were carried out. Very similar sequences were identified in E. faecalis (www.tigr.org\) and Clostridium difficile (www.sanger.ac.uk) (Table 4). The vanB operon was found almost identical only in the Enterococcus sequence, as expected from the genotype of the two strains, E. faecalis V583 at TIGR and E. faecalis 268-10, studied. However the vanB operon of V583 did not appear to be linked to sequences in Tn1549.

gef 6360 (37 %, 426 aa) gef 6360 (43 %, 94 aa) gef 6231 (32 %, 53 aa)

contig 116 (54 %, 74 aa) contig 299 (61 %, 431 aa) contig 299 (63 %, 109 aa) contig 299 (35 %, 76 aa)

DISCUSSION

Gene clusters related to the vanB operon can be carried by large elements that are transferable by conjugation from chromosome to chromosome at low frequency (Quintiliani & Courvalin, 1994). An element of 250 kb was found to contain a 64 kb composite transposon Tn1547 delineated by insertion sequences belonging to the IS256 family (Quintiliani & Courvalin, 1996). An approximately 27 kb putative transposon, Tn5382, encoding VanB-type glycopeptide resistance in E. faecium C68 and belonging to the family of Tn916related transposons has been described recently (Carias et al., 1998). Transfer of vancomycin resistance from clinical isolate C68 to E. faecium GE-1 is associated with the transfer of ampicillin and tetracycline resistances and with acquisition of an approximately 130–160 kb segment of chromosomal DNA (Carias et al., 1998). In E. faecalis E93\268 and E. faecium 654 clinical isolates, resistance to vancomycin was found to be associated with a vanB gene cluster carried by plasmids pIP834 and pIP835, respectively (Woodford et al., 1995a, b). Molecular characterization of the vancomycin-resistance determinant and of its flanking regions indicated that the vanB operon was carried by the 34 kb long transposon Tn1549 (Fig. 1). Sequence comparison of both ends revealed that Tn1549 was highly similar to Tn5382 (Carias et al., 1998). Analysis of the sequence of the target revealed that, in pIP834, the transposon was 1487


inserted into the traE1 gene of the pheromone conjugative plasmid pAD1 (Fig. 2). The TraE1 protein activates its own transcription from its own promoter, as well as transcription of other genes involved in regulation of the pheromone response (Pontius & Clewell, 1992). It has been reported that inactivation of traE1 abolishes plasmid transfer (Pontius & Clewell, 1992). However, transfer of vancomycin resistance between E. faecalis 268-10 and BM4110 occurred at a low frequency (4n4 i10−'). Conjugative transfer of pIP834 could be cis-complemented by proteins encoded by the left part of the transposon, since TrsK and TrsE are involved in conjugation of plasmids from Grampositive bacteria. Alternatively, transcription of the genes involved in the pheromone response could originate in the right part of the transposon with reading through the attachment site (Celli & Trieu-Cuot, 1998). By contrast, in pIP835, Tn1549 was inserted into the uvrB gene of pAD1. In this case, conjugal transfer of vancomycin resistance occurred at high frequency (4i10−#) similar to that (10−$ to 10−") of pAD1 (Pontius & Clewell, 1992). In its right extremity, Tn1549 was nearly identical to Tn5382 (Carias et al., 1998) and exhibited significant identity to the excisase (74 %) and the integrase (67 %) genes of transposon Tn916. Interestingly, a 309 bp joint region was amplified by nested PCR (Manganelli et al., 1995) using total DNA of 268-10 DNA as a template. This result indicated that like Tn5382, Tn1549 was capable of excision to form a circular intermediate. Tn1549 contained 30 ORFs and appeared to be organized into three distinct functional regions like Tn916 : (i) the right end, corresponding to the small HindIII fragment of Tn916 implicated in the excision– integration process (Celli & Trieu-Cuot, 1998) must be functional ; (ii) the central portion, in which the vanB2 operon responsible for vancomycin resistance was found instead of the tet(M) gene for tetracycline resistance in Tn916 ; and (iii) the left extremity, corresponding approximately to the large HindIII fragment of Tn916 (Celli & Trieu-Cuot, 1998), in which 8 of the 18 identified ORFs could be implicated in the conjugative transfer. The 55n4 mol % GjC content of the left 24 kb of the transposon was significantly different from those of the vanB operon (49 mol %), of the right portion (38 mol %) and of the enterococcal (38 mol %) and C. difficile (25–30 mol %) genomes. This indicates that the origin of the left end of the transposon is different from that of the two other functional regions. Analysis of partial genome sequences of E. faecalis and C. difficile indicated that a similar modular organization was present in both species. ACKNOWLEDGEMENTS This work was supported in part by a Bristol-Myers Squibb Unrestricted Biomedical Research Grant in Infectious Diseases and by the Programme de Recherche Fondamentale en Microbiologie, Maladies Infectieuses et Parasitaires. F. Garnier was the recipient of a fellowship from the Faculte! de 1488

Me! decine de Paris. We thank M. Granzotto for help in cloning experiments and sequence determination and P. Trieu-Cuot for critical reading of the manuscript. The Sanger Centre and The Institut for Genomic Research (TIGR) are gratefully acknowledged.

REFERENCES Altschul, S. F., Madden, T. L., Scha$ ffer, A. A., Zhang, J., Zhang, Z., Miller, W. & Lipman, D. J. (1997). Gapped  and - : a

new generation of protein database search programs. Nucleic Acids Res 25, 3389–3402. Arthur, M., Reynolds, P. E. & Courvalin, P. (1996). Glycopeptide resistance in enterococci. Trends Microbiol 4, 401–407. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1992). Preparation and analysis of

DNA. In Current Protocols in Molecular Biology, pp. 2–33. New York : Wiley. Beloin, C., Ayora, S., Exley, R., Hirschbein, L., Ogasawara, N., Kasahara, Y., Alonso, J. C. & Le He! garat, F. (1997). Charac-

terization of an lrp-like (lprC) gene from Bacillus subtilis. Mol Gen Genet 256, 63–71. Berg, T., Firth, N., Apisiridej, S., Hettiaratchi, A., Leelaporn, A. & Skurray, R. A. (1998). Complete nucleotide sequence of pSK41 :

evolution of staphylococcal conjugative multiresistance plasmids. J Bacteriol 180, 4350–4359. Buchrieser, C., Rusniok, C., Frangeul, L., Couve, E., Billault, A., Kunst, F., Carniel, E. & Glaser, P. (1999). The 102-kilobase pgm

locus of Yersinia pestis : sequence analysis and comparison of selected regions among different Yersinia pestis and Yersinia pseudotuberculosis strains. Infect Immun 67, 4851–4861. Carias, L. L., Rudin, S. D., Donskey, C. J. & Rice, L. B. (1998).

Genetic linkage and cotransfer of a novel, vanB-containing transposon (Tn5382) and a low-affinity penicillin-binding protein 5 gene in a clinical vancomycin-resistant Enterococcus faecium isolate. J Bacteriol 180, 4426–4434. Celli, J. & Trieu-Cuot, P. (1998). Circularization of Tn916 is required for expression of the transposon-encoded transfer functions : characterization of long tetracycline-inducible transcripts reading through the attachment site. Mol Microbiol 28, 103–117. Clewell, D. B. (1993). Bacterial sex pheromone-induced plasmid transfer. Cell 73, 9–12. Clewell, D. B., Flannagan, S. E. & Jaworski, D. D. (1995). Unconstrained bacterial promiscuity : the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol 3, 229–236. Courvalin, P. & Carlier, C. (1986). Transposable multiple antibiotic resistance in Streptococcus pneumoniae. Mol Gen Genet 205, 291–297. Dahl, K. H., Simonsen, G. S., Olsvik, O. & Sundsfjord, A. (1999).

Heterogeneity in the vanB gene cluster of genomically diverse clinical strains of vancomycin-resistant enterococci. Antimicrob Agents Chemother 43, 1105–1110. Devriese, L. A., Pot, B. & Collins, M. D. (1993). Phenotypic identification of the genus Enterococcus and differentiation of phylogenetically distinct enterococcal species and species groups. J Appl Bacteriol 75, 399–408. Evers, S. (1995). Genetic characterization of VanB-type glycopeptide resistance in Enterococcus faecalis V583. PhD thesis, Technischen Universita$ t Mu$ nchen.

Characterization of Tn1549 Ewing, B. & Green, P. (1998). Base-calling of automated sequencer

traces using phred. II. Error probabilities. Genome Res 8, 186–194. Ewing, B., Hillier, L., Wendl, M. C. & Green, P. (1998). Base-calling of automated sequencer traces using phred. I. Accuracy assessment. Genome Res 8, 175–185. Fines, M., Pe! richon, B., Reynolds, P. E., Sahm, D. F. & Courvalin, P. (1999). VanE, a new type of acquired glycopeptide resistance in

Enterococcus faecalis BM4405. Antimicrob Agents Chemother 43, 2161–2164. Flannagan, S. E., Zitzow, L. A., Su, Y. A. & Clewell, D. B. (1994).

Nucleotide sequence of the 18-kb conjugative transposon Tn916 from Enterococcus faecalis. Plasmid 32, 350–354. Gold, H. S., U$ nal, S., Cercenado, E., Thauvin-Eliopoulos, C., Eliopoulos, G. M., Wennersten, C. B. & Moellering, R. C., Jr (1993).

A gene conferring resistance to vancomycin but not teicoplanin in isolates of Enterococcus faecalis and Enterococcus faecium demonstrates homology with vanB, vanA, and vanC genes of enterococci. Antimicrob Agents Chemother 37, 1604–1609. Gordon, D., Abajian, C. & Green, C. (1998). Consed : a graphical tool for sequence finishing. Genome Res 8, 195–202. Jacob, A. E. & Hobbs, S. J. (1974). Conjugal transfer of plasmidborne multiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J Bacteriol 117, 360–372. Manganelli, R., Romano, L., Ricci, S., Zazzi, M. & Pozzi, G. (1995).

Dosage of Tn916 circular intermediates in Enterococcus faecalis. Plasmid 34, 48–57. Morton, T. M., Eaton, D. M., Johnston, J. L. & Archer, G. L. (1993).

DNA sequence and units of transcription of the conjugative transfer gene complex (trs) of Staphylococcus aureus plasmid pGO1. J Bacteriol 175, 4436–4447. Murray, B. E. (1990). The life and times of the Enterococcus. Clin Microbiol Rev 3, 46–65. Ozawa, Y., Tanimoto, K., Fujimoto, S., Tomita, H. & Ike, Y. (1997).

Cloning and genetic analysis of the UV resistance determinant (uvr) encoded on the Enterococcus faecalis pheromone-responsive conjugative plasmid pAD1. J Bacteriol 179, 7468–7475. Pearson, W. R. & Lipman, D. J. (1988). Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85, 2444–2448. Pe! richon, B., Reynolds, P. E. & Courvalin, P. (1997). VanD-type glycopeptide-resistant Enterococcus faecium BM4339. Antimicrob Agents Chemother 41, 2016–2018. Pontius, L. T. & Clewell, D. B. (1992). Conjugative transfer of Enterococcus faecalis plasmid pAD1 : nucleotide sequence and transcriptional fusion analysis of a region involved in positive regulation. J Bacteriol 174, 3152–3160. Poyart-Salmeron, C., Trieu-Cuot, P., Carlier, C. & Courvalin, P. (1989). Molecular characterization of two proteins involved in the

excision of the conjugative transposon Tn1545 : homologies with other site-specific recombinases. EMBO J 8, 2425–2433.

Poyart-Salmeron, C., Trieu-Cuot, P., Carlier, C. & Courvalin, P. (1990). The integration–excision system of the conjugative

transposon Tn1545 is structurally and functionally related to those of lambdoid phages. Mol Microbiol 4, 1513–1521. Projan, S. J., Kornblum, J., Moghazeh, S. L., Edelman, I., Gennaro, M. L. & Novick, R. P. (1985). Comparative sequence and functional

analysis of pT181 and pC221, cognate plasmid replicons from Staphylococcus aureus. Mol Gen Genet 199, 452–464. Quintiliani, R., Jr & Courvalin, P. (1994). Conjugal transfer of the vancomycin resistance determinant vanB between enterococci involves the movement of large genetic elements from chromosome to chromosome. FEMS Microbiol Lett 119, 359–364. Quintiliani, R., Jr & Courvalin, P. (1996). Characterization of Tn1547, a composite transposon flanked by the IS16 and IS256like elements, that confers vancomycin resistance in Enterococcus faecalis BM4281. Gene 172, 1–8. Reynolds, P. E. (1989). Structure, biochemistry and mechanism of action of glycopeptide antibiotics. Eur J Clin Microbiol Infect Dis 8, 943–950. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning : a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY : Cold Spring Harbor Laboratory. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463–5467. Siksnys, V., Zareckaja, N., Vaisvila, R., Timinskas, A., Stakenas, P., Butkus, V. & Janulaitis, A. (1994). CAATTG-specific restriction-

modification MunI genes from Mycoplasma : sequence similarities between R-MunI and R-EcoRI. Gene 142, 1–8. Trieu-Cuot, P., Poyart-Salmeron, C., Carlier, C. & Courvalin, P. (1993). Sequence requirements for target activity in site-specific

recombination mediated by the Int protein of transposon Tn1545. Mol Microbiol 8, 179–185. Triglia, T., Peterson, M. G. & Kemp, D. J. (1988). A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences. Nucleic Acids Res 16, 8186. Vieira, J. & Messing, J. (1982). The pUC plasmids, an M13mp7derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19, 259–268. Woodford, N., Jones, B. L., Baccus, Z., Ludlam, H. A. & Brown, D. F. J. (1995a). Linkage of vancomycin and high-level gentamicin

resistance genes on the same plasmid in a clinical isolate of Enterococcus faecalis. J Antimicrob Chemother 35, 179–184. Woodford, N., Morrison, D., Johnson, A. P., Bateman, A. C., Hastings, J. G. M., Elliot, T. S. J. & Cookson, B. (1995b). Plasmid-

mediated VanB glycopeptide resistance in enterococci. Microb Drug Resist 1, 235–240. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains : nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103–119. .................................................................................................................................................

Received 10 February 2000 ; revised 21 March 2000 ; accepted 24 March 2000.

1489