Characterization of tumor-infiltrating T lymphocytes in B-cell ...

American Journal of Pathology, Vol. 151, No. 5, November 1997 Copyright X) American Societyfor Investigative Pathology

Characterization of Tumor-Infiltrating T Lymphocytes in B-Cell Lymphomas of Mucosa-Associated Lymphoid Tissue

Athanasios Koulis, Tim Diss, Peter G. Isaacson, and Ahmet Dogan From the Department of Histopathology, University College London Medical School, London, United Kingdom

B-cell lymphomas of mucosa-associated lymphoid tissue invariably contain large numbers of reactive tumor-infiltrating T cells. In the stomach, these lym-

phomas develop secondary to Helicobacter pylori infection, and clinical and in vitro studies have shown that their growth depends on help provided by H. pylori-specific T cells. In this study we characterized tumor-infiltrating T cells in low- and highgrade B-cell lymphomas of mucosa-associated lymphoid tissue using immunohistochemistry. In most cases, CD4+ T cells dominated and almost all T cells were CD45RO+ memory cells. In 11 of 13 cases studied, the proliferating T cells were CD4+ and no proliferation was observed in the CD8+ subset. In lowgrade lymphomas, between 7 and 24% of T cells expressed CD40L whereas no CD40L expression was observed in the majority of high-grade tumors. Examination of homing receptor proffle showed that both a4(87 integrin+ and L-selectin+ T cells were present. Examination of T cell diversity by a panel of antibodies against different T-cell receptor V.8 regions and by analysis of T-cell receptor genes using polymerase chain reaction suggested that the T cells in these tumors were polyclonaL These results show that lowgrade B-cell lymphomas of mucosa-associated lymphoid tissue contain a significant population of activated helper T cells that may be important in supporting tumor growth. (Am J Pathol 1997, 151:1353-1360) A close link between development of primary gastric lymphomas of mucosa-associated lymphoid tissue (MALT) and Helicobacter pylori infection of the stomach has been established by histological and serological studies.1`3 Proliferation of tumor cells isolated from gastric MALT lymphomas can be induced by incubation with H. pylori.4 If the tumor-infiltrating T lymphocytes (TILs) are depleted from the tumor cell population before the incubation with H. pylori, no tumor cell proliferation is seen.4 Clinically, eradication of H. pylori infection may lead to

disappearance of the low-grade MALT lymphoma. 7 These findings suggest that T-cell help plays a role in the growth of B-cell MALT lymphomas in vivo and in vitro. We have studied the characteristics of TILs in situ in MALT lymphomas in the light of physiological interactions between normal T and B cells. The immunophenotype of TILs was investigated to quantify helper/cytotoxic and memory/nalve T cell proportions, to determine the proliferation fraction in T cell subsets, and to examine the expression of receptors involved in lymphocyte traffic and the expression of co-stimulatory molecules important in T cell/B cell interaction. The clonal diversity of TILs was studied by immunohistochemistry and a polymerase chain reaction (PCR)-based method.

Materials and Methods

Tissues Cryopreserved tissue blocks from eight cases of lowgrade and five cases of high-grade MALT lymphoma were retrieved from the departmental tissue bank. In all cases, the diagnosis of B-cell MALT lymphoma had been established by the characteristic histology, immunohistochemistry, and clonal analysis of the rearranged immunoglobulin heavy chain gene.5 The details of the specimens used are shown in Table 1.

Immunohistochemistry Frozen sections were stained with a single-layer avidinbiotin-peroxidase or alkaline phosphatase method or with a sequential double immunohistochemical staining using an avidin-biotin-peroxidase/alkaline phosphatase method. The peroxidase reactivity was demonstrated by diaminobenzidine substrate giving a brown reaction product and alkaline phosphatase reactivity by fast blue substrate giving a blue reaction product. A light hematoxylin counterstain was used when necessary. For each section stained, a negative conSupported by the Clinical and Research Development Committee of University College London Medical School. Accepted for publication June 28, 1997. Address reprint requests to Dr. Ahmet Dogan or Professor P.G. Isaacson, Department of Histopathology, University College London Medical School, Rockefeller Building, University Street, London WC1 E 6JJ, United Kingdom.

1353

1354 Koulis et al AJP November 1997, Vol. 151, No.

Table 1.

5

Clinical Details of MALT Lymphoma Cases Studied

Case

Age (years) Sex

Site

Histological diagnosis

1a lb

59 F

2 3

71 M 68M 46 F 55 F NA M 41 M 51 F 58M 65M 71 F 65M 71 M

Stomach Intestine Stomach Intestine Stomach Stomach Lung Stomach Stomach Lung Stomach Stomach Stomach Stomach

LG-MALT LG-MALT LG-MALT LG-MALT LG-MALT LG-MALT LG-MALT LG-MALT LG-MALT HG-MALT HG-MALT HG-MALT HG-MALT HG-MALT

4

5 6 7 8 9 10 11 12 13

M, male; F, female; NA, not available; LG-MALT, low-grade MALT lymphoma; HG-MALT, high-grade MALT lymphoma.

trol slide with the omission of the primary antibody was included. The details of the immunostaining procedures have been published elsewhere.9'10 The primary antibodies used in the study are shown in Table 2. All secondary reagents were purchased from Dako, High Wycombe, UK.

Quantification of Immunohistochemical Reactivity in T Cell Subsets Expression of CD8 and CD45RO by TILs The CD4/CD8 ratio of TILs in MALT lymphomas was determined by sequential double immunostaining for CD8 followed by CD3 as the expression of CD8 in tissues is predominantly limited to the T cell lineage. Those CD3+ T cells that do not express CD8 were assumed to be CD4+. Whether TILs are predominantly memory T cells or nalve T cells was determined by staining for CD45RO using the same approach.11 The CD45RO+ CD3+ cells were considered to be memory T cells whereas those T cells that did not express CD45RO were considered to be nalve. The quantification was performed as follows. The primary antibody against the antigen being investigated was applied first using the peroxidase method, which gave a brown reaction product. This was followed by the anti-CD3 antibody using the alkaline phosphatase method, which gave a blue reaction product. The percentage of T cells that did not express the antigen recTable 2.

ognized by the first antibody was calculated using the following formula: percentage of CD3+ cells not expressing the antigen = CD3+ antigen- cells (blue)/[all positive cells (brown/blue or blue)] x 100. In each case, sequential double immunostaining was also performed in reverse order to demonstrate that CD8 and CD45RO were not expressed on cells other than CD3+ cells. For each case, the cell counting was performed four times by two different observers (A. Koulis and A. Dogan) independently. At least 2000 T cells were counted for each parameter. The average of four counts and SE were calculated. Expression of Lymphocyte Homing Receptors The expression of homing receptors a4/7 and L-selectin by TILs was examined by staining two serial sections using the method described below as both receptors are expressed by cells other than T cells, such as B cells. The first section was stained with an anti-CD3 antibody using the single-layer method. The second section was first stained with an antibody against the antigen under investigation (a4137, L-selectin, or a4f37 plus L-selectin) using the peroxidase method (brown reaction product), followed by an antibody against CD3 using the alkaline phosphatase method (blue reaction product). Those CD3+ cells that were negative for the antigen being studied were observed in blue. The staining was quantified by counting positive cells (blue only) in the same areas of two serial sections. The number of T cells expressing the antigen being studied was calculated by the following formula: percentage of CD3+ cells expressing the antigen = [CD3+ cells (first section) - CD3+ antigen- cells (second section)]/[CD3+ cells (first section)] x 100. For each case, the cell counting was performed four times by two different observers (A. Koulis and A. Dogan) independently. At least 2000 T cells were counted for each parameter. The average of four counts and SE were calculated. Expression of Co-Stimulatory Molecules The percentage of TILs expressing CD40L in MALT lymphomas was determined using the method described

Details of Monoclonal Antibodies Used in the Study

Clone UCHT1 DK25 Ki-67 M90 EA-5 UCHL1 YTH913.12 BB1 BU63 Leu 8 Act-1

Source

Specificity CD3 CD8 Ki-67 antigen CD40L CD40 CD45RO CD28 CD80 CD86 L-selectin (CD62L)

a4,B7 integrin

Dako, High Wycombe, Bucks, UK Dako Dako

Serotec, Oxford, UK Serotec Dako Serotec

Becton-Dickinson, Oxford, UK Serotec Becton-Dickinson Dr. D. Ringler, LeukoSite, Cambridge, MA

T Cells in MALT Lymphomas

1355

AJP November 1997, Vol. 151, No. 5

for CD8 and CD45RO as the staining for CD40L in tissue sections is limited to the T cell lineage. The percentage of T cells expressing CD28 was quantified by using the method described for the homing receptors as CD28 is expressed by cells other than T cells. The expression of co-stimulatory molecules by the neoplastic B cells (CD40, CD80, and CD86) was scored as positive or negative. Determination of Proliferation Fraction in TIL Subsets

Quantification of CD3+ or CD8+ cells expressing Ki67 was performed using double immunohistochemical staining as described previously.12

Investigation of T Cell Diversity in MALT Lymphomas The T cell diversity in MALT lymphomas was investigated by immunohistochemistry and by PCR amplification of T-cell receptor genes.

Immunohistochemistry T-cell diversity was investigated by immunostaining using monoclonal antibodies against 13 different T-cell receptor VP3 regions. The monoclonal antibodies against V,B1, V,B2, V133, V139, V313.3, V,B17, Vp19, V,B21, and V,322 were purchased from The Binding Site, Birmingham, UK, and V,B5a, Vf5b, Vf85c, Vf36, V,B8, and V,B12 from T Cell Sciences, Cambridge, MA. For each case, frozen sections were sequentially immunostained with antibodies against individual V1 regions followed by an anti-CD3 antibody as described above. The ratio of T cells expressing individual Vf3 regions was determined as described for CD8.

PCR The T-cell receptor e-chain gene was amplified using the method described by McCarthy using two reactions with primers Vyl+ VylII/IV+ Jyl12 (product sizes, approximately 70 to 95 bp) and Vyl+ Vylll/IV+ JPy1/2 (product sizes, 80 to 110 bp).13 This method could detect approximately 80% of all T cells whether they express a/3 or -y T-cell receptor.13"14 The details of the PCR reaction have been described elsewhere.14 PCR products were run on 10% polyacrylamide gels, stained with ethidium bromide, and viewed under ultraviolet light. All samples were studied in duplicate. Samples that gave rise to a total of one or more clearly visible, discrete fragments within the expected size ranges and of the same size in both amplifications were scored as positive (mono- or oligoclonal); those that gave rise to a smear of products or an inconsistent, weak ladder pattern of amplification were scored as negative (polyclonal).

Cloning and Sequencing of PCR Products To show that the presence of a smear in the gels represented a polyclonal T cell population and to compare the T cell repertoire in two different sites from the same patient, the PCR products obtained from gastric and intestinal tumors of case 1 were cloned and sequenced.10 Briefly, the PCR products were partially purified using chloroform/isoamyl alcohol extraction followed by a simple ethanol precipitation and cloned into the pMOSB/ueT-vector using the pMOSB/ueT-vector kit (Amersham International, Little Chalfont, UK). The insert size for each clone was checked by PCR amplification using T3 and T7 primers. The clones with correct size inserts were sequenced in a single direction using the Sequenase sequencing kit (Amersham).

Results The Majority of TIL in MALT Lymphomas Are Helper T Cells with a Memory Phenotype In 11 of 13 cases of MALT lymphoma studied, there were more CD3+CD8- cells than CD3+CD8+, suggesting that the majority of TILs in MALT lymphomas were CD4+ helper T cells (Figures la and 2). Examination of CD45RO expression showed that in each case the vast majority of TILs in MALT lymphomas were memory T cells (Figures lb and 3).

Mucosal Homing Receptor, a4f37 Integrin, and Peripheral Lymph Node Homing Receptor LSelectin Are Expressed by Different Subsets of TILs in MALT Lymphomas L-selectin and a437 were each expressed by a different subset of TILs in MALT lymphomas (Figures lc and 4). The percentage of TILs expressing the individual homing receptors varied widely from one case to the other. However, overall, there was a reciprocal relationship between the number of L-selectin and a4f37 integrin expressing cells. Those cases that had high numbers of L-selectin+ TILs had low numbers a4f37 integrin+ TILs and vice versa. When tumors were stained with a mixture of antibodies against L-selectin and a4f37 integrin, it was observed that in each case more than 98% of CD3+ cells were labeled, suggesting TILs expressed either L-selectin or a4f37.

Co-Stimulatory Molecules Necessary for Effective T-Cell/B-Cell Interaction Are Expressed in Low-Grade MALT Lymphomas CD40L ligand was expressed by 7 to 26% of TILs in all low-grade MALT lymphomas whereas three of the four cases of high-grade lymphomas studied showed expression in less than 1% of TILs (Figures 1 d and 5). In all cases, more than 98% of TILs expressed CD28. The neoplastic B

1356

Koulis et al


I.t .-.

..I lk

.:

?=t ;~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~.:. ~ ~ ~ k.

Figure 1. Immunohistochemical analysis of TIL in frozen sections of MALT lymphomas. a: Case 3 (low grade) immunostained for CD8 in brown and CD3 in blue. The blue cells are CD3+, CD8-. Original magnification, X 160. b: Case 6 (low grade) immunostained for CD45RO in brown and CD3 in blue. The blue cells (arrowheads) are CD3+, CD45RO-. Original magnification, X100. C: Gastric tumor from case 1 (low grade) immunostained for a4,7 integrin in brown and CD3 in blue. The blue cells are CD3+, a4,B7 integrin negative. Original magnification, X 192. d: Case 4 (low grade) immunostained for CD40L in brown and CD3 in blue. The CD3+ cells expressing CD40L are seen as blue-brown (arrowheads). Original magnification, X 192. e: Case 5 (low grade) immunostained for Ki67 in brown and CD3 in blue. The proliferating CD3+ cells are shown with arrowheads, proliferating CD3- cells with an arrow. Original magnification, X 100.

cells invariably expressed CD40 and CD80. CD86 was expressed by tumor cells in five cases (Table 3).

Proliferation of TILs Is Limited to the CD4+ Helper T Cells in MALT Lymphomas In 11 cases, the percentages of CD8+ T cells expressing Ki67 was significantly lower than total T cells expressing Ki67, suggesting that the majority of proliferating T cells were in the CD4+ fraction (Figures le and 6). In cases 7 and 13, the proliferation fraction in CD8+ TIL subset was similar to that observed in total CD3+ cells.

MALT Lymphomas Contain a Diverse TIL Repertoire Immunohistochemistry using antibodies against T-cell receptor V,3 families showed no skewing in V,3 usage, all V,B families studied being expressed in less than 5% of the total number of CD3+ cells. PCR analysis of T-cell recep-

tor y-chain genes revealed a smear in all cases, suggesting that the TIL populations in MALT lymphoma were polyclonal (Figure 7). In case 1, where tumor tissue from two separate sites was available, cloning and sequencing of PCR products showed a diverse T cell population at each site, confirming this observation (Figure 8). None of the clones sequenced was shared between the gastric and intestinal tumors.

Discussion B-cell lymphomas invariably contain a population of reactive TILs, the functional significance of which is not known. Although it has been suggested that these T cells could be part of an immune response against the tumor, 15-18 our recent studies on low-grade MALT lymphomas suggest that they can provide help for proliferation of neoplastic B cells.4 19 Here we observed that in the majority of MALT lymphoma cases, there were more CD4+ TILs than CD8+ TILs, suggesting that TILs with helper


1357


Li 0c

(3

a9 O

I

I

Case la

Case la Case lb Case 2 Case 3 Case 4 Case 5 Case 6 Case 7 Case 8 Case 10 Case ii Case 12 Case 13

j--q p

Case lb a Case 2 Case 3 Case 4 0 Case 6 Case 7 c, -Jl I Case 8 a Case 9 U' Case 10 C, 11 Case S a, Case 12 Case 13

0

20

40

80

(%) 60

100

Figure 2. The percentage of T cells that were negative (shaded bars) and positive for CD8 (open bars). The average of four counts + SE is shown. Case 9 was not studied.

function dominated these tumors. Increased proliferation of T cells in low- and high-grade MALT lymphomas compared with normal lymphoid tissues has been reported.12 Examination of the proliferation fraction in CD8+ and CD8- TIL subsets suggests that, in the majority of MALT lymphomas, almost all proliferating TILs are CD4+ helper T cells. In each case, the great majority of TILs expressed CD45RO, a marker of memory T cells, showing that TILs were composed of T cells that had gone through antigen stimulation. The lymphocyte traffic into mucosal tissues is, in part, regulated by a4f7 integrin expressed by lymphocytes and its endothelial ligand mucosal addressin cell adhesion molecule-1 (MAdCAM-1) expressed by high endothelial venules (HEVs) of mucosal lymphoid follicles and mucosal venules.20-25 The traffic into peripheral lymphoid tissue is to a large extent regulated by L-selectin expressed by the lymphocytes and its ligands called peripheral lymph node addressin (PNAd) expressed by HEVs of peripheral lymph nodes.25-28 PNAd is to a lesser extent expressed by the HEVs of Peyer's patches and plays a role in recruitment of lymphocytes to organized

LIIII ~== ]

H

m MENMV==-i

II

l|i 20

10

40

(%)

20

100

lymphoid structures of the mucosa.23'26 In normal gastrointestinal lamina propria, T cells express either a4,f7 integrin and/or aEk7 integrin, and no L-selectin expression is observed.29-31 In contrast, when the homing receptor profile of TILs in MALT lymphomas was examined, in addition to a4f37 integrin+ T cells, in each case, a significant number of L-selectin+ T cells were observed. No aEf37 integrin expression by TILs was present (data not shown). In the stomach, we have observed that H. pylori-associated gastritis leads to accumulation of Lselectin+ T and B cells and to induction of PNAd expression in the HEVs (Dogan A, Du M, Koulis A, Briskin M, Isaacson P: Expression of lymphocyte homing receptors and vascular addressins in low-grade gastric B-cell lymphomas of mucosa-associated lymphoid tissue. Am J Pathol 1997, 151 (in press)). Similarly, in gastrointestinal MALT lymphomas, the HEVs express PNAd. This pattern of vascular addressin expression may be responsible for the accumulation of L-selectin+ T cells into the lymphoma. A similar finding has been reported for Crohn's -------I

L 1~~-q

Th

.h

I~~~~~~~~~~~~

I~~~~

M

30

Figure 3. The percentage of T cells that were negative for CD45RO. The average of four counts ± SE is shown. Case 9 was not studied.

-i --

80

60

Figure 4. The percentage of T cells expressing a4f37 integrin (open bars) and L-selectin (shaded bars). The average of four counts ± SE is shown. In cases lb and 13, the a4/37 integrin immunostaining was quantified due to strong expression in neoplastic B cells (arrows).

E

I I IZIZJH 2pi

iq nomin-

0

Case la Case l b Case 2 0 Case 3 Case 4 0 Case 5 Case 6 Case 7 -1 Case 8 a Case 10 Case 1 1 Case 12 1 CI Case 13

Case la Case l b Case 2 -~Case 3 Case 4 Case 5 0 -i Case 6 Case 7 Case 8 Case 10 II 1= Case 11 0 Case 12 Case 13

=H 1.-i

0

10

(%)

20

30

Figure 5. percentage of T cells expressing CD40L. The average of four counts ± SE is shown. Case 9 was not studied. The

1358

Koulis et al


Table 3.

Expression of CD40, CD80, and CD86 by Neoplastic B Cells in MALT Lymphomas

Case

CD40

CD80

la lb

+ +

+ +

+ + + + + + +

+

+ + + + +

+ +

+ +

+

+

+

+

2 3 4 6 7 8 9 10 11 12 13

+

CD86

+

+

Not done + + +

+

disease where chronic inflammation leads to induction of PNAd expression and recruitment of L-selectin+ memory T cells into the mucosa.32 The development of a B cell response requires interaction with helper T cells via cell surface molecules expressed by both B cells and T cells and cytokines secreted by T cells.33,34 Two sets of co-stimulatory molecules have been shown to be essential for effective T cell/B cell communication. These are CD28 expressed by T cells and its ligands CD80 and CD86 expressed by B cells as well as other antigen-presenting cells35-37 and CD40 expressed by B cells and its ligand CD40L expressed by activated T cells.38-41 Our results have shown that the co-stimulatory molecules necessary for effective B cell/T cell interaction are expressed in MALT lymphomas. Neoplastic B cells in all cases studied were positive for CD40 whereas substantial CD40L expression was seen in low-grade MALT lymphomas. Our previous in vitro studies have shown that blocking antibodies against CD40L inhibits H. pylori-mediated proliferation of MALT lymphoma cells.19 CD40L expression by TILs and CD40 expression by neoplastic B cells in vivo in MALT lymphomas suggests that CD40/CD40L plays an important role in growth of low-grade MALT lymphomas. Lack of CD40L

Figure 7. The PCR amplification products obtained with V-yI+VyII/IV and Jy1/2 primers in ethidium-bromide-stained polyacrylamide gels. M, markers (arrowhead indicates 100 bp); T, positive control T-cell lymphoma; N, negative control; la-2-5-8-10, five different cases of MALT lymphoma.

expression in the majority of high-grade tumors implies the function of TILs in high-grade tumors could be different. Unlike low-grade B-cell MALT lymphomas, highgrade MALT lymphomas do not respond to H. pylori stimulation,4 and examination of the immunoglobulin heavy chain shows no intraclonal variation.42'43 These findings suggest that factors other than T cell help, such as accumulation of p53 mutations, are more important in growth of high-grade tumors.44 CD28, the co-stimulatory molecule that is very important in T cell activation, was expressed by the great majority of TILs and the ligands for CD28, CD80, and, in one-half of the cases, CD86 were expressed by the neoplastic B cells. This is in contrast with nodal follicular lymphomas where low levels of CD80/86 expression has been demonstrated.45 We have previously shown that proliferation of the cells from gastric MALT lymphomas can be induced by incubation with H. pylori.4 This response has been shown to be strain and site specific, suggesting an antigen-specific interaction. The proliferation depends on the presence of T cells, indicating that T cells are responding to H. pylori-related antigens. Preliminary studies show that the TIL response is dependent on the antigen presentation via MHC class 11 molecules expressed by neoplastic .I,ll

STOMCH

ClI

VyI V1YI

prlimer

AC CTGG

ACCTGG pCimerPCimer- ACCTGGGACGGG

VyI Primer

primerVyI primer-

AGTAGTGATTGGATCAAGACGTTTGCAAAAG -JpII IIPrimer Primer

AC AC

ACCTGGGACGGG

TCG

Vyl VyI primerprime- ACC VyI

ACATCGCCGGGA ACTCCCTGGGG

TAGTAGTGATTGGATCAAGACGTTTGCAAAAG-JpI/II GTAGTGATTGGATCAAGACGTTTGCAAAAG JpI /II AGTGATTGGATCAAGACGTTTGCAAAAG-Jpl/II AGTAGTGATTGGATCAAGACGTTTGCAAAAG-JpI/II CTA AGTAGTGATTGGATCAAGACGTTTGCAAAAG-Jpl/II CGCTA ATACCACTGGTTGGTTCAAGATATTTGCTGAAG-JpI/II ACTGGTTGGTTCAAGATATTTGCTGAAG-JpI/II CTTG GTGTCCCGGTCCGT GTAGTGATTGGATCAAGACGTTTGCAAAAG-JpI/II GTCCGATCACAGAT ATAGTAGTGATTGGATCAAGACGTTTGCAAAAG-JpI/II

ACCTGGG ACCTGGGACGG ACCTGGGATG

ACCTGGGATAG

CGAGGAGG TTC ACACCGGG

Pri mer Primer P,,imer Primer Primer Primer Primer

Primer GTAGTGATTGGATCAAGACGTTTGCAAAAG-JpI/II Prime GATTGGATCAAGACGTTTGCAAAAG-Jpl/II Primer TGGTTGGTTCAAGATATTTGCTGAAG-JpI/II Primer

VyI primer- ACCTGGGATAGG CTGAACAGGATGGGGTATGG VyI pr imr - ACCTGGGACGGG ACCGAAGAGTACGAA

I / 15 1/ 15 1 / 15 1 / 15 1 / 15 1 / 15 1 / 15 1 / 15 2 / 15 2 / 15 1 / 15 1 / 15 1 / 15

SMLL INTESITINE

VlyI primer- ACCTGGGA VWI primer- ACCTGGGAC VyI primer- ACCT

vWI

VyI VyI VyI VyI VyI VyI

6.06W,

U

__e

.; .5

1X

Figure 6. The percentages CD3+ (shaded bars) and CD8+ (open bars) cells expressing Ki67. The average of four counts + SE is shown. Cases 9 and 12 were not studied.

primerprimerprimerprimerprimerpCimerprime-

ACCTGGGATGGG ACC ACCTGGG ACCTGGGATGGG ACCTGGG ACCT ACCTGGGACA

TGGTTG

TAAAGA CCCCGGCTAAGGG CGAGGG CGATGG CA AT CTGGGCGAGGGG ACAGGGC AAGTCT

GTAGTGATTGGATCAAGACGTTTGCAAAG -JpI/II PrCim-r AGTGATACAlAGACGTTTYCAAAAG-JpI /lII Primer

AGTGATTGAITCAAGACGTTTGCAAAAG-JpI/II PrCimer

TGATT'GGTTCAAGATATTT2CTGAAG-JpI//II TAGTAGTGATTGGATCAAGACGTTTGCAAAG-Jp/I/II

Primer Primer AGTAGTGATTGGATCAAGACGTTTGCAAAAG-JpI II Primer ACCACTGGTTGGTTCAAGATATTTGCTGAAG -JpI/I Pr imer

TGGTTGGTTCAAGATATTTGCTGAAG-JpI/II Pr/imer TTGGATCAAGACGTTTCAAAAG- JpI II Pr ime.

ACTGGTTGGATCAAGACGTTTGCAAAAG-JpI/II Primer

1 / 11

1 / 11 1/11

1/11 2 /11 1/11 1/11 1/ 11 1/11 1/11

Figure 8. T-cell receptor y-chain sequences (V-N-J) obtained from gastric and intestinal tumors of case 1 after PCR amplification with VyI+VyIII/IV and Jpyl/2 primers. The frequency of each given sequence over the total number of clones sequenced in each site is shown.


1359


B cells and possibly by other antigen-presenting cells.46 On the other hand, neoplastic B cells recognize autoantigens within the local microenvironment47 but, possibly, not H. pylori and proliferate with help from H. pylori-activated T cells. If TILs are responding to a limited number of H. py/ori-related antigens, an oligoclonal expansion could be expected, and one study has suggested the presence of such a clonal expansion in TILs in a highgrade MALT lymphoma.48 In contrast, in this study we observed that TIL populations in MALT lymphoma were polyclonal. The panel of antibodies used against different T-cell receptor V,B families recognize approximately 45% of the T-cell V13 repertoire, and the PCR method detects approximately 80% of monoclonal T cell populations. Therefore, it is theoretically possible that an oligoclonal expansion may have been missed. However, we think it is unlikely as no evidence of oligoclonality was observed with either method in any of the cases studied. A more likely explanation is the dilution of antigen-specific T cell clones in the presence of large numbers of nonspecific reactive T cells. Induction of PNAd expression on HEVs and recruitment of large numbers of L-selectin+ T cells into the tumor may account for this. Additional studies investigating the clonal diversity of activated T cells isolated from MALT lymphomas are necessary to show oligoclonal expansion of TILs in MALT lymphomas.

Acknowledgment

11. 12. 13. 14. 15.

16.

17.

18.

19.

20.

We thank Dr. D. Ringler of LeukoSite Inc. for the generous gift of monoclonal antibody Act-1. 21.

References 22.

1. Wotherspoon AC, Ortiz Hidalgo C, Falzon MR, Isaacson PG: Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet 1991, 338:1175-1176 2. Doglioni C, Wotherspoon AC, Moschini A, de Boni M, Isaacson PG: High incidence of primary gastric lymphoma in northeastern Italy. Lancet 1992, 339:834-835 3. Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA, Jellum E, Orentreich N, Vogelman JH, Friedman GD: Helicobacter pylori infection and gastric lymphoma. N Engl J Med 1994, 330:1267-1271 4. Hussell T, Isaacson PG, Spencer J: Proliferation and differentiation of tumour cells from B-cell lymphoma of mucosa-associated lymphoid tissue in vitro. J Pathol 1993, 169:221-227 5. Wotherspoon AC, Doglioni C, Diss TC, Pan L, Moschini A, de Boni M, Isaacson PG: Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacterpylori. Lancet 1993, 342:575-577 6. Bayerdorffer E, Neubauer A, Rudolph B, Thiede C, Lehn N, Eidt S, Stolte M: Regression of primary gastric lymphoma of mucosa-associated lymphoid tissue type after cure of Helicobacterpylori infection: MALT Lymphoma Study Group. Lancet 1995, 345:1591-1594 7. Roggero E, Zucca E, Pinotti G, Pascarella A, Capella C, Savio A, Pedrinis E, Paterlini A, Venco A, Cavalli F: Eradication of Helicobacter pylori infection in primary low-grade gastric lymphoma of mucosaassociated lymphoid tissue. Ann Intern Med 1995, 122:767-769 8. Isaacson PG, Spencer J: Malignant lymphoma of mucosa-associated lymphoid tissue. Histopathology 1987, 11:445-462 9. Spencer J, MacDonald TT, Diss TC, Walker Smith JA, Ciclitira PJ, Isaacson PG: Changes in intraepithelial lymphocyte subpopulations in coeliac disease and enteropathy associated T cell lymphoma (malignant histiocytosis of the intestine). Gut 1989, 30:339-346 10. Dogan A, Dunn-Walters DK, MacDonald TT, Spencer J: Demonstra-

23. 24. 25. 26. 27.

28. 29.

30.

31.

32.

tion of local clonality of mucosal T cells in human colon using DNA obtained by microdissection of immunohistochemically stained tissue sections. Eur J Immunol 1996, 26:1240-1245 Smith SH, Brown MH, Rowe D, Callard RE, Beverley PC: Functional subsets of human helper-inducer cells defined by a new monoclonal antibody, UCHL1. Immunology 1986, 58:63-70 Wang J, Isaacson PG, Spencer J: Immunohistochemical analysis of T cell proliferation in normal tonsil and B cell lymphoma. J Clin Pathol 1995, 48:873-875 McCarthy KP, Sloane JP, Kabarowski JH, Matutes E, Wiedemann LM: The rapid detection of clonal T-cell proliferations in patients with lymphoid disorders. Am J Pathol 1991, 138:821-828 Diss TC, Watts M, Pan L, Linch D, Isaacson PG: The polymerase chain reaction in the demonstration of monoclonality in T cell lymphomas. J Clin Pathol 1995, 48:1045-1050 Jacob MC, Piccinni MP, Bonnefoix T, Sotto MF, Couderc P, Bensa JC, Sotto JJ: T lymphocytes from invaded lymph nodes in patients with B-cell-derived non-Hodgkin's lymphoma: reactivity toward the malignant clone. Blood 1990, 75:1154-1162 Luna Fineman S, Lee JE, Wesley PK, Clayberger C, Krensky AM: Human cytotoxic T-lymphocytes specific for autologous follicular lymphoma recognize immunoglobulin in a major histocompatibility complex restricted fashion. Cancer 1992, 70:2181-2186 Shi I, Bonnefoix T, Heuze Le Vacon F, Jacob MC, Leroux D, Gressin R, Sotto MF, Chaffanjon P, Bensa JC, Sotto JJ: Autotumour reactive T-cell clones among tumour-infiltrating T lymphocytes in B-cell nonHodgkin's lymphomas. Br J Haematol 1995, 90:837-843 Nelson EL, Li X, Hsu FJ, Kwak LW, Levy R, Clayberger C, Krensky AM: Tumor-specific, cytotoxic T-lymphocyte response after idiotype vaccination for B-cell, non-Hodgkin's lymphoma. Blood 1996, 88: 580-589 Hussell T, Isaacson PG, Crabtree JE, Spencer J: Helicobacterpylorispecific tumour-infiltrating T cells provide contact dependent help for the growth of malignant B cells in low-grade gastric lymphoma of mucosa-associated lymphoid tissue. J Pathol 1996, 178:122-127 Berlin C, Berg EL, Briskin MJ, Andrew DP, Kilshaw PJ, Holzmann B, Weissman IL, Hamann A, Butcher EC: Alpha 4 beta 7 integrin mediates lymphocytes binding to the mucosal vascular addressin MadCAM-1. Cell 1993, 74:185-195 Erle DJ, Briskin MJ, Butcher EC, Garcia-Pardo A, Lazarovits Al, Tidswell M: Expression and function of the MadCAM-1 receptor, integrin a4f37, on human leukocytes. J Immunol 1994, 153:517-528 Shyjan AM, Bertagnolli M, Kenney CJ, Briskin MJ: Human mucosal addressin cell adhesion molecule-1 (MAdCAM-1) demonstrates structural and functional similarities to the a4137-integrin binding domains of murine MAdCAM-1, but extreme divergence of mucin-like sequences. J Immunol 1996, 156:2851-2857 Hamann A, Andrew DP, Jablonski-Westrich D, Holzmann B, Butcher EC: Role of a4-integrins in lymphocyte homing to mucosal tissues in vivo. J Immunol 1994, 152:3282-3293 Picker LJ, Butcher EC: Physiological and molecular mechanisms of lymphocyte homing. Annu Rev Immunol 1992, 10:561-591 Butcher EC, Picker LJ: Lymphocyte homing and homeostasis. Science 1996, 272:60-66 Michie SA, Streeter PR, Bolt PA, Butcher EC, Picker W: The human peripheral lymph node vascular addressin: an inducible endothelial antigen involved in lymphocyte homing. Am J Pathol 1993,143:1688-1698 Berg EL, McEvoy LM, Berlin C, Bargatze RF, Butcher EC: L-selectin mediated lymphocyte rolling on MadCAM-1. Nature 1993, 366:695-698 Gallatin WM, Weissman IL, Butcher EC: A cell-surface molecule involved in organ-specific homing of lymphocytes. Nature 1983, 304: 30-34 Kanof ME, Strober W, Fiocchi C, Zeitz M, James SP: CD4 positive Leu-8 negative helper-inducer T cells predominate in the human intestinal lamina propria. J Immunol 1988, 141:3029-3036 Farstad IN, Halstensen TS, Lazarovits Al, Norstein J, Fausa 0, Brandtzaeg P: Human intestinal B-cell blasts and plasma cells express the mucosal homing receptor integrin a4,/7. Scand J Immunol 1995, 42:662-672 Schweighoffer T, Tanaka Y, Tidswell M, Erie DJ, Horgan KJ, Luce GE, Lazarovits Al, Buck D, Shaw S: Selective expression of integrin a407 on a subset of human CD4+ memory T cells with hallmarks of guttrophism. J Immunol 1993, 151:717-729 Salmi M, Granfors K, MacDermott R, Jalkanen 5: Aberrant binding of

1360

Koulis et al


33. 34.

35. 36. 37. 38. 39. 40.

41. 42.

lamina propria lymphocytes to vascular endothelium in inflammatory bowel diseases. Gastroenterology 1994, 106:596-605 Parker DC: T cell-dependent B cell activation. Annu Rev Immunol 1993, 11:331-360 Clark EA, Ledbetter JA: How B and T cells talk to each other. Nature 1994, 367:425-428 Linsley PS, Ledbetter JA: The role of the CD28 receptor during T cell responses to antigen. Annu Rev Immunol 1993, 11:191-212 June CH, Bluestone JA, Nadler LM, Thompson CB: The B7 and CD28 receptor families. Immunol Today 1994, 15:321-331 Lenschow DJ, Walunas TL, Bluestone JA: CD28/B7 system of T cell costimulation. Annu Rev Immunol 1996, 14:233-258 Noelle RJ, Ledbetter JA, Aruffo A: CD40 and its ligand, an essential ligand-receptor pair for thymus-dependent B-cell activation. Immunol Today 1992, 13:431-433 Banchereau J, Bazan F, Blanchard D, Briere F, Galizzi JP, van Kooten C, Liu YJ, Rousset F, Saeland S: The CD40 antigen and its ligand. Annu Rev Immunol 1994, 12:881-922 Grewal IS, Flavell RA: A central role of CD40 ligand in the regulation of CD4+ T-cell responses. Immunol Today 1996, 17:410-414 Foy TM, Aruffo A, Bajorath J, Buhlmann JE, Noelle RJ: Immune regulation by CD40 and its ligand GP39. Annu Rev Immunol 1996, 14:591-617 Du MQ, Diss TC, Xu CF, Peng HZ, Isaacson PG, Pan LX: Ongoing

43. 44. 45.

46.

47.

48.

mutation in MALT lymphoma immunoglobulin VH gene suggests that antigen stimulation plays a role in the clonal expansion. Leukemia 1996, 10:1190-1197 Du MQ, Xu CF, Diss TC, Peng HZ, Wotherspoon AC, Isaacson PG, Pan LX: Intestinal dissemination of gastric mucosa-associated lymphoid tissue lymphoma. Blood 1996, 88:4445-4451 Du MQ, Peng HZ, Singh N, Isaacson PG, Pan LX: The accumulation of p53 abnormality is associated with progression of mucosa-associated lymphoid tissue lymphoma. Blood 1995, 86:4587-4593 Schultze JL, Cardoso AA, Freeman GJ, Seamon MJ, Daley J, Pinkus GS, Gribben JG, Nadler LM: Follicular lymphomas can be induced to present alloantigen efficiently: a conceptual model to improve their tumor immunogenicity. Proc Natl Acad Sci USA 1995, 92:8200-8204 Finn T, Spencer J, Koulis A, Isaacson PG, Dogan A: Cyclosporin A inhibits in vitro proliferation of low grade gastric B-cell lymphoma of mucosa-associated lymphoid tissue (MALT). J Pathol 1997, 181 (Suppl):9A Hussell T, Isaacson PG, Crabtree JE, Dogan A, Spencer J: Immunoglobulin specificity of low grade B cell gastrointestinal lymphoma of mucosa-associated lymphoid tissue (MALT) type. Am J Pathol 1993, 142:285-292 Yumoto N, Araki A, Sumida T, Saito T, Taniguchi M, Mikata A: Restricted V13 gene usage of tumour-infiltrating T lymphocytes in primary gastric malignant B-cell lymphoma. Virchows Arch 1995, 426:11-18