TISSUE ENGINEERING Volume 12, Number 6, 2006 © Mary Ann Liebert, Inc.
Chemotactic Migration of Human Mesenchymal Stem Cells and MC3T3-E1 Osteoblast-Like Cells Induced by COS-7 Cell Line Expressing rhBMP-7 DONG HEE LEE,1 BONG JOO PARK,2 MIN-SUB LEE,1 JIN WOO LEE,3,4 JEONG KOO KIM,5 HYEONG-CHEOL YANG,6 and JONG-CHUL PARK1,4
ABSTRACT During bone development, remodeling, and repair, bone morphogenetic proteins (BMPs) induce the differentiation of mesenchymal progenitor cells (MPCs) that enter into the osteoblastic lineage, and enhance the recruitment of MPCs and osteogenic cells. The process of migration is believed to be regulated, in part, by growth factors stored within the bone matrix, which are released by bone resorption. In this study, primary human mesenchymal stem cells (hMSCs) and MC3T3-E1 osteoblasts were examined for chemotaxis in response to recombinant human BMP-7 (rhBMP-7) produced in COS-7 cells (co-culture system). In order to produce BMP-7 transfected cells (BTCs), which serve as suppliers of rhBMP-7 under in vitro culture conditions, the encoding DNA was transferred into the pTARGET expression vector and introduced into COS-7 cells by conventional genetic engineering techniques. In cell culture studies, the rhBMP-7 produced in BTCs stimulated the specific activity of ALP, the production of cAMP in response to PTH, and the synthesis of osteocalcin. Migration assays were conducted with a computer-aided time-lapse video-microscopy system, to allow the rapid and precise analysis of cell migration and for the dynamic measurement of cell position and morphology. The migration distance and speed of the MC3T3-E1 cells, or hMSCs, co-cultured with BTCs, using a band-type seeding method, were significantly increased (p 0.001), compared to those of the MC3T3-E1 cells (or hMSCs) only. In conclusion, these studies revealed that rhBMP-7 plays a role in the migration of bone-forming cells, and that the co-culture model (co-culture of bone-forming cells with BMP-7-producing cells) using a computer-aided, time-lapse video-microscopy system, is useful for the chemotactic migration assay of other chemotactic growth factors. INTRODUCTION
H
OMEOSTATIC TURNOVER of bone is believed to be reg-
ulated in part by growth factors present in the surrounding environment. The first step of the bone formation process is the recruitment of osteoblasts from the
surrounding intact bone to the resorption site.1–3 Therefore, the chemotactic activity and migration of osteoblasts to growth factors, such as bone morphogenetic proteins (BMPs),4,5 transforming growth factor- (TGF-),6 and platelet-derived growth factor (PDGF)7 have been demonstrated.
1Department
of Medical Engineering, Yonsei University College of Medicine, Seoul, Korea. United Graduate School of Veterinary Sciences, Gifu University, Gifu, Japan. 3Department of Orthopedic Surgery, Yonsei University College of Medicine, Seoul, Korea. 4Brain Korea 21 Project for Medical Sciences, Yonsei University, Seoul, Korea. 5Department of Biomedical Engineering, College of Biomedical Science and Engineering, Inje University, Kimhae, Korea. 6Department of Dental Biomaterials Science, College of Dentistry, Seoul National University, Seoul, Korea. 2The
1577
LEE ET AL.
1578
Previously, many studies have shown that BMPs, TGF-, and PDGF stimulated the migration of various bone cell strains in a dose-dependent manner.8–11 These results additionally suggest that BMPs, TGF-, and PDGF may participate in the recruitment of osteoblasts during bone healing and bone remodeling because these growth factors are found in bone matrix and could be released during osteoclastic bone resorption. BMPs are part of the TGF-1 superfamily and have been shown to directly induce ectopic bone formation in a rat subcutaneous bone induction model. BMPs play important roles in the migration of progenitor cells, proliferation of mesenchymal stem cells (MSCs), differentiation to chondrogenic or osteogenic cells, vascular invasion, and bone remodeling.2,3 These data support the theory that BMPs take part in the initiation of the bone healing response. During the early phases of bone induction, monocytes are observed, and BMPs have been shown to stimulate their chemotaxis. It could be speculated that BMPs also stimulate the migration of differentiated osteoblasts toward areas of bone formation with high levels of BMPs, thereby increasing the number of cells capable of forming bone.12,13 It is well known that the chemotactic effects of BMP-2 are found in human osteoblasts and various osteoblastic cell-lines.4,9 Until now, no information has been available as to whether BMP-7 (osteogenic protein-1), a member of the BMP subfamily, also has an effect on the recruitment of the MSC isolated from bone marrow, or whether these cells become responsive to chemoattractants at a later stage of their differentiation. The aim of this study was to assess and quantify the chemotactic effects of recombinant human BMP-7 (rhBMP-7) on primary human MSC (hMSC), compared to MC3T3-E1 osteoblasts, using a computer-aided, time-lapse video-microscopy system. To demonstrate that MC3T3-E1 osteoblasts (or hMSCs) show direct migration phenomenon on the culture plate, a coculture system of osteoblasts (or hMSCs) with BMP-7producing cells was attempted and the resultant chemotactic effects were analyzed by individual-cell migration assay using time-lapse microscopy. In addition, these findings could be experimentally utilized for the development of biomaterials that are modified to enhance migration and attachment of the specific cell populations, which repair or replace the damaged tissue.
MATERIALS AND METHODS Materials An inverted microscope (model IX70, Olympus Optical Co., Ltd., Tokyo, Japan), with a color charge-coupled device camera (CCD; model VCC-3974, SANYO Electric Co., Ltd., Osaka, Japan), was purchased from Techsan Medical Co., Ltd. (Seoul, Korea). A video recording
system, with a videocassette recorder (VCR; model SV-G577L) and color line monitor (model SMP-151), was purchased from SAMSUNG Electronic Co., Ltd. (Suwon, Korea). A Meteor-II frame grabber card was purchased from Matrox Electronic Systems Ltd. (Dorval, Quebec, Canada). A temperature controller (model DX4), consisting of two temperature sensors and a heating tape 100-cm long, was purchased from Hanyoung Co. (Seoul, Korea). A Mini pump (model MP-603T), produced by SIBATA Scientific Technology Ltd. (Tokyo, Japan), was supplied from the National Institute of Health Sciences (Tokyo, Japan). All reagents were purchased from Sigma-Aldrich Co. (St. Louis, MO) or GIBCO-BRL (Grand Island, NY) unless otherwise noted.
Cell cultures COS-7 cells were obtained from the American Type Culture Collection (Rockville, MD), and maintained in Dulbecco’s modified Eagle’s medium (DMEM), containing 4.5 g/L glucose, 10% fetal bovine serum (FBS) and antibiotic-antimycotic solution (100 U/mL of penicillin-G and 100 g/mL of streptomycin). MC3T3-E1 cells (RIKEN Cell Bank, Ibaraki, Japan) were maintained in minimum essential medium alpha modification (MEM), containing 10% FBS, antibiotic-antimycotic solution, 20 mM L-glutamine and 25 mM HEPES buffer, at 37°C in a humidified atmosphere (5% CO2/95% air). The hMSCs were isolated as previously described.14 A syringe, containing 3000 units of heparin, was used to aspirate 2–8 mL of bone marrow from the posterior iliac crest of healthy adult donors. The bone marrow was obtained from patients with the approval of the Institutional Review Board (IRB). DMEM-low glucose (DMEM-LG) was added to the aspirate and a cell pellet produced by centrifugation. The pellet was fractionated on a density gradient generated by centrifuging 25, 50, and 75% Percoll solutions (Amersham Pharmacia, Piscataway, NJ), at 3000 rpm, for 20 min. The middle portion of the 50% and 75% gradient was collected. The human MSC medium consisted of DMEM-LG supplemented with 10% FBS and a 1% antibiotic-antimycotic solution. During the primary culture, adherent cells formed colonies, which were removed when they had covered approximately 90% of the tissue culture flask. The hMSC phenotype was proven by FACS analysis, with CD29, CD44, and CD105 (positive), as well as CD14, CD34, and CD45 (negative). The labeled cells were analyzed on a FACScan, by collecting 10,000 events using the Cell-Quest software program (Becton-Dickinson Instrument, San Jose, CA).
Preparation of BMP-7 transfected cells (BTCs) COS-7 cells, secreting rhBMP-7, were established as previously described.15 Briefly, cDNA molecules encod-
CHEMOTACTIC MIGRATION OF hMSCs AND MC3T3-E1 CELLS ing the hBMP-7 were synthesized by a polymerase chain reaction method using two primers (5’GCTAGGATCCCCTC TGCCACCTGGGGCGGTGC and 5’GCTAGTCGACGCCCCAAAGGGTCTGAATTCTCG) that recognize the 5’ starting and the 3’ ending regions of the cloned cDNA of BMP-7, respectively. The amplified cDNA was inserted into a pUC19 vector. A 1.5-kbp SalI/BamHI fragment was recovered and inserted into the expression vector, pTARGET (Promega, Madison, WI). The COS-7 cells were transfected with SuperFectTM transfection reagent (QIAGEN Inc., Valencia, CA), and stable BMP-7 transformants were selected by their resistance to the drug G418 and then subcultured. Two liters of conditioned medium, containing 0.5% FBS, was diluted with 2 volumes of 9 M urea and 20 mM HEPES at pH 7.0 and applied to a S-Sepharose column containing 50 mM NaCl, which had been equilibrated with 6 M urea and 20 mM HEPES at pH 7.0. After washing with the equilibration buffer, step elution of the bound protein was accomplished by using the same buffer, containing 100 and 300 mM NaCl. Ammonium sulfate was added to the 300 mM NaCl fraction to give a concentration of 1.0 M ammonium sulfate, which was then applied to a phenylSepharose column, pre-equilibrated with 6 M urea, 1.0 M ammonium sulfate, 0.3 M NaCl, and 20 mM HEPES, at pH 7.0. After washing with the equilibration buffer, the column was step-eluted with the same buffer, containing 0.6 M aqueous ammonium sulfate. The protein was eluted with distilled water, then sequentially dialyzed against distilled water, 30% acetonitrile, and 0.1% trifluoroacetic acid, and finally subjected to reverse-phase high-performance liquid chromatography on a C18 column, as described previously.16 The fractions containing the rhBMP-7, as determined by Western blot analysis and by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), were pooled. The specific polyclonal anti-human BMP-7 antibody (Peptron Inc., Daejoun, Korea) was produced from a rabbit immunized with purified epitide (epitope sequence of hBMP-7, STGSKQRSQNRSKTC), conjugated with KLH through the sulfhydryl group, using the maleimidobenzoic acid-N-hydroxysuccinimide ester (MBS) coupling method. The purity of the rhBMP-7 was determined by gel scanning densitometry.
Biological assay of BMP activity The biological activity of the rhBMP-7 was assayed, using MC3T3-E1 cells, for the osteogenic differentiation markers; i.e., osteocalcin and the production of alkaline phosphatase (ALP) and cAMP in response to parathyroid hormone (PTH). The ALP activity was measured using a commercial assay kit (Sigma-Aldrich Co.). The cells were lysed by sonication in 0.05% Triton X-100 and phosphatebuffered saline for 60 s at room temperature. The total
1579
cellular ALP activity in the lysates was measured in a 2-amino-2-methyl-1-propanol buffer (pH 10.3) at 37°C, with p-nitrophenyl phosphate as the substrate. The reactions were terminated by the addition of 0.5 M NaOH. The absorbance of the reaction was measured at 405 nm using a microplate reader (Molecular Devices, Sunnyvale, CA). The total protein level in the lysates was measured according to the Bradford assay, using bovine serum albumin as a standard, with the activity expressed in nanomoles of p-nitrophenol liberated per microgram of total cellular protein. To determine the production of cAMP in response to PTH, the cells were pre-incubated for 20 min in a culture medium containing 0.5% bovine serum albumin and 1 mM 3-isobutyl-1-methylxanthine. The pre-incubation medium was removed and each well incubated for 8 min, with 200 ng/mL human PTH (hPTH, Sigma-Aldrich Co.) dissolved in the same culture medium. The cAMP concentration in the cell layer was determined by a radioimmunoassay, using a cAMP assay kit (PerSeptive Biosystems, MA). The osteocalcin concentrations in the conditioned medium samples were measured by a radioimmunoassay, using mouse osteocalcin reagents (Biomedical Technologies, Inc., Stoughton, MA). The total DNA content in the cell layer was determined by a fluorometric assay, based on the reaction of m-diaminobenzoic acid dihydrochloride (DABA˛2HCl) with free deoxyribose, as previously described.17 In brief, the DNA concentration in a 5% trichloroacetic acid-precipitated cell layer, was determined against standard calf thymus DNA, using a fluorescence spectrophotometer (Hitachi F-2000, Hitachi Instruments, Inc., Japan), with fluorescence emission and excitation at 500 and 408 nm, respectively. The osteocalcin production was expressed in nanograms of mouse osteocalcin in the conditioned medium per microgram of cell layer DNA.
Computer-aided time-lapse video-microscopy system A computer-aided, time-lapse video-microscopy system was designed and developed for the tracking and rapid examination of a single cell migration, as shown in Fig. 1. In order to incubate the cells on the stage of an inverted microscope, a CO2 mini-incubator (150 130 40 mm) was designed and fabricated with a double-layered acrylic plate. There were two temperature sensors and a heating-tape, for monitoring and maintaining the temperature of the mini-incubator at 36 1°C. The two temperature sensors were connected to a temperature controller and a multimeter, and the heating-tape was coiled, using the Helmholtz coiling method, to provide a minimal electrical field in the CO2 mini-incubator. For the supply of CO2, the fabricated CO2 mini-incubator was connected to a commercial CO2 incubator
LEE ET AL.
1580
Removing silicon rubber
Cell seeding & attachment
Cell culture in CO2 mini incubator CO2 IN Light Source
CO2 Incubator CO2 OUT
Mini Incubator
Mini Pump
Phase Contrast Objective
Multi Tester
Temperature Controller Image acquisition & cell tracking
CCD Camera
Real-time observation
FIG. 1. Experimental procedure of individual-cell migration assay and schematic diagram of the computer-aided time-lapse video-microscopy system. The procedure for cell migration assay was performed as follows: Cells were plated using the bandtype seeding method, with a width of 380 m. The seeded cells were cultured at 37°C in a humidified atmosphere for 30 min, and the attached cells were cultured in the self-designed CO2 mini-incubator placed on the microscope stage for 24 h. Finally, the images were captured using the computer-assisted cell-tracking system. (Color images are available online at ).
(MCO-15AC, Sanyo Electric Co., Ltd., Osaka, Japan) through a mini-pump.
Individual-cell migration assay using time-lapse microscopy This present study attempted to assess the chemotactic effect of rhBMP-7 released from BTCs on osteoblasts (MC3T3-E1) and hMSCs, and to evaluate the effect on migration of MC3T3-E1 cells and hMSCs by BTCs. Five different experimental conditions were designed: (1) culture of MC3T3-E1 cells (or hMSCs) alone, in normal medium; (2) culture of MC3T3-E1 cells (or hMSCs) alone, in BTCs-cultured medium; (3) culture of MC3T3E1 cells (or hMSCs) alone, in rhBMP-7-treated medium; (4) co-culture of MC3T3-E1 cells (or hMSCs) and COS-7 cells, in normal medium; and (5) co-culture of MC3T3-E1 cells (or hMSCs) and BTCs, in normal medium (Fig. 2). MC3T3-E1 cells (or hMSCs) and BTCs (as BMP-7 producing cells) were plated using the band-type seeding method, respectively. Silicon rubber (thickness, 0.5 mm) with two holes (rectangle-type; WLH, 380 m
20 mm 2.5 mm) at a certain distance of 20 mm, was placed on a tissue culture–treated glass slide (BD Biosciences, Bedford, MA), and MC-3T3-E1 (or hMSC) and COS-7 (or BTC) cells were simultaneously plated into the first and second hole at 1 105 cells/cm2. Plated cells were incubated for attachment at 37°C in a humidified atmosphere (5% CO2/95% air) for 30 min. Silicon rubber was cautiously removed from the glass surface. The attached cells were cultured for 24 h in the newly designed, chambered cover-glass CO2 mini-incubator, placed on the stage of an inverted microscope. The microscopic examination of the adherent cells, by timelapse video-graph, allows for direct measurement of the extent of cell migration. For determination of the migration speed and distance, the cells were viewed with a 4 phase-contrast lens and video recordings were made, using a color CCD camera attached to the inverted microscope. Images were captured on a computer system, using a color CCD camera mounted on an inverted microscope with a frame grabber installed and saved in 8-bit full-color mode, under the control of Matrox intellicam software (version 2.06, Matrox Electronic Systems Ltd., Quebec, Canada). The size of the captured images
CHEMOTACTIC MIGRATION OF hMSCs AND MC3T3-E1 CELLS
A
1581
Statistics All experiments were performed in triplicate and the mean value used for the statistical analysis. The levels of significance were determined by one-way analysis of variance or Student’s t-tests. All statistical calculations were performed using the SPSS system for Windows (version 8.0, SPSS Inc., Chicago, IL). P values from the
D MC3T3-E1 cells (or hMSCs) in normal medium
B
MC3T3-E1 (or hMSCs) +COS-7 cells in normal medium
A E
Cell movement path 1200 Auto Manual
MC3T3-E1 cells (or hMSCs) in BTC cells-cultured medium
1250
MC3T3-E1 (or hMSCs) +BTC cells in normal medium
Distance [µm]
C
MC3T3-E1 cells (or hMSCs) in rhBMP-7-treated medium
was in the order of 640 480 pixels. An image processing procedure was performed as follows: the captured 8-bit color images were incorporated into image analysis software, programmed by MATLAB V5.3 (The MathWork Inc., USA) and Visual BASIC V6.0 languages (MicroSoft, Redmond, WA) and transformed into gray scale images. The digitized gray scale images of the cells expressed a poor range of gray-level values. Therefore, imaging techniques to reduce the noise and enhance the gray-level values were implemented. To enhance the morphology of the cells, contrast stretching and histogram equalization was applied. From the histogram equalization images, the edge points of each cell were detected by the Canny method, which is less likely to be “fooled” by noise, and therefore more likely to detect true weak edges. After edge detection, an appropriate cell was selected for continuous observation. The computer-based image-processing software, including the capture program to choose the capture interval and period, and analysis techniques were developed for quantitative analysis of cell migration, and were compared with image-processing method by the manual method (Fig. 3).
1350
1400
1450 1300 1320 1340 1360 1380 1400 1420 1440 1460 1480 1500
Distance [µm]
B
Cell movement speed 12 Auto Manual
10
Speed [µm/min]
FIG. 2. The experimental conditions for the cell migration assay; (A) culture of MC3T3-E1 cells (or hMSCs) alone, in normal medium, (B) culture of MC3T3-E1 cells (or hMSCs) alone, in BTCs-cultured medium, (C) culture of MC3T3-E1 cells (or hMSCs) alone, in rhBMP-7-treated medium, (D) co-culture of MC3T3-E1 cells (or hMSCs) and COS-7 cells, in normal medium, and (E) co-culture of MC3T3-E1 cells (or hMSCs) and BTCs, in normal medium. (Color images are available online at ).
1300
8
6
4
2
0 0
500
1000
1500
Time [min]
FIG. 3. Computer-assisted cell tracking system. The cells were observed in the self-designed CO2 mini-incubator placed on the microscope stage for 24 h, and the images were captured from the CCD camera attached the inverted phase-contrast microscope. The edge point of each cell was detected, and the migration of the center was recorded with cell movement path (A), accumulated distance, and speed (B). The computer-based image processing software, including the capture program to choose the capture interval and period, and analysis techniques were developed for quantitative analysis of cell migration, and were compared with the manual image-processing method. (Color images are available online at ).
LEE ET AL.
1582
Student’s t-test less than p 0.001 were considered significant.
The PTH response was assessed by measuring cAMP production in MC3T3-E1 cells, treated for 9 days with or without rhBMP-7. rhBMP-7 significantly elevated the PTH response in the MC3T3-E1 cells compared with that in the rhBMP-7-untreated cells (Fig. 5B). The specific osteoblastic marker, osteocalcin, in the rhBMP-7-treated culture medium, was also quantified. Treatment with rhBMP-7 significantly induced 1,25(OH)2 vitamin D3-dependent osteocalcin production in MC3T3-E1 cells. To confirm the stimulatory effects of rhBMP-7 on osteocalcin production, dose–response experiments were conducted using MC3T3-E1 cells. At concentrations 20 ng/mL, rhBMP-7 significantly induced 1,25-(OH)2 vitamin D3-dependent osteocalcin production in the MC3T3-E1 cells (Fig. 5C).
RESULTS Biological assay of BMP activity The full-length rhBMP-7 cDNA clone encoding the rhBMP-7 precursor, including the signal sequence, was expressed in mammalian cells (COS-7), in order to obtain correctly processed and fully active protein. Cell clones expressing rhBMP-7 were selected by use of Western blot analysis, using rhBMP-7 specific antisera. Purification of rhBMP-7, from the COS-7-conditioned medium, yielded preparations of processed mature rhBMP-7, which were greater than 90% pure. Fig. 4 shows immunoblotted and Coomassie brilliant blue R250-stained aliquots of the purified rhBMP-7 preparations after SDS-PAGE. The COS-7 rhBMP-7 migrated as a dimer, approximately 36 kDa, which after reduction migrated at approximately 18 kDa. The effects of rhBMP-7 on the osteoblast markers, or the activities known to be associated with their cellular functions, were examined using osteoblast cultures. As shown in Fig. 5A, rhBMP-7 stimulates the ALPase specific activity in a dose-dependent manner: four- and fivefold at 50 and 100 ng/mL rhBMP-7, respectively. In a kinetic experiment, the ALPase activity in both the rhBMP-7-treated and control cultures increased gradually, with the activity in the rhBMP-7-treated culture being consistently higher throughout the culture period (data not shown).
Enhancement of osteoblast (MC3T3-E1) and hMSC migration by BTCs To evaluate the migration of osteoblasts and hMSCs due to BMP-7 activity, MC3T3-E1 cells (or hMSCs) were co-cultured with BTCs in chambered cover-glass slides for 24 h. hMSCs responded in a similar way to the osteoblasts (MC3T3-E1), as shown in Figs. 6 and 7. The cell migration distance gradually increased after 4 h and was also extended in relation to the time for both the MC3T3-E1 cells and the hMSCs. Fig. 6 shows the migration distances of the MC3T3-E1 cells and the hMSCs under different experimental conditions, and Fig. 7 shows the average migration speeds of the MC3T3-E1 cells and hMSCs. The migration distance and speed of the MC3T3-E1 cells, or hMSCs, co-cultured with BTCs in the band-type seeding method, were significantly in-
0.100 rhBMP-7 36kDa
36kDa
18kDa
Volts (280 nm)
0.075 0.050 0.025 0.000 −0.025
A
B
Intact
A
B
Reduced
2
4
6
8 10 Minutes
12
14
FIG. 4. The image on the left is a photograph showing the results of the SDS-PAGE and Western blot analysis of purified COS7 cell–produced rhBMP-7. The COS-7-conditioned media were purified as described in Materials and Methods. A pool of the active fractions of rhBMP-7, from the C18 reverse phase chromatography purification, was analyzed by SDS-PAGE, after reduction with DTT and with no reducing agent. Lanes designated as A are Coomassie brilliant blue R250-stained, and those designated as B are the immunoblots. The image on the right is a gel filtration chromatogram (Shodex OHpak SB-803 column) of rhBMP-7. (Color images are available online at ).
CHEMOTACTIC MIGRATION OF hMSCs AND MC3T3-E1 CELLS
1583
A
DISCUSSION
ALP activity (umol PNP/min/mg protein)
450 400 350 300 250 200 150 100 50 0
0
5
B
10
20
50
100
50
100
PTH response (Treated/Control)
rhBMP-7 (ng/ml) 10 9 8 7 6 5 4 3 2 1 0
0
5
C
10
20
rhBMP-7 (ng/ml)
A
500
Migration Distance (µm)
Osteocalcin (ng/ug DNA)
600
400 300 200 100 0
In this study, it was demonstrated that the MSCs and osteoblasts from bone marrow have the ability to respond to migration factors, such as BMP-7, secreted by osteoblasts and other cells in a bone marrow environment. This was shown by the inductive effect of BMP-7 on the chemotaxis and migration of mesenchymal cells (or osteoblasts), which served as a bone induction cascade. In addition, BMPs differentiate mesenchymal progenitor cells, chondroblasts, and osteoblast lineage cells, promote the expression of markers that are characteristic of the chondroblast and osteoblast phenotype, and enhance the synthesis of the extracellular matrix.18 The chemotactic properties of BMPs, PDGF-bb, basic fibroblast growth factor (bFGF), and TGF-1 have been studied in rat and human osteoblasts and mostly measured by the Boyden chamber assay using a welltype microchemotaxis chamber.4,19,20 However, the present study, which focused on an experimental method of migration assay, can be demonstrated by an analo-
700
MC3T3-E1 MC3T3-E1 + CO5-7 MC3T3-E1 + BTCs cultured medium MC3T3-E1 + rhBMP-7 MC3T3-E1 + BTCs
600 500 400
*
*
20
24
*
*
300 200
*
100 0
0
5
10
20
50
100
0
4
8
rhBMP-7 (ng/ml)
creased (p 0.001), compared to those of the MC3T3E1 cells (or hMSC) only, whereas the migration distance and speed of MC3T3-E1 cells (or hMSCs) cultured with 10 ng/mL of rhBMP-7 did not show a significant difference, compared to those of the MC3T3-E1 (or hMSC) only. Although the migration distance and speed of the MC3T3-E1 cells in an individual-cell migration assay were higher than those of the hMSCs, the patterns of the migration distance and speed were similar between the two cell types.
16
B 600 Migration Distance (µm)
FIG. 5. The effects of rhBMP-7 on the ALP activity (A), the production of cAMP in response to PTH (B), and the production of osteocalcin (C) in the MC3T3-E1 cell cultures. For the dose dependence, cells were cultured from day 1, with graded concentrations of rhBMP-7 for 9 days then harvested on day 9. The data represent the mean SD of five cultures for each treatment.
12 Time (hr)
MSCs MSCs + CO5-7 MSCs + BTCs cultured medium MSCs + rhBMP-7 MSCs + BTCs
500 400
* * *
300 *
200 100 0 0
4
8
12 Time (hr)
16
20
24
FIG. 6. The migration distances of the MC3T3-E1 cells (A) and hMSCs (B) under different experimental conditions. *p 0.001; significant differences compared to control cultures (MC3T3-E1 cells or hMSCs only). Data are means SD for three independent experiments.
LEE ET AL.
1584
A Migration Speed (µm/hr)
30
*
25 20 15 10 5 0
MC3T3-E1 MC3T3-E1 MC3T3-E1 MC3T3-E1 MC3T3-E1 + COS-7 + BTCs + BTCs + rhBMP-7 cultured medium
B Migration Speed (µm/hr)
25
*
20 15 10 5 0
MSCs
MSCs + COS-7
MSCs + BTCs cultured medium
MSCs + rhBMP-7
MSCs + BTCs
FIG. 7. The average migration speed of the MC3T3-E1 cells (A) and hMSCs (B) under different experimental conditions. *p 0.001; significant differences compared to control cultures (MC3T3-E1 cells or hMSCs only). Data are means SD for three independent experiments.
gous model to the bone marrow environment and the behavior of primary hMSCs, which can differentiate into osteoblasts, chondrocytes, adipocytes, and other cells of a mesenchymal origin. Toward this goal, a co-culture system (co-culture of bone forming cells with BMP-7producing cells) was attempted, to offer the osteoblasts (or MSCs) a condition similar to that of a bone induction model (in vivo). In order to produce BMP-7 transfected cells, which served as the supplier of rhBMP-7 under in vitro culture conditions, the encoding DNA was transferred into the pTARGET expression vector and introduced into COS-7 cells by conventional genetic engineering techniques. As predicted by its analogy to the other members of the TGF- superfamily, the rhBMP7 gene was produced as a process-matured disulfidelinked homodimer, as determined by Western blot analysis, with BMP-7 antisera and SDS-PAGE analyses, under nonreducing and reducing conditions. In the cell culture studies, the rhBMP-7 produced in the BTCs stimulated the specific activity of ALP (a marker enzyme for osteogenesis), the production of cAMP (a marker for hormonal responsiveness of osteoblasts) in response to PTH, and the synthesis of osteocalcin (a bone-specific
protein and marker of mature osteoblast activity and bone formation). Migration assays were carried out in a computer-aided time-lapse video-microscopy system, for the rapid and precise analysis of the cell migration and for the dynamic measurement of cell position and morphology. In recent years, several methods have been used for the in vitro studies of cell migration that have tracked the movement of the cells.21–24 In the future, these methods will typically employ an automated image vision approach and be used to track the movement of a single cell in many biological assays, including embryogenesis, angiogenesis, wound healing, inflammatory response, embryonic development, and tumor metastasis. It has previously been shown4,9,12 and confirmed in this study that BMPs stimulate the in vitro chemotactic migration of osteoblasts. Although previous studies used a modified Boyden chamber assay to assess the BMP (BMP-2, BMP-4, and BMP-6)-induced chemotactic migration, here, a co-culture model (co-culture of bone forming cells with BMP-7-producing cells) has been postulated and a computer-aided time-lapse videomicroscopy system was designed as a tool for a chemotactic migration assay. In the case of the Boyden chamber assay, results were expressed as a chemotactic index, giving the average number of migrated cells upon stimulation over the average number of migrated cells without stimulation.25 In this study, the migration values are presented as the migration distance and speed of the cells, which were randomly selected on the culture plate. Consequently, the migration distance of both hMSCs and MC3T3-E1 cells, co-cultured with BTCs (as BMP-7 producing cells), were observed to gradually increase after 6 h in relation to time, as shown in Figs. 6 and 7. Interestingly, the migration speeds of the hMSC (1.2fold) and MC3T3-E1 cells (1.7-fold), under the co-culture conditions with BTCs, were observed to be higher than those in the rhBMP-7-treated culture media. These results, therefore, indicate that the cell migration seen in response to rhBMP-7 was due to true chemotaxis and not chemokinesis. Generally, in the case of a modified Boyden chamber assay, a Zigmond-Hirsch checkerboard analysis26 is performed to distinguish between concentration-dependent (chemotaxis) and random cell migrations (chemokinesis). The analysis is performed after eliminating the concentration gradient, by the addition of chemoattractants to the upper chamber containing the cell suspension. In the present study, two experimental conditions were tested: (1) a culture of MC3T3-E1 cells (or hMSCs) alone, in rhBMP-7-treated medium (chemokinesis), and (2) a co-culture of MC3T3-E1 (or hMSC), with BTCs in normal medium (chemotaxis), and the results were compared to determine whether the cell migration was due to chemotaxis or chemokinesis. The re-
CHEMOTACTIC MIGRATION OF hMSCs AND MC3T3-E1 CELLS sults showed a positive chemotactic response for the hMSCs and MC3T3-E1 cells toward the rhBMP-7, which was released from BTCs in a time-dependent gradient. In the present study, the MC3T3-E1 cells were found to be more responsive to rhBMP-7-stimulated migration than normal hMSCs. These findings are somewhat different from those of Fiedler et al.,9 who reported that the response to rhBMP-4 and rhBMP-2 declined from human mesenchymal progenitor cells to the cells expressing an osteoblastic phenotype. This could indicate that the phenotypic changes of the malignant transformation, or differentiation status, affected the responsiveness to chemotactic stimuli from BMP-7 and perhaps to other growth factors also. Of course, this conflicting data may be due to the well-known differences in the biological behavior of osteoblastic cells from varying locations and species of donor tissue. Additionally, the present study has provided no evidence of such a BMP-7 receptor expression, and further studies will be required to address this question. In bone physiological events, such as healing and remodeling, BMPs have mainly been suggested to stimulate the chemotaxis of osteoblasts and the differentiation of MSC toward an osteoblastic lineage, thereby increasing the number of differentiated osteoblasts capable of forming bone.12,13 Recent studies support this hypothesis, because they have demonstrated the expressions of BMPs and their presence in the early phases of fracture healing. The present study suggests that rhBMP-7 could also participate in the chemotactic recruitment of both osteoprogenitor cells and differentiated osteoblasts. The significance of osteoblast chemotaxis, in vivo, is currently unclear, but it could be hypothesized that stimulation of chemotaxis by rhBMP-7 could be another mechanism for the recruitment of bone-forming cells, which is different from the well-established differentiative effects of rhBMP. The chemotactic recruitment of osteoprogenitor cells and osteoblasts by rhBMP-7 could be of importance during both local bone formation throughout remodeling and in the course of extensive formation in the bone-healing process. In conclusion, these studies revealed that rhBMP-7 play a role in the migration of bone-forming cells and that a co-culture model using a computer-aided timelapse video-microscopy system is useful for the chemotactic migration assay of other chemotactic growth factors.
ACKNOWLEDGMENT This research was supported by a grant (code SC13142) from the Stem Cell Research Center of the 21st Century Frontier Research Program, funded by the Ministry of Science and Technology, Republic of Korea.
1585
REFERENCES 1. Reddi, A.H. Initiation of fracture repair by bone morphogenetic proteins. Clin. Orthop. 355 Suppl., S66, 1998. 2. Reddi, A.H. Bone morphogenetic proteins: an unconventional approach to isolation of first mammalian morphogens. Cytokine Growth Factor Rev. 8, 11, 1997. 3. Okubo, Y., Bessho, K., Fujimura, K., Kusumoto, K., Ogawa, Y., and Iizuka, T. Expression of bone morphogenetic protein in the course of osteoinduction by recombinant human bone morphogenetic protein-2. Clin. Oral. Implants Res. 13, 80, 2002. 4. Lind, M., Eriksen, E.F., and Bunger, C. Bone morphogenetic protein-2 but not bone morphogenetic protein-4 and -6 stimulates chemotactic migration of human osteoblasts, human marrow osteoblasts, and U2-OS cells. Bone 18, 53, 1996. 5. Bostrom, M.P., Lane, J.M., Berberian, W.S., Missri, A.A., Tomin, E., Weiland, A., Doty, S.B., Glaser, D., and Rosen, V.M. Immunolocalization and expression of bone morphogenetic proteins 2 and 4 in fracture healing. J. Orthop. Res. 13, 357, 1995. 6. Hughes, F.J., Aubin, J.E., and Heersche, J.N. Differential chemotactic responses of different populations of fetal rat calvaria cells to platelet-derived growth factor and transforming growth factor beta. Bone Miner. 19, 63, 1992. 7. Horner, A., Bord, S., Kemp, P., Grainger, D., and Compston, J.E. Distribution of platelet-derived growth factor (PDGF) A chain mRNA, protein, and PDGF-alpha receptor in rapidly forming human bone. Bone 19, 353, 1996. 8. Lind, M., Deleuran, B., Thestrup-Pedersen, K., Soballe, K., Eriksen, E.F., and Bunger, C. Chemotaxis of human osteoblasts. Effects of osteotropic growth factors. APMIS 103, 140, 1995. 9. Fiedler, J., Roderer, G., Gunther, K.P., and Brenner, R.E. BMP-2, BMP-4, and PDGF-bb stimulate chemotactic migration of primary human mesenchymal progenitor cells. J. Cell Biochem. 87, 305, 2002. 10. Panagakos, F.S. Transforming growth factor-alpha stimulates chemotaxis of osteoblasts and osteoblast-like cells in vitro. Biochem. Mol. Biol. Int. 33, 643, 1994. 11. Tsukamoto, T., Matsui, T., Fukase, M., and Fujita, T. Platelet-derived growth factor B chain homodimer enhances chemotaxis and DNA synthesis in normal osteoblast-like cells (MC3T3-E1). Biochem. Biophys. Res. Commun. 175, 745, 1991. 12. Cunningham, N.S., Paralkar, V., and Reddi, A.H. Osteogenin and recombinant bone morphogenetic protein 2B are chemotactic for human monocytes and stimulate transforming growth factor beta 1 mRNA expression. Proc. Natl. Acad. Sci. U S A 89, 11740, 1992. 13. Cho, T.J., Gerstenfeld, L.C., and Einhorn, T.A. Differential temporal expression of members of the transforming growth factor beta superfamily during murine fracture healing. J. Bone Miner. Res. 17, 513, 2002. 14. Deans, R.J., and Moseley, A.B. Mesenchymal stem cells: biology and potential clinical uses. Exp. Hematol. 28, 875, 2000. 15. Lee, D.H., Suh, H., Han, D.W., Park, B.J., Lee, J.W., and Park, J.C. The effects of recombinant human BMP-7, pre-
1586
16.
17. 18.
19.
20.
21.
22.
pared from a COS-7 expression system, on the proliferation and differentiation of rat newborn calvarial osteoblasts. Yonsei Med. J. 44, 593, 2003. Sampath, T.K., Coughlin, J.E., Whetstone, R.M., Banach, D., Corbett, C., Ridge, R.J., Ozkaynak, E., Oppermann, H., and Rueger, D.C. Bovine osteogenic protein is composed of dimers of OP-1 and BMP-2A, two members of the transforming growth factor-beta superfamily. J. Biol. Chem. 265, 3198, 1990. Vytasek, R. A sensitive fluorometric assay for the determination of DNA. Anal. Biochem. 120, 243, 1982. Reddi, A.H. Regulation of cartilage and bone differentiation by bone morphogenetic proteins. Curr. Opin. Cell Biol. 4, 850, 1992. Godwin, S.L., and Soltoff, S.P. Extracellular calcium and platelet-derived growth factor promote receptor-mediated chemotaxis in osteoblasts through different signaling pathways. J. Biol. Chem. 272, 11307, 1997. Mayr-Wohlfart, U., Kessler, S., Knochel, W., Puhl, W., and Gunther, K.P. BMP-4 of Xenopus laevis stimulates differentiation of human primary osteoblast-like cells. J. Bone Joint Surg. Br. 83, 144, 2001. Thurston, G., Jaggi, B., and Palcic, B. Cell motility measurements with an automated microscope system. Exp. Cell Res. 165, 380, 1986. Zicha, D., and Dunn, G.A. An image processing system for cell behaviour studies in subconfluent cultures. J. Microsc. 179, 11, 1995.
LEE ET AL. 23. Shutt, D., Jenkins, L., Carolan, E., Stapleton, J., Daniels, K., Kennedy, R., and Soll, D. T cell chemoattractants: demonstration with a newly developed single cell chemotaxis chamber. J. Cell Sci. 111, 99, 1998. 24. Siegert, F., Weijer, C.J., Nomura, A., and Miike, H. A gradient method for the quantitative analysis of cell movement and tissue flow and its application to the analysis of multicellular Dictyostelium development. J. Cell Sci. 107, 94, 1994. 25. Falk, W., Goodwin, R.H. Jr., and Leonard, E.J. A 48-well micro chemotaxis assembly for rapid and accurate measurement of leukocyte migration. J. Immunol. Methods 33, 239, 1980. 26. Zigmond, S.H., and Hirsch, J.G. Leukocyte locomotion and chemotaxis. New methods for evaluation, and demonstration of a cell-derived chemotactic factor. J. Exp. Med. 137, 387, 1973.
Address reprint requests to: Jong-Chul Park Department of Medical Engineering Yonsei University College of Medicine 134 Shinchon-dong, Seodaemun-ku Seoul 120-752, Korea E-mail:
[email protected]
