Chitosan Nanoparticles Cause Pre- and Postimplantation Embryo ...

BIOLOGY OF REPRODUCTION (2013) 88(4):88, 1–13 Published online before print 6 March 2013. DOI 10.1095/biolreprod.112.107532

Chitosan Nanoparticles Cause Pre- and Postimplantation Embryo Complications in Mice1 Mi-Ryung Park,3 Sangiliyandi Gurunathan,3 Yun-Jung Choi, Deug-Nam Kwon, Jae-Woong Han, Ssang-Goo Cho, Chankyu Park, Han Geuk Seo, and Jin-Hoi Kim2 Department of Animal Biotechnology, KonKuk University, Seoul, Republic of Korea

Embryo development is a complex and tightly controlled process. Nanoparticle injury can affect normal development and lead to malformation or miscarriage of the embryo. However, the risk that these nanoparticles may pose to reproduction is not clear. In this study, chitosan nanoparticles (CSNP) of near uniform size, in the range of 100 nm, were synthesized and confirmed by a particle size analyzer and transmission electron microscopy. Morulae-stage embryo exposure to CSNP during in vitro culture caused blastocyst complications that had either no cavity or a small cavity. Furthermore, CSNP-treated embryos showed lower expression of not only trophectoderm-associated genes but also pluripotent marker genes. When blastocysts developed in both media with and without CSNP were transferred to recipients, the percentage of blastocysts resulting in viable pups was significantly reduced. These detrimental effects are linked to the reduction of total cell numbers, enhanced apoptosis, and abnormal blastocoels forming at the blastocyst stage, indicating that CSNP treatment might have long-term adverse biological effects in view of pregnancy outcome. apoptosis, caspases, Chitosan nanoparticles, implantation, mouse blastocysts

INTRODUCTION Nanotechnology plays an important role in areas such as photonics, catalysis, magnetic, materials and manufacturing, nanoelectronics, and biotechnology, including cosmetics, pharmaceutics, and medicines [1–4]. Chitosan is a nontoxic biodegradable polycationic polymer with low immunogenicity. Being a polycationic, nontoxic, biodegradable, and biocompatible polymer, chitosan has attracted much attention and has wide applications in the biotechnology, pharmaceutical, textile, food, cosmetics, and agricultural industries [5, 6]. It has been extensively investigated for formulating carrier and delivery systems for therapeutic macrosolutes [7, 8]. Moreover, cationic polymers play an important role in both membrane adhesion [9] and lysosomal escape [10] of the encapsulated DNA, 1

Supported by the Woo Jang-Choon project (PJ007849) and next generation of Biogreen 21 (PJ009107) from the Rural Development Administration (RDA), Republic of Korea. S.G. was supported by SMART-Research Professor Program of Konkuk University. 2 Correspondence: Jin-Hoi Kim, Department of Animal Biotechnology, KonKuk University, Seoul 143–701, Republic of Korea. E-mail: [email protected] 3 These authors contributed equally to this work. Received: 27 December 2012. First decision: 4 February 2013. Accepted: 21 February 2013. Ó 2013 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363

1

Article 88

Downloaded from www.biolreprod.org.

providing a potential explanation for the superiority of polymer-mediated gene transfer relative to naked DNA administration in many applications. Earlier studies [11, 12] evaluated chitosan in humanenhanced body-weight loss without caloric restriction by leading to fat excretion due to binding and trapping of dietary fat. However, there is little evidence to support the claims that, in humans, chitosan causes clinically significant fat malabsorption and that it subsequently leads to weight loss [13]. Despite the lack of supporting evidence, chitosan-based diet products continue to flourish and to be touted as safe natural products to ‘‘trap the fat.’’ In addition to diet food and the drug delivery system, another related issue is whether dietary food influences reproduction, such as ovulation and reproduction. Until now, only a few studies have explored this connection [14]. They focused mainly on the relationship between fat intake and characteristics of the menstrual cycle, such as cycle length and the duration of different phases of the cycle. Nanomedicine has long been a model favored in the future of medicine. Despite its importance in development and the need for a basic understanding of chitosan nanoparticles (CSNP), the risk these nanoparticles may pose to human health must be addressed because it has been shown that nanoparticles can be administered to the human body by several routes. Even though several studies addressing the cytotoxicity of CSNP have been reported [15–18], most studies are limited to cytotoxity according to CSNP size and cell line [15–17]. Recently, Huiying et al. [19] demonstrated that N-succinylchitosan nanoparticles (NSCNP) induces apoptosis in K562 cells by decreasing the cell zeta potential, disrupting the mitochondrial membrane potential (MMP), and increasing reactive oxygen species (ROS) generation and Ca2þ concentration. Another study shows that NSCNP induces accumulation of cytochrome c in cytosol and elevating the expression of apoptosis-promoted protein Bax while depressing the expression of apoptosis-restrained protein Bcl2 in a time- and dosedependent manner [20]. The toxicity of chitosan nanoparticles needs to be evaluated in embryo development aspects because extensive research into their biomedical applications was based largely on the biodegradable and biocompatible profile of chitosan. Recently, Hu et al. [21] reported that exposure of embryos to CSNP and ZnO nanoparticles resulted in a decreased hatching rate and increased mortality, including a bent spine, pericardial edema, and an opaque yolk in zebrafish embryos. Also, intravenous injection of silica and titanium dioxide nanoparticles with diameters of 70 and 35 nm caused pregnancy complications in mice, and these nanoparticles were found in the placenta, fetal liver, and fetal brain [22]. The effects of chitosan solutions on intestinal cells have been extensively investigated [23–25]. Absorption enhancement was found to depend on both molecular weight and degree of deacetylation. Schipper et al. [23–25] observed a modest increase in effective atenolol

ABSTRACT

PARK ET AL. days after embryo transfer, surrogate mice were killed. The frequency of implantation and numbers of fetuses were calculated as the number of implantation sites or survival per number of embryos transferred. The weights of the surviving fetuses and placenta were measured immediately after dissection.

permeability after perfusion of atenolol through rat ileal sections for 2 h with or without 250-lg/ml chitosan solutions. However, studies related to risk of CSNP nanoparticles on mammalian pre- and postimplantation embryo are limited and have not yet been studied. Here we report, for the first time, that the culture of mouse preimplantation embryos in media containing 10–200 lg/ml CSNP impaired blastocyst expansion and hatching and also resulted in higher rates of resorption after embryo transfer.

TUNEL Assay To evaluate the apoptotic response of CSNP in blastocysts, a TUNEL) assay was performed using the In Situ Cell Death Detection Kit (Roche). DAPIlabeledor TUNEL-positive nuclei were observed under a fluorescence microscope. Approximately 10 blastocysts per treatment group were used in the TUNEL assays in each independent experiment.

MATERIALS AND METHODS Materials

Measurement of Mitochondrial Membrane Potential

Sodium tripolyphosphate and five different molecular-weight chitosan, derived from crab shell, in the form of fibrils flakes were obtained from SigmaAldrich. All other chemicals were purchased from Sigma-Aldrich unless stated otherwise.

MMP was measured by staining with 5,5,6,6-tetrachloro-1,1,3,3-tetraethylbenzimidazolyl carbocyanide iodide (JC-1; Molecular Probes). Cells were incubated in CZB containing 5.0 mg/ml JC-1 for 15 min at 378C in the dark. Cells were washed with CZB, excited at 488 nm, and then observed at either 510 nm (green mitochondria) or 590 nm (red-to-orange mitochondria) with the confocal imaging system.

Preparation of CSNP CSNP were prepared as described earlier by Gan et al. [26]. Chitosan solutions of different concentration and molecular weight were prepared by dissolving purified chitosan with sonication in 0.1 M acetic acid solution until the solution was transparent. Once dissolved, the chitosan solution was adjusted to pH 3.0, 3.5, 4.0, 4.5, and 5.0 with 1 N NaOH. Tripolyphosphate (TPP) was dissolved in deionized water at the concentration 1 mg/ml. The chitosan solution was flush mixed with TPP solution, and the formation of chitosan-TPP nanoparticles was started spontaneously via the TPP-initiated ionic gelation mechanism. The nanoparticles were formed at selected pH. The nanoparticle suspensions were gently stirred for 60 min at room temperature before being subjected to centrifugation. The CSNP samples were centrifuged at 15 000 rpm for 10 min, and then the supernatant was discarded to remove free chitosan. Again the pellet was dissolved in water and sonicated undissolved residues, and nanoparticles solutions were taken for further analysis and applications. In order to distinguish between chitosan and other nanoparticle effects in blastocyst development, we used gold nanoparticles (AuNPs) with 100-nm diameter with a stabilized suspension in 0.1 mM PBS (catalog no. 753688; Sigma-Aldrich) as a benchmark.

Extraction and Amplification of mRNA

Characterization of CSNP The particle size of distribution was measured by Zetasizer Nano ZS90 (Malvern Instruments Ltd). Transmission electron microscopy (TEM; JEM1200EX) was used to determine the size and morphology of CSNP. Ten microliters of nanoparticle suspension were placed on a copper grid, the excess liquid was removed with a piece of filter paper, and then the grid was air-dried. Samples were visualized at a 300-kV setting.

Animals

Histopathological Examination of Apoptosis in Various Organs by TUNEL Assay

The mice were housed in wire cages at 22 6 18C under a 12L:12D cycle with 70% humidity and fed ad libitum. All experiments were conducted in accordance with the Konkuk University Guide for the Care and Use of Laboratory Animals (IACUC approval no. KU12045).

To clarify the relationship between toxicity of CSNP and placental dysfunction, we examined placenta in CSNP-treated mice using TUNEL staining. Hematoxylin-eosin staining was performed according to a previous procedure [29]. The placenta of mice treated with CSNP showed variable structural abnormalities when compared to control mice. Apoptosis in CSNPtreated groups was restricted primarily to cytotrophoblast and syncytotrophoblast cells from the placenta.

Collection of Mouse Morula-Stage Embryos Female ICR mice (age 6–8 wk) were superovulated by injection of 5 IU of equine chorionic gonadotropin (eCG), followed 48 h later by the injection of 5 IU of hCG, and then mated with male ICR mice. The day a vaginal plug was found was defined as Day 0 of gestation. Plug-positive females were separated for experimentation. Morulae were obtained by flushing the uterine tubes on the afternoon of postmating 2.5 days using Chatot-Ziomek-Bavister (CZB)-HEPES medium.

Statistical Analysis Each experiment was repeated four to five times to obtain 40–100 embryos per treatment. The data were subjected to arcsine transformation for each replication. The transformed values were analyzed using one-way ANOVA; P , 0.05 was defined as indicating statistical significance.

Embryo Transfer and Collection of Fetuses

RESULTS

To examine the ability of CSNP-treated blastocysts to implant and develop in vivo, cycling female mice were mated with vasectomized males to produce pseudopregnant mice as recipients for embryo transfer. Embryo transfer was performed according to our previous protocol [27]. To estimate embryo survival, 20 controls and CSNP-treated blastocyst embryos were transferred to both uterine horns of Day 2.5 pseudopregnant mice, respectively. Eighteen

Preparation and Characterization of CSNP Particle size is one of the most significant determinants in mucosal and epithelial tissue uptake of nanoparticles and in the 2

Article 88


Approximately 10 blastocysts were washed in Caþ2- and Mg þ2-free PBS, snap frozen in liquid nitrogen, and stored at 708C. The mRNA from pools of control and CSNP-treated blastocysts was extracted using the Dynabeads mRNA Direct Kit (Dynal Ase) according to the manufacturer’s instructions. For reverse transcription, total mRNA in a final volume of 20 ll (containing 0.5 mg oligo-dT, RT buffer [13], 10 mM dithiothreitol, and 10 mM dNTP) was subjected to reverse transcription at 378C for 50 min, followed by 708C for 15 min, and products were stored at 48C until use. Because of the low concentrations of the extracted mRNAs, the integrity and purity of the preparations could not be verified. The PCR reactions were performed according to the instructions of the real-time PCR machine manufacturer (DNA Engine Opticon 3 fluorescene detection system, MJ Research). The threshold cycle (Ct) value represents the cycle number at which sample fluorescence rises to a statistically significant level above the background [28]. Quantitative RTPCR (qRT-PCR) reactions were performed using a kit from BioRad. Each RTPCR reaction mixture was composed of 4 ll cDNA and 10 pm/ll of the appropriate forward and reverse primers (Table 1). The PCR program was as follows: denaturation (958C for 10 min), amplification and quantification repeated 40 times (958C for 10 sec, 55–608C for 30 sec, and 728C for 30 sec with a single fluorescent measurement), melting curve analysis (65–958C, with a heating rate 0.28C/sec and continuous fluorescence measurement), and final cooling to 128C. Tests were performed in triplicate, and the relative quantification of gene expression was analyzed by the 2-ddCt method. In all experiments, GAPDH mRNA was used as an internal standard (Supplemental Fig. S1, available online at www.biolreprod.org).

CHITOSAN NANOPARTICLE TOXICITY IN MOUSE EMBRYOS TABLE 1. Primers and conditions used for real-time RT-PCR. Primer name GAPDH Pou5f1 Sox2 Klf4 Cdx2 Eomes Krt8 Trp53 Bcl2 Bax Bad

Casp9 Casp3 Casp6 B3gnt5 Wnt3a Atpaf1 Atp1b1

F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R:

AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA CTCCCTACAGCAGATCACTCACA AACCATACTCGAACCACATCCT CACAACTCGGAGATCAGCAA CTCCGGGAAGCGTGTACTTA CTGAACAGCAGGGACTGTCA GTGTGGGTGGCTGTTCTTTT AGACAAATACCGGGTGGTGTA CCAGCTCACTTTTCCTCCTGA GAGCTTCAACATAAACGGACTCAA CGGCCAGAACCACTTCCA ATCGAGATCACCACCTACCG TGAAGCCAGGGCTAGTGAGT GGAGTATTTGGACGACCG TCAGTCTGAGTCAGGCCC TAAGCTGTCACAGAGGGGCT TGAAGAGTTCCTCCACCACC CGAGCTGATCAGAACCATCA GAAAAATGCCTTTCCCCTTC GGAAGACGCTAGTGCTACAGA GAGCCTCCTTTGCCCAAGTTT CCCAGGACACAGAGGAGGTC GCCCAACAGAACCACACCAAAA GTCACGGCTTTGATGGAGAT CAGGCCTGGATGAAGAAGAG AGGGGTCATTTATGGGACA TACACGGGATCTGTTTCTTTG GGCAACCACGTTTACGCATAC GGCGCTGAGAGACCTTTCTGT CGTGGGGCAATGAGAACTAT CCCAGCTGAACTGAAGAAGG TTTGGAGGAATGGTCTCTCGGGAGT ACCACCAGCAGGTCTTCACT CCTGCCCAACATTTCTTTGT TGTGGAGTCCATTTCTGCTG CAGATTCCCCAGATCCAGAA CTGCACACCTTCCTCTCTCC

578C

123

638C

220

608C

190

588C

218

608C

153

608C

210

638C

151

568C

350

588C

344

558C

283

608C

438

638C

518

588C

224

558C

422

638C

406

558C

207

558C

178

588C

209

588C

215

Effect of CSNP on Proliferation of Cells in Blastocyst-Stage Embryos Since material properties affect the kinetics of cell death, it is possible that the mechanisms of nanomaterial-mediated cell toxicity vary depending on the composition of material interactions with each cell type. ROS generation has been suggested to be an initial cellular response to nanomaterial internalization [30] and, later, cell death. To further determine the effects of CSNP on proliferation of embryo, cell counting was used to assess cell proliferation in blastocysts treated with CSNP for 24 h. We found that even at lower concentrations of (10 lg/ml), CSNP was also able to block proliferation of cells in blastocyst-stage embryos (Fig. 3A). Incubation with 10 lg/ ml (2.0 6 0.5) and 100 lg/ml (11.75 6 1.7) of CSNP caused a significant reduction of proliferation and 2.6- and 15.6-fold increased cell death compare to control (0.75 6 0.3), respectively (Fig. 3B). However, a massive occurrence of apoptosis was slightly decreased at higher CSNP concentrations (200 lg/ml, 8.88 6 1.5) than 100 lg/ml (11.75 6 1.7), and maximum cell death occurred between 10 and 100 lg/ml. We also observed that the total numbers of cells were significantly reduced when compared with control cells (Fig. 3B). Of note, the effect of CSNP on cell apoptosis was more pronounced in the inner cell mass (ICM) than in the trophectoderm (TE; Fig. 3A). Here we demonstrated that CSNP decreases cell proliferation and also increases the number of cell deaths in both ICM and TE cells, suggesting harmful effects on embryo implantation and development.

intracellular trafficking of the particles. In order to overcome the penetration problem of larger nanoparticles, we successfully prepared CSNPs of about 100-nm size by ionic crosslinking of chitosan with TPP. Dynamic light scattering (DLS) measurement was performed in aqueous solution to elucidate the size of chitosan nanoparticles. It was found that the average size of chitosan was 95 nm (Fig. 1A). The morphological characteristics of synthesized nanoparticles were examined using high-resolution TEM. The TEM image reveals that uniform size of CSNP maintained a round shape with homogeneous structure, and the diameter of these particles was about 100 nm (Fig. 1B). Impact of CSNP on Blastocyst Development

Effects of CSNP on TE/ICM-Specific Gene Expression in Blastocysts

To define the role of CSNP from morula to blastocyst development, in vivo-derived morulae-stage embryos were cultured in the presence or absence of various concentrations of CSNP (0, 10, 20, 40, 60, 80, 100, or 200 lg/ml) in CZB culture medium for 24 h of in vitro culture (IVC). A representative photograph of blastocysts developed in IVC medium supplemented with the previously indicated doses of CSNP for the 24 h of IVC is shown in Figure 2A. The addition of CSNP during IVC significantly decreased the expanded blastocyst development in a dose-dependent manner except at 10-lg/ml CSNP concentration (Fig. 2B). In addition, to show the difference between chitosan and other known nanoparticle effects on

During mouse preimplantation development, TE/ICMspecific genes are required in vivo and in vitro for the establishment and maintenance of the pluripotent ICM in blastocysts Therefore, we examined the effect of CSNP on TE/ ICM-specific gene expression by qRT-PCR on CSNP-treated blastocysts. In this study, CSNP-treated heterogeneous blastocysts showed lower expression not only of TE-associated genes, such as Cdx2 and Krt8, but also of the pluripotent marker gene Pou5f1 and Sox2, whereas Klf4 and Eomes gene expression did not significantly differ (Fig. 4, A and B). 3

Article 88


Bak1

Primer sequence

blastocyst development, we used different concentrations of AuNPs (10, 50, 100, and 200 lg/ml) as a reference. The results of this experiment indicate that AuNPs have no significant toxicity at the level of 200 lg/ml (Table 2). At 24 h after IVC, control embryos formed fully expanded blastocysts and started to hatch from their zonae pellucidae. Even though morula-stage embryos cultured with CSNP were morphologically indistinguishable from controls, blastocyststage embryos had a variable phenotype in blastocoel formation (Fig. 2D). Bright-field images show representative CSNP-treated embryos with different sizes of blastocoels relative to control littermates. The length and width of the blastocoel were measured on confocal images, and the area was calculated as length 3 width: average blastocoel size of individual control-derived blastocyst-stage embryos is designated as normal (100%). Embryos cultured with more than 100 lg/ml of CSNP had either no cavity (0% blastocoel, 17.24 6 2.2%), a small cavity (30% blastocoel, 20.69 6 1.1%), or a middle cavity (80% blastocoel, 48.28 6 2.5%) that was less than the size of control embryos (13.79 6 1.7%; Fig. 2C). Collectively, these results indicate that CSNP treatment during IVC has negative effects on embryo development.

PCR Size conditions (bp)

PARK ET AL.

of CSNP-treated blastocyst-stage embryos. Therefore, we examined caspases-cascade expression, consisting of cysteine-aspartic acid proteases well known for their vital role in the initiation as well as the execution of apoptosis [31]. The results of real-time quantititative RT-PCR clearly indicated that upregulation of Casp3 was dose dependent in mouse blastocyststage embryos treated with 10–200 lg/ml of CSNP (Fig. 6) compared to the housekeeping GAPDH gene. In addition, expression of other caspases, such as Casp6 and Casp9, was also increased after exposure to CSNP. Furthermore, on treatment of CSNP in treating mouse blastocyst-stage embryos, the expression levels were increased in apoptotic markers Bax, including Bad and Bak1, while antiapoptotic marker Bcl2 expression was decreased (Fig. 6). The results show the involvement of the caspase signaling (Casp9, Casp6, and Casp3) pathway due to dysregulation of Bcl2/Bax expression in the apoptotic cell death of mouse blastocyst-stage embryos treated with CSNP. The expression of Bax increased and the expression of Bcl-2 decreased in a dose-dependent manner, suggesting that Bax/Bcl2 was involved in the CSNP-induced apoptosis.

Important genes associated with blastocyst developmental competence were selected for gene expression analysis in the presence and absence of CSNP treatment. Each of these genes, B3gnt5 (cell differentiation and adhesion), Wnt3a (development), and Eomes (TE differentiation), were expressed in every individual blastocyst [32]. To find out the underlying mechanism between hatching failure and gene expression in CSNP-treated mouse embryos, the individual blastocoel area of CSNP-treated embryos was compared with the average blastocoel size of the control. According to the cavity size of blastocyst, CSNP-pretreated blastocyst-stage embryos were classified as four groups with 0%, 30%, 80%, and 100% cavity size (Fig. 7A). CSNP-pretreated blastocyst embryos that had either no cavity (0% cavity) or a small cavity (30% cavity) showed a significant decrease in expression of B3gnt5, Wnt3a, and Eomes (Fig. 7B), whereas gene expression in blastocyst embryos that had a 100% cavity did not differ between CSNP treatment and control groups. Taken together, these observations suggest that failure to hatching or implantation might be caused by these compromised blastocyst embryos.

FIG. 1. Characterization of CSNP. The particle-size distribution of CSNP was determined by DLS. The average particle size was found to be 100 nm (A). TEM micrographs confirmed the nanosize of dried chitosan particles and show the distribution of uniform sizes of 100-nm particles (B). Bar ¼ 500 lm.

Impact of CSNP on MMP Up-regulation of mitochondrial activity is a feature of TE differentiation. To investigate alternative mechanisms of nanomaterial-mediated cytotoxicity in blastocysts, we examined the changes of MMP in blastocysts after CSNP exposure. The MMP was determined with JC-1 probe by laser scanning confocal microscopy (LSCM; Fig. 5A). The green/red fluorescence intensity ratio was used to express the changes of MMP, and the increased ratio indicates a decrease of MMP. The upper panel of Figure 5A shows the MMP level of control blastocyst, and lower panel indicate the status of CSNP-treated blastocyst. The LSCM results showed that the elevated level of the red ratio to the increase of CSNP exposure indicating the MMP changes was due to an effect of CSNP treatment. The MMP of blastocyst-stage embryos by CSNP exposures showed significant differences compared with the control. Further gene expression analysis demonstrated that the reduction in mitochondrial activity was mediated by the lower expression of genes involved in both ATP synthesis (Atpaf1) and ATP consumption (Atp1b1; Fig. 5B). Of note, gene expression in blastocyst-stage embryos that have either no cavity or a small cavity was significantly more down-regulated than those of blastocyst-stage embryos with normal cavity size, indicating that blastocyst-stage embryos that have either no cavity or a small cavity have both reduced mitochondrial activity and a defect of TE cells.

Effects of CSNP on Blastocyst with Survival to Term, Litter Ratio, and Placenta Weight To find out the effects of CSNP on blastocyst development in vivo, untreated control and CSNP-pretreated mouse blastocysts were transferred. At 18 days posttransfer, CSNP-treated groups had fewer implantation sites and fetuses than those of controls (Fig. 8). The implantation ratio in the CSNP-pretreated group was significantly different from that of the untreated control group (Fig. 8A). However, the proportion of implanted embryos that failed to develop normally was significantly lower in the CSNP-pretreated group. Embryos that implanted but failed to develop were subsequently resorbed. Interestingly, there was a significant difference in early resorption rate between the CSNPpretreated and control groups, but the CSNP-pretreated group had a significantly later resorption rate than the untreated control group. Fetal weight is a vital part and important indicator of developmental status, and we used the average fetal weight of the untreated control group as the key

CSNP Induces Apoptosis Casp-3/7 activation was found in some nanoparticleexposed embryos. Caspase activation may lead to apoptosis 4

Article 88


The Effect of CSNP on the Size of the Blastocyst and Development-Associated Gene Expression Profile

CHITOSAN NANOPARTICLE TOXICITY IN MOUSE EMBRYOS

these findings indicate that CSNP exposure at the blastocyst stage reduces embryo implantation and the potential for postimplantation development.

indicator for measuring the development of CSNP-treated blastocysts. The results showed that the CSNP-treated group had a higher body weight (0.8 g) than the control (0.6 g). While observing placental weight, there was no significant difference in placental weight between the CSNP-treated and CSNP-untreated groups (Fig. 8B), but fetal weight was slightly higher in the CSNP-treated group than controls. All

Histological Evaluation of Apoptosis Using TUNEL In order to evaluate the effect of CSNP on apoptosis, tissue sections of various organs, such as placenta, lung, liver, and

TABLE 2. Development of the blastocysts in medium supplemented with the doses of AuNP. Treatment (lg/ml) Control 10 50 100 200

No. of morula 49 60 57 56 59

No. of 100% BL

No. of 80% BL

39 49 46 45 48

8 6 7 5 7

(79.6 (81.7 (80.7 (80.4 (81.4

6 6 6 6 6

3.2) 0.8) 2.6) 3.3) 2.3)

5

(16.3 6 1.9) (10 6 0.9) (12.3 6 3.9) (8.9 6 2.4) (11.9 6 1.2)

No. of 30% BL 2 3 1 5 3

(4.1 6 4.4) (5 6 0.5) (1.8 6 1.7) (8.9 6 1.0) (5.1 6 2.8)

No. of 0% BL 0 2 3 1 1

(0 6 0) (3.3 6 1.6) (5.3 6 0.7) (1.8 6 1.6) (1.7 6 2.1)

Article 88


FIG. 2. Effect of CSNP on embryo development and blastocoels formation. In vivo-derived morulae-stage embryos were cultured in the presence or absence of various concentrations of CSNP (0, 10, 20, 40, 60, 100, or 200 lg/ml) in CZB culture medium for 24 h of in vitro culture (IVC). A) A representative photograph of blastocysts developed in IVC medium supplemented with the different doses of CSNP for the 24 h of IVC: a–h indicate embryos that cultured in the presence of different concentrations (0, 10, 20, 40, 60, 100, or 200 lg/ml) of CSNP, respectively. Original magnification 3200. B) Expanded blastocyst developmental rate according to addition of CSNP during IVC. Error bars represent SEM; groups marked with different letters (a–c) are significantly different from each other at P , 0.05. C, upper panel) Bright-field images show representative CSNP-treated embryos with different sizes of cavity relative to control litter mates. C, lower panel) The blastocoel areas of individual CSNP-treated embryos were compared with the average blastocoel size of control littermates. In vivo-derived morulae-stage embryos were cultured in the presence of 200 lg CSNP/ml in CZB culture medium for 24 h of IVC. Original magnification 3200. The experiments were performed in triplicate; data shown represent the mean of three independent experiments. Asterisk (*) means P , 0.05 as compared with untreated cells.

PARK ET AL.

DISCUSSION

kidney, were stained with TUNEL for evaluating DNA fragmentation. Enumeration of apoptotic nuclei (about 200 cells were counted) was made of slides picked up at random by three independent experimenters. We measured the level of apoptosis in control and CSNP-derived placenta, lung, liver, and kidney using the TUNEL assay (Fig. 9). Whereas apoptotic cells were barely detectable in control groups, there was a marked elevation in apoptosis in organs derived from CSNPtreated groups: an enhanced apoptosis signal in lung, liver, and kidney was detected in alveoli, hepatocyte, and proximal tubules. We found significant abnormal tubular degeneration in the lung and liver but no difference in brain and heart tissues (data not shown). However, fetal loss was observed in both sexes equally, as the litter sex ratio did not differ between treatments (45.46% and 37.84% males for controls and high CSNP, respectively; data not shown). The data from the current study are reinforced with the previous hypothesis that placental dysfunction has been associated with miscarriage and fetal growth restriction. The present study suggests that CSNPinduced embryo toxicity may have long-lasting adverse effects on embryo development. Based on our results, we propose a hypothetical model that explains that various signaling pathways could be involved in the treatment of blastocyst with CSNP (Fig. 10).

The increasing use of nanomaterials has raised concerns about their potential risks to human health. Recent studies have shown that nanoparticles can cross the placental barrier in pregnant mice and cause neurotoxicity in their offspring, but a more detailed understanding of the effects of CSNP on pregnant animals remains elusive. Due to specific features of biocompatibility and biodegradability, chitosan has been applied in drug delivery systems to prepare microspheres or nanospheres for encapsulation of drugs, enzymes, proteins, and DNA [33]. Several studies have been reported using chitosan nanoparticles as drug carrier molecules [5, 6]. However, the potential toxic effects of CSNP on embryo development are still lacking. The present study demonstrated that CSNP-treated embryos showed lower developmental competency and reduction of total cell numbers, including TE and ICM. Particle size and surface properties are important factors influencing nanoparticle interactions at the biological interface, including nanotoxicology [18]. In this study, chitosan nanoparticles of near uniform size, in the range of 100 nm, were synthesized, and their size was confirmed by TEM (Fig. 1). Our results suggest that CSNP significantly decreases the expanded blastocyst development in a dose-dependent manner at except 10-lg/ml CSNP concentration (Fig. 1). In addition, it 6

Article 88


FIG. 3. Dose-dependent effect of CSNP on cell proliferation. A) Mouse blastocysts were treated with or without CSNP for 24 h, apoptosis was examined by TUNEL staining, and the total number of cells per blastocyst and the cell numbers in the inner cell mass (ICM) and trophectoderm (TE) were counted. Original magnification 3200. The mean number of total cells in blastocyst and apoptotic (TUNEL positive) cells per blastocyst was calculated. B) The experiments were performed in triplicate; data shown represent the mean of three independent experiments. Error bars represent SEM; groups marked with different letters (a–c) are significantly different from each other at P , 0.05.


average blastocoels size of individual control-derived blastocyst-stage embryos was calculated and is designated as ‘‘normal blastocoel size.’’ In our study, embryos cultured with more than 100 lg/ml of CSNP had either no cavity (0% blastocoel, 17.24 6 2.2%), a small cavity (30% blastocoel, 20.69 6 1.1%), or a middle cavity (80% blastocoels, 48.28 6 2.5%) that was smaller than that of control embryos (13.79 6 1.7%). A previous study [32] reported that blastocysts that resulted in complete implantation failure showed a significant decrease in expression of B3gnt5, Wnt3a, and Eomes. When blastocysts implanted but were absorbed (nonviable implantation), a significant decrease was observed in Wnt3a and Eomes or B3gnt5 and Eomes expression. Another study reported that Eomes has also been shown to be essential for mouse trophoblast formation, where Eomes-null embryos arrest at the blastocyst stage and TE from these embryos fails to differentiate into trophoblast cells, suggesting that Eomes is necessary for TS cell self-renewal or differentiation [37]. Also, disrupting the B3gnt5 gene leads to preimplantation lethality, which potentially is caused by a defect of the lactoseriesderived glycosphingolipids (GSL) pathway and possibly by destabilization of other enzymes involved in GSL biosynthesis [38]. It is possible that CSNP-treated blastocyst-stage embryos are not entirely normal with respect to gene expression. Therefore, those with relatively minor errors in gene expression will develop to expand the blastocyst and then ultimately develop to full term. Taken together, these findings suggest that

significantly inhibits cell proliferation and induces apoptosis in the ICM and TE of mouse blastocysts and leads to impairment of the developmental potential of blastocysts. The TE arises from the trophoblast at the blastocyst stage and develops into a sphere of epithelial cells surrounding the ICM and the blastocoel; these cells contribute to the placenta and are required for development of the mammalian conceptus [34], meaning that a reduction in the TE cell lineage may reduce implantation and embryonic viability [35]. To determine why CSNP-pretreated blastocysts failed in blastocoel formation or hatch from the zona pellucidae, we performed gene expression studies by qRT-PCR on CSNPtreated blastocysts. In this study, CSNP-treated embryos showed lower expression not only of TE-associated genes, such as Cdx2, Krt8, and Atp1b1, but also of the pluripotent marker gene Pou5f1, Sox2, and Klf 4 (Fig. 4), which have been reported to play crucial roles in the TE/ICM formation. Even though somatic cell nuclear transfer (SCNT) embryos has lower TE- and ICM-specific gene expressions compared to those of normal fertilized-derived blastocyst embryos, some of the SCNT embryos successfully developed to term [36]. This observation suggestes that implantation and full-term failure might be caused by other underlying mechanism rather than a low TE/ICM-specific gene expression, such as Pou5f1 and Cdx 2 genes. To find out the underlying mechanism between hatching failure and gene expression in CSNP-treated mouse embryos, 7

Article 88


FIG. 4. Expression profiles of ICM- and TE-associated genes. The expression levels of ICM- and TE-associated genes were analyzed by qPCR and compared between control and CSNP-treated blastocysts. The experiments were performed in triplicate; data shown represent the mean of three independent experiments. Error bars represent SEM; groups marked with different letters (a and b) are significantly different from each other at P , 0.05.

PARK ET AL.

ATP synthesis (Atpaf1) and ATP consumption (Atp1b1). Taken together, the present observations indicate that the adverse changes in mitochondrial function due to CSNP, with a possible association of intracellular ROS production, trigger the apoptosis process. Although apoptosis is responsible for eliminating unwanted cells during normal embryonic development, this process does not normally occur at the blastocyst stage [41, 42]. Excessive apoptosis before or during the blastocyst stage is likely to delete important cell lineages, impacting embryonic development and potentially leading to miscarriage or embryonic malformation [43]. Thus, our observation that CSNP treatment reduced the cell number and increased apoptosis in the ICM and, to a lesser extent, in the TE of mouse blastocysts led us to investigate the possibility that CSNP treatment could cause mortality and/or developmental delay in postimplantation mouse embryos in vitro and in vivo. Our results revealed that CSNP-treated blastocysts suffered from decreased implantation and embryonic death both in vitro and in vivo. Two major apoptotic signaling pathways have been defined. The mitochondria-dependent pathway is responsible for extracellular cues and internal insults, such as DNA damage. Cytotoxic stress causes proapoptotic members of the Bcl2

decreased B3gnt5, Wnt3a, and Eomes gene expression in CSNP-treated blastocyst-stage embryos are responsible for negative implantation as well as nonviable implantation. An earlier report suggests that mitochondria play a crucial role in regulation of cell death. Under extreme conditions (e.g., high Ca2 þ, oxidative stress), mitochondria undergo drastic changes, accompanied by a decrease of the mitochondrial potential, de-energization, swelling, and permeabilization of the inner membrane [39]. A drastic decrease of MMP was observed in chitosan nanoparticle-treated human gastric carcinoma cells, indicating that the mitochondrial membrane is damaged [17]. Furthermore, the occurrence of mitochondrial dysfunction is rapidly followed by or nearly coincident with the loss of plasma membrane integrity [40]. In this study, fluorescence microscopic observation of control blastocyststage embryos (Fig. 5) shows completely polarized mitochondria forming J-aggregates as red dots. In contrast, the treatment with CSNP resulted in the depolarization of the mitochondrial membrane in blastocyst-stage embryos, as evident from the loss of the red dots and simultaneous increase of green fluorescence (Fig. 5). Further gene expression analysis demonstrated that the reduction in mitochondrial activity was mediated by the lower expression of genes involved in both 8

Article 88


FIG. 5. Effect of CSNP on MMP. A) MMP was determined with JC-1 probe by laser scanning confocal microscopy. Viable control blastocyst showed completely polarized mitochondria forming J-aggregates as red dots (c and c 0 ). In contrast, the treatment with CSNP resulted in the depolarization of the mitochondrial membrane in blastocyst-stage embryos, as evident from the loss of the red dots and simultaneous increase of green fluorescence (b and b 0 ). The effect of CSNP on the proportions of blastocysts was shown with different green/red fluorescence intensity. Dead and dying cells are shown in green (b and b 0 ) and yellow color (d), whereas a viable blastocyst is shown as a red color (c and c 0 ). a and d show DAPI staining and merge, respectively. Bar ¼ 100 lm. B) Comparison of Atpaf1 (ATP synthesis) and Atp1b1 (ATP synthesis) gene expression in normal and compromised blastocyst due to CSNP treatment. In vivo-derived morulae-stage embryos were cultured in the presence of 200 lg CSNP/ml in CZB culture medium for 24 h of IVC. Error bars represent SEM; groups marked with different letters (a–c) are significantly different from each other at P , 0.05.


FIG. 7. The effect of CSNP on the size of the blastocyst and development associated gene expression profile. In vivo-derived morulae-stage embryos were cultured in the presence of 200 lg CSNP/ml in CZB culture medium for 24 h of IVC. A) Individual blastocyst with different cavity after CSNP treatment were analyzed. B3gnt5, Wint3a, and Eomes gene expression analysis was carried out in individual blastocyst with different cavity (0%, 30%, 80%, and 100%) revealed differential gene expression profiles. B) Control and CSNT-treated- blastocyst with 100% cavity displayed increased expression of B3gnt5, Eomes, and Wnt3a, whereas CSNT-treated blastocyst with the small size of cavity showed a significant decrease in gene expression of B3gnt5 and Wnt3a. The experiments were performed in triplicate; data shown represent the mean of three independent experiments. Error bars represent SEM; groups marked with different letters (a–c) are significantly different from each other at P , 0.05.

9

Article 88


FIG. 6. CSNP enhances expression of Trp53, Bad/Bax, and caspase families. The expression levels of various apoptotic associated genes were analyzed by qPCR and compared between control and CSNP-treated samples. The experiments were performed in triplicate; data shown represent the mean of three independent experiments. Error bars represent SEM; groups marked with different letters (a–c) are significantly different from each other at P , 0.05.

PARK ET AL.

The data from the current study are reinforced with a previous hypothesis that placental dysfunction has been associated with miscarriage and fetal growth restriction. Fetuses are known to be more sensitive to environmental toxins than adults; the present study suggests that CSNP-induced embryo toxicity may have long-lasting adverse effects on embryo development. The results presented here demonstrate that CSNP treatment might have long-term adverse biological effects in view of pregnancy outcome. Therefore, the findings of this study may help to better define the roles played by CSNP during embryo development in preclinical mouse model. In recent years, chitosan nanoparticles have been used as a delivery vehicle for nasal, ocular, and peroral drug delivery in order to prolong contact time and improve drug absorption. However, little is known about the potential toxicity of nanoparticles used in targeted drug delivery and gene therapies in terms of potential risk to human health. Current studies are aimed at investigating the dose-dependent toxicity of CSNP in cell survival, embryo development, and blastocoel formation. CSNP-treated embryos impair the mitochondrial function and down-regulation of genes responsible for development and eventually cause structural and functional abnormalities in the placenta. Overall, this study validates the idea that human and mouse have mostly similar biochemical and biophysical properties. Thus, these in vitro data could complement the currently available and future findings from animal studies to elucidate the toxicity of CSNP and its role in embryonic development. Thus, the conclusions of mouse studies to elucidate the toxicity of CSNP and its role in embryo development may be extrapolated to apply to human biology. In addition, this study would help us to create safer nanomaterials.

family, such as Bax, to translocate from the cytosol to mitochondria, leading to the release of cytochrome c into cytosol [44]. Cytochrome c then binds to the apoptotic protease activation factor 1 (Apaf-1) and forms a heptamer complex called the apoptosome [45]. Apoptosome recruits and activates Casp9, which in turn activates the downstream executioner caspases, such as Casp3, Casp6, and Casp7 [46, 47]. The second apoptotic pathway is triggered by death-receptor superfamily members through the activation of Casp8, which can directly activate downstream caspases and lead to cellular degradation. Caspases are cysteine-aspartic acid proteases wellknown for their vital role in the initiation as well as the execution of apoptosis [48]. Among several types of caspases, the activation of Casp3 is crucial for cellular DNA fragmentation [49]. The results of real-time qRT-PCR (Fig. 3c) indicate up-regulation of Casp3, as compared to housekeeping GAPDH gene, in a dose-dependent manner in mouse blastocyst-stage embryos treated with 10–200 lg/ml of CSNP. Additionally, real-time qRT-PCR analysis (Fig. 6) clearly demonstrates that the expression levels of Casp6 and Casp9 increased after exposure to CSNP. Furthermore, the changes in antiapoptotic Bcl2 and apoptotic Bax, including Bad and Bak1, expression in treating mouse blastocyst-stage embryos were significantly decreased or increased, as evident from real-time qRT-PCR analysis (Fig. 6). The results indicate the involvement of the Caspase signaling (Casp9, Casp6, and Casp3) pathway due to dysregulation of Bcl2/Bax expression in the apoptotic cell death of mouse blastocyst-stage embryos treated with CSNP. Normal placental development is required for embryonic growth, and placental dysfunction has been associated with miscarriage and fetal growth restriction [50, 51]. Several studies have suggested that many chemical toxins in air, water, and foods can induce pregnancy complications in humans [52, 53]. 10

Article 88


FIG. 8. Effects of CSNP on survival to term, litter ratio, and placenta weight. Mouse blastocysts were treated with or without CSNP, Posttransfer Day 18 fetuses derived from the uteri of recipients after transferring control and CSNP-treated blastocysts (A and B). In CSNP-treated group, some of the embryos were absorbed (arrow mark). C) Fetal survival, fetal weight, and placenta weight were evaluated. The experiments were performed in triplicate; data shown represent the mean of three independent experiments. Asterisk (*) means P , 0.05 as compared with untreated cells.


FIG. 10. A hypothetical model for the involvement of apoptosis pathway in morulae to blastocyst development after CSNP supplementation.

11

Article 88


FIG. 9. Pathological examination of various tissue organs by TUNEL assay. In vivo-derived morulae-stage embryos were cultured in the presence of 200 lg CSNP/ml in CZB culture medium for 24 h of IVC. Histological examination was done by TUNEL staining. Many dead cells with condensed nuclei were seen. The majority of dead cells with condensed and fragmented nuclei were in the CSNP-treated groups. These findings indicate that CSNP-induced cell death mostly due to apoptosis. Bar ¼ 200 lm.

PARK ET AL.

REFERENCES 27.

28.

29.

30. 31. 32.

33.

34. 35.

36.

37.

38.

39.

40.

41. 42.

43.

44.

45.

46.

47.

48. 49.

50.

12

Article 88


1. Donaldson K. Resolving the nanoparticles paradox. Nanomedicine (Lond) 2006; 1:229–234. 2. Kagan VE, Bayir H, Shvedova AA. Nanomedicine and nanotoxicology: two sides of the same coin. Nanomedicine 2005; 1:313–316. 3. Linkov I, Satterstrom FK, Corey LM. Nanotoxicology and nanomedicine: making hard decisions. Nanomedicine 2008; 4:167–171. 4. Medina C, Santos-Martinez MJ, Radomski A, Cor rigan OI, Radomski MW. Nanoparticles: pharmacological and toxicological significance. Br J Pharmacol 2007; 150:552–558. 5. Li Q, Dunn ET, Grandmasion EW, Goosen MFA. Applications and properties of chitosan. In: Goosen MFA (ed.), Applications of Chitin and Chitosan. Lancaster: Technomic Publishing Company; 1992:3–29. 6. Kumar MNV. A review of chitin and chitosan applications. React Funct Polym 2000; 46:1–27. 7. Richardson SCW, Kolbe HVJ, Duncan R. Potential of low molecular mass chitosan as a DNA delivery system: biocompatibility, body distribution and ability to complex and protect DNA. Int J Pharm 1999; 178:231–243. 8. Janes KA, Calvo P, Alonso MJ. Polysaccharide colloidal particles as delivery systems for macromolecules. Adv Drug Deliv Rev 2001; 47: 83–97. 9. Mislick KA, Baldeschwieler JD. Evidence for the role of proteoglycans in cation-mediated gene transfer. Proc Natl Acad Sci 1996; 93: 12349–12354. 10. Panyam J, Labhasetwar V. Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Adv Drug Deliv Rev 2003; 55:329–347. 11. Ernst E, Pittler M. Chitosan as a treatment for body weight reduction? A meta-analysis. Perfusion 1998; 11:461–465. 12. Gades MD, Stern JS. Chitosan supplementation does not affect fat absorption in healthy males fed a high fat diet, a pilot study. Int J Obes Relat Metab Disord 2002; 26:119–122. 13. Gades MD, Stern JS. Chitosan supplementation and fat absorption in men and women. J Am Diet Assoc 2005; 105:72–77. 14. Choi HG, Kim JK, Kwak DH, Cho JR, Kim JY, Kim BJ, Jung KY, Choi BK, Shin MK, Choo YK. Effects of high molecular weight water-soluble chitosan on in vitro fertilization and ovulation in mice fed a high-fat diet. Arch Pharm Res 2002; 25:178–183. 15. Ma Z, Lim LY. Uptake of chitosan and associated insulin in Caco-2 cell monolayers: a comparison between chitosan molecules and chitosan nanoparticles. Pharm Res 2003; 20:1812–1819. 16. Huang M, Khor E, Lim LY. Uptake and cytotoxicity of chitosan molecules and nanoparticles: effects of molecular weight and degree of deacetylation. Pharm Res 2004; 21:344–353. 17. Qi L, Xu Z, Jiang X, Li Y, Wang M. Cytotoxic activities of chitosan nanoparticles and copper-loaded nanoparticles. Bioorg Med Chem Lett 2005; 15:1397–1399. 18. Loh JW, Yeoh G, Saunders M, Lim LY. Uptake and cytotoxicity of chitosan nanoparticles in human liver cells. Toxicol Appl Pharmacol 2010; 249:148–157. 19. Huiying L, Juan L, Xuan C. Antitumor effect of N-succinyl-chitosan nanoparticles on K562 cells. Biomed Pharmacother 2010; 64:521–526. 20. Luo H, Su H, Wang X, Wang L, Li J. N-Succinyl-chitosan nanoparticles induced mitochondria-dependent apoptosis in K562. Mol Cell Probes 2012; 26:164–169. 21. Hu YL, Qi W, Han F, Shao JZ, Gao JQ. Toxicity evaluation of biodegradable chitosan nanoparticles using a zebrafish embryo model. Int J Nanomed 2011; 6:3351–3359. 22. Yamashita K, Yoshioka Y, Higashisaka K, Mimura K, Morishita Y, Nozaki M. Silica and titanium dioxide nanoparticles cause pregnancy complications in mice. Nat Nanotechnol 2011; 6:321–328. 23. Schipper NG, Varum KM, Artursson P. Chitosans as absorption enhancers for poorly absorbable drugs. 1: influence of molecular weight and degree of acetylation on drug transport across human intestinal epithelial (Caco-2) cells. Pharm Res 1996; 13:1686–92. 24. Schipper NG, Olsson S, Hoogstraate JA, deBoer AG, Va˚rum KM, Artursson P. Chitosans as absorption enhancers for poorly absorbable drugs 2: mechanism of absorption enhancement. Pharm Res 1997; 14: 923–929. 25. Schipper NG, Va˚rum KM, Stenberg P, Ocklind G, Lennerna¨s H, Artursson P. Chitosans as absorption enhancers of poorly absorbable drugs. 3: influence of mucus on absorption enhancement.Eur J Pharm Sci 1999; 8: 335–43. 26. Gan Q, Wang T, Cochrane C, McCarron P. Modulation of surface charge, particle size and morphological properties of chitosan-TPP

nanoparticles intended for gene delivery. Colloids Surf B Biointerfaces 2005; 44:65–73. Kwon DN, Lee SY, Cho SK, Kang SJ, Jang J, Seo H, Song H, Park JY, Lee SY, Cho SK, Kang SJ, Jang JS, Seo HG, Kim JH. Dynamic control of oligosaccharide modification in the mammary gland: linking recombinant human erythropoietin functional analysis of transgenic mouse milkderived hEPO. Transgenic Res 2006; 15:37–55. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001; 25:402–408. Altman J, Bayer SA. Migration and distribution of two populations of hippocampal granule cell precursors during the perinatal and postnatal periods. J Comp Neurol 1990; 301:365–381. Nel A, Xia T, Madler L, Li N. Toxic potential of materials at the nanolevel. Science 2006; 311:622–627. Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol 2007; 35:495–516. Parks JC, McCallie BR, Janesch AM, Schoolcraft WB, Katz-Jaffe MG. Blastocyst gene expression correlates with implantation potential. Fertil Steril 2011; 95:1367–1372. Kim TH, Park IK, Nah JW, Choi YJ, Cho CS. Galactosylated chitosan/ DNA nanoparticles prepared using water-soluble chitosan as a gene carrier. Biomaterials 2004; 25:3783–3792. Cross JC, Werb Z, Fisher SJ. Implantation and the placenta: key pieces of the development puzzle. Science 1994; 266:1508–1518. Kelly SM, Robaire B, Hales BF. Paternal cyclophosphamide treatment causes postimplantation loss via inner cell mass-specific cell death. Teratology 1992; 45:313–318. Ross PJ, Rodriguez RM, Iager AE, Beyhan Z, Wang K, Ragina NP, Yoon SY, Fissore RA, Cibelli JB. Activation of bovine somatic cell nuclear transfer embryos by PLCZ cRNA injection. Reproduction 2009; 137: 427–437. Russ AP, Wattler S, Colledge WH, Aparicio SA, Carlton MB, Pearce JJ, Barton SC, Surani MA, Ryan K, Nehls MC, Wilson V, Evans MJ. Eomesodermin is required for mouse trophoblast development and mesoderm formation. Nature 2000; 404:95–99. Biellmann F, Hulsmeier AJ, Zhou D, Cinelli P, Hennet T. The Lc3synthase gene B3gnt5 is essential to pre-implantation development of the murine embryo. BMC Dev Biol 2008; 8:109. Lemasters JJ, Qian T, Bradham CA, Brenner DA, Cascio WE, Trost LC, Nishimura Y, Nieminen AL, Herman B. Mitochondrial dysfunction in the pathogenesis of necrotic and apoptotic cell death. J Bioenerg Biomembr 1999; 31:305–319. Bonneau MJ, Poulin R. Spermine oxidation leads to necrosis with plasma membrane phosphatidylserine redistribution in mouse leukemia cells. Exp Cell Res 2004; 259:23–34. Hardy K. Cell death in the mammalian blastocyst. Mol Hum Reprod 1997; 3:919–925. Hardy K, Stark J, Winston RM. Maintenance of the inner cell mass in human blastocysts from fragmented embryos. Biol Reprod 2003; 68: 1165–1169. Byrne AT, Southgate J, Brison DR, Leese HJ. Analysis of apoptosis in the preimplantation bovine embryo using TUNEL. J Reprod Fertil 1999; 117: 97–105. Chan AT, Teo PM, Leung TW, Johnson PJ. The role of chemotherapy in the management of nasopharyngeal carcinoma. Cancer 1998; 82: 1003–1012. Liu XS, Kim CN, Yang J, Jemmerson R, Wang XD. Induction of apoptotic program in cell-free extracts: requirement for dATP and cytochrome c. Cell 1996; 86:147–157. Acehan D, Jiang X, Morgan DG, Heuser JE, Wang X, Akey CW. Threedimensional structure of the apoptosome: implications for assembly, procaspase-9 binding, and activation. Mol Cell 2002; 9:423–432. Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X. Cytochrome c and dATP-dependent formation of apaf-1/caspase9 complex initiates an apoptotic protease cascade. Cell 1997; 91:479–489. Nun˜ez G, Benedict MA, Hu Y, Inohara N. Caspases: the proteases of the apoptotic pathway. Oncogene 1998; 17:3237–3245. Janicke RU, Sprengart ML, Wati MR, Porter AGJ. Capase-3 is required for DNA fragmentation and morphological changes associated with apoptosis. Biol Chem 1998; 273:9357–9360. Kibschull M, Gellhaus A, Winterhager E. Analogous and unique functions of connexins in mouse and human placental development. Placenta 2008; 29:848–854.

CHITOSAN NANOPARTICLE TOXICITY IN MOUSE EMBRYOS 53. Wigle DT, Arbucle TE, Turner MC, Be´rube´ A, Yang Q, Liu S, Krewski D. Epidemiologic evidence of relationships between reproductive and child health outcomes and environmental chemical contaminants. J Toxicol Environ Health B Crit Rev 2008; 11:373–517.

51. Gasperowicz M, Otto F. The notch signalling pathway in the development of the mouse placenta. Placenta 2008; 29:651–659. 52. Tardiff RG, Carson ML, Ginevan ME. Updated weight of evidence for an association between adverse reproductive and developmental effects and exposure to disinfection byproducts. Regul Toxicol Pharmacol 2006; 45: 185–205.


13

Article 88