J Mol Med (2007) 85:1239–1251 DOI 10.1007/s00109-007-0226-x
ORIGINAL ARTICLE
Cholinergic status modulations in human volunteers under acute inflammation Keren Ofek & Karen S. Krabbe & Tama Evron & Meir Debecco & Anders R. Nielsen & Helle Brunnsgaad & Raz Yirmiya & Hermona Soreq & Bente K. Pedersen
Received: 8 March 2007 / Revised: 26 April 2007 / Accepted: 10 May 2007 / Published online: 27 July 2007 # Springer-Verlag 2007
Abstract Cholinergic Status, the total soluble circulation capacity for acetylcholine hydrolysis, was tested for putative involvement in individual variabilities of the recruitment of immune cells in response to endotoxin challenge. Young (average age 26) and elderly (average age 70) volunteers injected with either Escherichia coli endotoxin or saline on two different occasions were first designated Enhancers and Suppressors if they showed increase or decrease, respectively, in plasma acetylcholinesterase (AChE) activity 1.5 h after endotoxin administration compared to saline. Enhancers showed significant co-increases in plasma butyrylcholinesterase (BChE) and paraoxonase (PON1) activities, accompanied by rapid recovery of lymphocyte counts. Young Enhancers alone showed pronounced postexposure increases in the pro-inflammatory cytokine interleukin-6 (IL-6), and upregulation of the normally rare, stress-induced AChE-R variant, suggesting age-associated
K. Ofek and K. Krabbe contributed equally to this work. K. Ofek : T. Evron : M. Debecco : H. Soreq (*) The Institute of Life sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel, e-mail:
[email protected] K. S. Krabbe : A. R. Nielsen : H. Brunnsgaad : B. K. Pedersen The Centre of Inflammation and Metabolism, Department of Infectious Diseases and CMRC, Rigshospitalet, Faculty of Health Sciences, University of Copenhagen, Copenhagen, Denmark R. Yirmiya Department of Psychology and the Eric Roland Center for Neurodegenerative Diseases, The Hebrew University of Jerusalem, Jerusalem 91904, Israel
KEREN OFEK is a PhD student in Professor Hermona Soreq’s research group at The Hebrew University of Jerusalem, Israel. Her major research interests involve the cholinergic-related mechanisms underlying individual variabilities in human inflammation responses.
BENTE KLARLUND PEDERSEN received her medical degree and defended her doctoral thesis at The University of Copenhagen, Denmark. She is presently professor of Internal Medicine and Director of The Danish National Research Foundation’s Centre of Inflammation and Metabolism. Her research interests include muscle-fat-brain cross talk.
exhaustion of the cholinergic effects on recruiting innate immune reactions to endotoxin challenge. Importantly, IL-6 injected to young volunteers or administered in vitro to primary mononuclear blood cells caused upregulation of AChE, but not BChE or PON1, excluding it from being the sole cause for this extended response. Interestingly, Suppressors but not Enhancers showed improved post-exposure working memory performance, indicating that limited cholinergic reactions may be beneficial for cognition. Our findings establish Cholinergic Status modulations as early facilitators and predictors of individual variabilities in the peripheral response to infection.
1240
Keywords Human . Cytokines . Inflammation . Acetylcholinesterase . Butyrylcholinesterase . Paraoxonase
Introduction Exposure to pathogenic threats activates inflammatory reactions, followed by a fast and crucial anti-inflammatory response [1]. This limits the inflammatory processes below a certain threshold, ascertaining survival and avoiding autoimmune diseases or spreading of the inflammatory components into the bloodstream, which may lead to septic shock [1]. Neither the origin(s) of individual variabilities in response to inflammation, nor the underlying mechanism(s) are fully understood. However, cholinergic signaling is notably involved in antiinflammatory reactions [2]. Thus, the vagus nerve releases acetylcholine (ACh) when stimulated (either electrically or pharmacologically), inhibiting activation of macrophages and release of pro-inflammatory cytokines (e.g., interleukin-6 [IL6], tumor necrosis factor alpha [TNF-α], IL-1, and IL-18). In contrast, the synthesis and secretion of anti-inflammatory cytokines (e.g., IL-10) are maintained [2]. Based on this knowledge, we predicted that variations in the total free circulation capacity for hydrolyzing ACh might be causally involved in determining individual variabilities in the reaction to inflammatory challenge. Circulating ACh may be hydrolyzed by acetylcholinesterase (AChE) and the closely similar enzyme butyrylcholinesterase (BChE) [3]. Both of these enzymes are inherently protected from oxidative stress by paraoxonase1 (PON1), suggesting that all three activities may contribute to variabilities in one’s capacity for peripheral ACh hydrolysis. Importantly, both cholinesterases and PON1 activities are subjected to age-dependent modulations: AChE and BChE activities [4], increase with age, paralleling the age-associated increase in circulating levels of cytokines and the increased susceptibility to infection [5], whereas PON1 activity decreases with age [4]. Causal involvement of the total free soluble Cholinesterases (ChE) molecules determines the capacity for ACh hydrolysis and hence the individual variability to react to immune challenge, therefore predicted age-related differences in what we designated “Cholinergic Status”, namely, summated ACh hydrolyzing activities of free AChE and BChE in the plasma. Only these free molecules (but not, for comparison, red blood cells AChE) have the possibility to reach the sites where macrophages cross-talk with cholinergic nerves. The age-related changes in PON1 levels were further predicted to exhaust one’s capacity of oxidative stress reactions, together suggesting aging-associated decline in the reaction to immune challenges. IL-6 was shown to stimulate the hypothalamic-pituitary-adrenal (HPA) axis [6], which regulates the inflammatory response, among others, by
J Mol Med (2007) 85:1239–1251
inhibiting inflammatory mediators [7]. IL-6 given once at 3 μg/kg in healthy humans suppressed corticosteroid-binding globulin, which determines cortisol bioavailability [8]. The AChE promoter includes a functionally active glucocorticoid binding site [9], linking between these seemingly unrelated elements. In addition, cholinesterase inhibitors downregulate pro-inflammatory cytokines (i.e., IL-1, IL-6, and TNF) in Alzheimer’s Disease (AD) patients [10], suggesting involvement of ACh hydrolysis in this phenotype. Apart from its involvement in inflammation through its hydrolyzing activity, AChE appears to be involved in hematopoietic reactions through its non-catalytic activities [11]. Specifically, changes in the levels of the stress-related variant AChE-R, which possesses distinct non-catalytic properties from those of other AChE variants [12], associate with the levels of pro-inflammatory cytokines such as IL-1β and IL-6 in adult peripheral mononuclear cells [13], primate motoneurons [14], and hippocampus and serum of rodents [15]. In PC12 cells, IL-1β modulates AChE mRNA levels and protein activity in a dosedependent manner [16], suggesting a closed loop of control whereby AChE induces IL-1β production and IL-1β induction promotes yet more AChE synthesis. Like many other stressful stimuli, known to affect learning and memory processes [17], inflammation can also cause marked alterations in memory functioning [18]. In healthy humans, endotoxin-induced cytokine secretion is correlated with impairments in verbal and non-verbal declarative memory functions [19], and similar findings were demonstrated in patients receiving cytokine immunotherapy for cancer or hepatitis-C [20]. In contrast, in healthy volunteers working memory functioning was improved after a low-dose endotoxin administration [21]. Several indications pointed at the involvement of cholinergic signaling in these endotoxin-indiced effects. Thus, endotoxin decreases brain choline acetyltransferase activity [22], similar to the effects of psychological stress [23]. AChE was considered as particularly relevant to these processes because it controls ACh levels, which are involved with cognition [24] and as AChE inhibitors improve cognitive functions in both clinical and experimental paradigms [25]. Furthermore, subjects with a greater endotoxin-induced elevation in AChE-R cleavage (and presumably, larger increases in ACh levels) showed both lower endotoxin-induced improvement in working memory functioning, and greater endotoxin-induced impairment in declarative memory [21]. Based on all of the above considerations, we predicted an association of the Cholinergic Status with post-infection parameters of inflammation, oxidative stress, hematopoiesis, and memory function. To challenge this prediction, we injected young (average age 26) and elderly (average age 70) volunteers with either bacterial endotoxin or saline on two
J Mol Med (2007) 85:1239–1251
1241
different occasions and traced changes in the subjects’ capacity to hydrolyse ACh. Our findings support the notion that these changes reflect the individuals’ capacity to confront endotoxin challenges and the scope of their immune reaction. Two patterns of responses to endotoxin were observed, after exposure enhancement or suppression of the cholinergic status. Enhancers and Suppressors differ in their post-exposure PON1 levels, immune markers such as IL-6 and lymphocyte counts, and in their working memory.
Materials and methods Endotoxin infusion Twenty-four healthy male subjects, 12 young (mean age 26, range 21–29), and 12 elderly (mean age 70, range 67–77) were included in this study, all with a negative medical history and no abnormalities in physical examination.
Blood analyses showed normal white blood cell total and differential counts, CRP and blood glucose as well as normal functioning of the kidneys, liver, and coagulation system. All subjects had a normal electrocardiogram (ECG). None of them used any medication, and urine was blank for glucose, albumin, ketones, or leukocytes. Furthermore, the elder participants had normal levels of vitamin B-12. Exclusion criteria were: presence of any medical or psychiatric illness, BMI >30, febrile illness, or travels outside of Europe/North America during the month preceding the study, vaccination in this time frame, use of drugs other than alcohol, less than 7 years of education, and for the elderly, Mini Mental State Examination (MMSE) score .64 for all measures and alternate form reliability was >.55 for all measures [26]. rhIL-6 infusion Seven healthy males, mean age 26 (range 19–34 years) were recruited to participate in this part of the study. All subjects had a negative medical history, no abnormalities in physical examination, did not use any medication, and did not have any febrile illness during the 2 weeks preceding the study. Oral and written information about the experimental procedures was presented and written informed consents received. Twelve young volunteers who were injected with saline from the endotoxin experiment were used as a control group. Ethics The studies were approved by the Ethical Committee of the Copenhagen and Frederiksberg Council, Denmark and performed according to the Declaration of Helsinki. Subjects were first informed about possible risks and discomfort. All subjects submitted informed written consent to participate.
J Mol Med (2007) 85:1239–1251
Procedures For endotoxin tests, two intravenous (i.v.) cannulae were inserted into an antecubital forearm vein for intermittent blood sampling and i.v. injection of either placebo (NaCl) or endotoxin (0.2 ng/kg BW Escherichia coli endotoxin (Lot EC-6, United States Pharmacopoeia Convention, Rockville, MD). The order of injections was randomized, balanced, and double-blinded. Blood was collected at baseline before i.v. injection and at 1.5, 3, 4.5, 6, and 24 h after injection. Body temperature was measured using an ear probe. Blood samples were drawn into ice-cold tubes containing ethylenediaminetetraacetic acid (EDTA) and centrifuged immediately thereafter. Plasma was stored at −80° C until analyzed. Nucleated blood cells (NBC) were isolated from each subject at baseline, and stored in dimethyl sulfoxide (DMSO) in liquid nitrogen. For transportation purposes, they were kept frozen with packed ice. For IL-6 infusion, subjects reported to the laboratory at 0800 after an overnight fast, changed into appropriate attire and rested in a supine position. Peripheral catheters were placed in an antecubital vein (for blood sampling) and in a contralateral vein (for infusion of recombinant human [rh] IL-6). Blood pressure, heart rate, and rectal temperature were recorded every hour. Subjects were infused with rhIL6 (Sandoz, Bavle, Switzerland) for 3 h at a rate of 25 ml and 5 μg/h. Venous blood for cytokine analyses was drawn at baseline, after 0.5, 1, 2, 3, 4, 5, and 8 h. The subjects reported to the laboratory the following day again, after an overnight fast, to have blood samples drawn after 24 h. Plasma IL-6 and TNF-α levels were determined in duplicates, and mean values calculated, by the enzymelinked immunosorbent assay (ELISA) (R and D Systems, Minneapolis, MN, USA [detection limit IL-6: 0.156 pg/ml; detection limit TNF- α: 0.5 pg/ml]).
Enzyme activity measurements Plasma PON activity was determined by an adaptation of the spectrophotometric method [27] to a microtiter plate assay. We found that 1:5 dilution of plasma and 1.2 mM paraoxon concentration were optimal, yielding high variability as reported for paraoxonase activity. Briefly, 10 μL of plasma diluted 1:5 were placed in microtiter plate wells (Nunc, Roskilde, Denmark) in triplicate; reaction was initiated by adding 190 μL of the substrate, 1.2 mM paraoxon (Sigma), in 0.26 mM Tris–HCl, pH 8.5, 25 mM CaCl2 and 0.5 M NaCl. Readings at ɛ405 nm were repeated at minimal intervals for 10 min. Non-enzymatic breakdown of paraoxon was subtracted from the total rate of hydrolysis. Enzyme activity was calculated using the ɛ405 for pnitrophenol, 17,100 M/cm.
J Mol Med (2007) 85:1239–1251
1243
Plasma cholinesterase catalytic activity measurements involved adaptation of a spectrophotometric method [28] to a microtiter plate assay. Acetylthiocholine (ATCh, Sigma, 1 mM) or butyrylthiocholine (BTCh, Sigma, 10 mM) hydrolysis rates were measured by placing 10 μL 1:20 diluted plasma in microtiter plate wells, after 20 min preincubation with 5×105 M iso-OMPA (Sigma), a specific BChE inhibitor, or 105 M 1,5-bis(4-allyldimethylammoniumphenyl)pentan-3-one dibromide (BW284C51, Sigma), a specific AChE inhibitor, respectively. For Cholinergic Status measurements, plasma hydrolysis of ATCh was measured without inhibitors. Readings at ɛ405 nm were repeated at 2-min intervals for 20 min. Non-enzymatic breakdown of substrate was subtracted from the total rate of hydrolysis. Enzyme activities were calculated using the ɛ405 for 5-thio-2-nitrobenzoate, 13,600 M/cm. AChE-R immuno quantification To quantify plasma AChE-R levels, we developed an ELISA procedure whereby intact AChE-R was captured on multiwell plates by general anti-AChE antibodies and quantified by selective anti-AChE-R antibodies. Briefly, each of the 96 well immuno-plates (nunc, Roskilde, Denmark) was coated overnight at 4°C with 100 μl of 0.2 μg/ml primary commercial antibody against the common domain of AChE (Santa Cruz Biotechnology, California, USA, N19) diluted in 100 μl phosphate-buffered saline (PBS). The plate was washed once with 300 μl of PBS 0.5% Tween for 5 min. After aspirating the wash solution, wells were blocked with 300 μl 5% bovine serum albumin (BSA) in PBS for 2 h at room temperature (RT). After one wash, wells were covered with 100 μl undiluted serum (2 h, RT) and then washed four times with 300 μl PBS-Tween. Each well was covered with 1.23 μg of rabbit anti-AChE-R antibodies [29] in 3% BSA/PBS (2 h, RT). After four washes with 300 μl PBS-Tween, wells were covered with 100 μl of 1:100 secondary antibody, horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin (2 h, RT). Then, 100 μl 3,3′,5,5′tetramethybenzidine (TMB) (Chemicon, Massachusetts, USA) was added. To stop the reaction, 50 μl of 1 M
H2SO4 were added to each well after 10 min at RT. Calibration curves performed with highly purified, plantproduced human recombinant AChE-R [30] were used for quantifying the amount of AChE-R in patient’s serum. RNA extraction and real-time RT-PCR RNA extraction from NBC was with the RNeasy lipid tissue kit (Qiagen, Valencia, CA, USA) as per the manufacturer’s instructions. DNase treatment was applied, RNA integrity confirmed by gel electrophoresis, and RNA concentration and purity assessed spectrophotometrically. RNA samples (0.4 μg) were used for 20-μl cDNA synthesis (Promega, Madison, WI, USA). Real-time RT-PCR was performed in duplicates using ABI prism 7900HT and SYBR green master mix (Applied Biosystems, Foster City, CA, USA). ROX, a passive reference dye, was used for signal normalization across the plate. Primer sequences are detailed in Table 2. For normalization, 18S RNA was used as a reference transcript. Annealing temperature was 60°C for all primers. Serial dilution of samples was used to evaluate primers efficiency and the appropriate cDNA concentration that yields linear changes. Melting curve analysis and amplicons sequencing verified end product identities.
Isolation and treatment of primary human mononuclear cells Isolation of NBC involved the use of lymphocyte separation medium (LSM) (MP Biomedicals, Irvine, CA, USA; Cat. No. 50494X), using Ficoll-based reagent as instructed. Outdated human Buffy coats kept at RT were received from the blood bank at the Hadassa Medical Center, Ein-Kerem (Jerusalem, Israel). The experiments were approved by the Hebrew University’s committee for studies involving human- derived materials. After isolation, cells were incubated at 37°C for 1 h. NBC, which do not adhere to the flask, were collected. After overnight incubation, mononuclears were treated with 0.4 ng/ml rhIL-6 (R and N systems at. No. 206-IL, Minnesota, USA). Three hours
Table 2 Primers employed for RT-PCR measurements Isoform
Accession #
Forward primer 5′-3′
Position
Reverse primer 5′-3′
Position
1.hAChE-R Isoform 2. hN-AChE 3.h18S rRNA
AY750146 AY389977 M10098
cttcctccccaaattgctc atgctaggcctggtgatgt cgccgctagaggtgaaattc
7092-7110 189-207 1049-1068
ggggagaagagaggggttac ggcagtggaaacttctgga ttggcaaatgctttcgctc
7177–7196 285–303 1092–1110
Shown are the oligonucleotide sequences employed for RT-PCR amplification of the corresponding transcripts and their accession number and positions within the GeneBank.
1244
J Mol Med (2007) 85:1239–1251
after IL-6 administration, cellular proteins were extracted and AChE activity was measured. Statistical analysis Results were analyzed by three-way ANOVAs with age and Cholinergic Status (Enhancers vs Suppressors), as betweensubjects factors and time (baseline and the various time periods after endotoxin administration) as within subjects, repeated measures factor. Age was not found to influence any of the measures, except IL-6 production, so only the results with respect to the Cholinergic Status are reported. Significant ANOVAs were followed by analysis of the differences in each time point, using Student’s t tests.
Results Variable endotoxin reactions in Enhancers and Suppressors To explore differences in the post-endotoxin changes in plasma AChE, which regulates the levels of ACh, selfcontrolled data scores (after endotoxin vs after saline injection) were derived for each subject, where baseline (t0) free AChE activities were taken as 100%; subjects whose post endotoxin activities increased (six of the younger and four of the elderly volunteers, Table 1) were defined as Enhancers, whereas those with post endotoxin decreases in AChE activity were designated Suppressors (Fig 1a–d). Overall, Enhancers demonstrated significantly greater postexposure AChE activities, regardless of age (p
